LU502044B1 - Cre/lox TRANSIENT EXPRESSION VECTOR SYSTEM AND USE THEREOF - Google Patents

Abstract

The present disclosure provides a Cre/lox transient expression vector system and use thereof, and belongs to the technical field of genetic engineering. The Cre/lox transient expression vector system includes independent vectors carrying T7 RNA polymerase and T7 promoter, respectively; plant expression vector pC35Spro::T7RP includes a 35S promoter, a lox site, a Bar gene, an NOS terminator, a 35S promoter, a T7 RNA polymerase gene, an NOS terminator, a lox site, and an OXY gene; plant expression vector pCT7pro::Cre includes a 35S promoter, a lox site, a Bar gene, an NOS terminator, a T7 promoter, a Cre gene, a T7 terminator, a lox site, and a CP4 EPSPS gene. The expression vector system, combined with a crossing strategy and an automatic excision strategy, crosses two different types of transgenic resistant rapes to remove marker genes.

Description

BL-5484

LU502044

Cre/lox TRANSIENT EXPRESSION VECTOR SYSTEM AND USE THEREOF

TECHNICAL FIELD

[01] The present disclosure belongs to the technical field of genetic engineering, and particularly relates to a Cre/lox transient expression vector system and use thereof.

BACKGROUND ART

[02] Cre/lox technology has been used successfully in model plants such as Arabidopsis thaliana and tobacco. However, the use of this technology in other crops is limited, particularly in cabbage-type polyploid crops. In addition, there is yet potentiality for the improvement of the wider use of the Cre/lox technology. There are three major aspects. First, before the induced shearing, due to a complicated integration process, Southern blot is needed to select single-copy transgenic plants. Second, a marker-free plant cannot be obtained until a given amount of inducer is sprayed to the whole candidate plant for days to maintain the shear force. Third, the leakage of tissue-specific promoter may lead to downregulated expression of target tissue or failure to obtain resistant callus due to early production of shearing in the callus phase. This will reduce the overall efficiency of the method, leading to a failure to achieve the desired objective of efficient deletion of a selective marker.

SUMMARY

[03] In view of this, an objective of the present disclosure is to provide a Cre/lox transient expression vector system and use thereof, the Cre/lox transient expression vector system combines with a crossing strategy and an automatic excision strategy, including two sets of independent vectors carrying T7 RNA polymerase and T7 promoter, respectively, and crossing these two types of transgenic resistant rapes can remove marker genes.

[04] The present disclosure provides a Cre/lox transient expression vector system, including plant expression vectors pC3SSpro::T7RP and pCT7pro::Cre.

[05] The present disclosure has the following beneficial effects:

[06] In the present disclosure, hybridized T7 promoter can promote the expression of a Cre 1 gene and cut out a fragment between two lox sites, so that the Cre gene is cut out after the T7 promoter works, reducing potential risk of constitutive expression of Cre.

[07] The method of the present disclosure avoids a new round of transformation and selection compared with multiple transformation strategies.

[08] Compared with an automatic excision strategy of the Cre gene having a heat shock- induced promoter, a chemically inducible promoter, or a tissue-specific promoter, the method of the present disclosure has no risk of leakage. The leakage of the automatic excision strategy may lead to accidental excision and downregulation of expression of target tissue and reduce overall deletion efficiency.

[09] The Cre/lox transient expression vector system can obtain two herbicide-resistant transgenic rapes by transformation: pC3SSpro::T7RP and pCT7pro::Cre transgenic rapes are glufosinate-resistant Bar” plants. After crossing, in case of the production of excision effect, F1 rapes show EPSPSTOXY™ and resistance to glyphosate and bromoxynil; in case of no excision,

F1 rapes still show Bar” and resistance to glufosinate.

BRIEF DESCRIPTION OF THE DRAWINGS

[010] FIG. 1 illustrates a structure of a marker automatic excision vector, where (A) shows a structure of plant expression vector pC35Spro::T7RP, and (B) shows a structure of plant expression vector pCT7pro::Cre;

[011] FIG. 2 illustrates the detection of pC35Spro::T7RP and pCT7pro::Cre transgenic rape plants (A and C) by PCR assay amd the detection of Bar protein (B and D) by test strips, where

M represents a DL 1000 DNA Marker; 1 to 43 and 1 to 24 represent To plants; WT represents wild-type ‘ZS6’; P1 represents expression vectors pC35Spro:: T7RP (A) and pCT7pro::Cre (C);

P2 represents a transgenic Brassica napus Ms8Rf3-positive plant (with Bar protein);

[012] FIG. 3 shows a map of a vector of pC35Spro::T7RP;

[013] FIG. 4 shows a map of a vector of pCT7pro::Cre.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[014] Example 1 2

[015] The plant material of the example was tetraploid B. napus, and the genotype was ‘Zhongshuang 6’ (‘ZS6’), provided by the Oil Crops Research Institute, Chinese Academy of

Agricultural Sciences (Wuhan, China). ‘ZS6’ has low content of erucic acid and glucosinolates, with an oil content of 39.08%. ‘ZS6’ is an elite cultivar in China. Transgenic and wild-type plants were cultivated in a 3:1 mixture of moss peat (PINDSTRUP, Denmark) and field soil under potted condition. Under the light intensity of 44 umol/m°s and the relative humidity of 60-90%, these plants grew at 20 + 2°C on a 16 h light/8 h dark cycle.

[016] Construction of plant expression vectors pC3SSpro::T7RP and pCT7pro::Cre

[017] Plant expression vector pC35Spro:: T7RP had a 35S promoter, a lox site, a Bar gene, an

NOS terminator, a 35S promoter, a T7 RNA polymerase gene, an NOS terminator, a lox site, and an OXY gene (bromoxynil-resistant gene) (FIG. 1A). Plant expression vector pCT7pro::Cre included a 35S promoter, a lox site, a Bar gene, an NOS terminator, a T7 promoter, a Cre gene, a T7 terminator, a lox site, and a CP4 EPSPS gene (glyphosate-resistant gene) (FIG. 1B). The

Bar gene was derived from Streptomyces hygroscopicus, which encodes a phosphinothricin N- acetyltransferase and confers resistance to glufosinate on plants. The CP4-EPSPS was derived from Salmonella typhimurium, which encodes 5-enolpyruvate phenyloxalate-3-phosphate lipase and confers resistance to glyphosate on plants. The OXY gene was derived from Klebsiella pneumoniae ssp. ozaenae, which encodes bromoxynil hydrolase and confers resistance to bromoxynil on plants.

[018] Specific sequence information is as follows:

[019] Bar gene (SEQ ID No: 1)

[020] atggacccagaacgacgcecggecgacatecgccateccacegagecegacateecggcggtetgcaccategtcaacc actacatcgagacaagcacggtcaacttccgtaccgagecgeaggaaccgeaggagtggacggacgacctegteegtetgegggag cgctatcectggetegtegecgaggtggacggegaggtegecggeatcgectacgegggeccctggaaggeacgeaacgectacga ctggacggccgagtegaccgtgtacgteteccccegecaccageggacgggactgggctecacgetctacacccacctgetgaagtee ctggaggcacagggcttcaagagegtggtegetgtecatcgggetgcccaacgaccegagegtgcgeatgeacgaggegcteggatat gcececcecggcatectecgegcegecgecttcaagcacgegaactgecatgacatggetttctggcagctegacttcagectgccg gtaccgceccetecgetectgeccetcaccgaaatctga

[021] CP4 EPSPS gene (SEQ ID No: 2)

[022] atggcgcaagttagcagaatctgcaategtetgcagaacccatetettateteccaatetetegaaatecagtcaacgcaaatete cettatcgetttetctgaagacgcagcagcateccacgagcttatecgatttcetcatcetegegattgaagaagagtgggatgacgttaatt 3 gectetgagettcgteetettaagetcatetettctetttccacgecetecatgcttcacgetgcaagcagecetccagcaactgctegtaa gtectetgetetttctegaaccatecgtattccagetgacaagtctateteccacagetccttcatetttggagetetcectagcgstgaaact cetatcaccgetettttggaagetgaagatettatcaacactestaagectatgcaagctatggetgccagaatccgtaaggaagetgata cttggatcattgatggtgttggtaacggtggactecttgetectgaggetectctegatttcggtaacgetgeaactggttgcegtttgactat gggtcttgttogtotttacgatttcgatageactttcattggtgacgcttctetcactaagegtecaatgggtegtgtattgaacceacttcgeg aaatgggtgtgcaggtgaagtctgaagacggtgategtettceagttaccttgegtggaccaaagactccaacgecaatcacctacaggg tacctatggcttecectcaagtgaagtecgctettctecttectgetetcaacaceccaggtatcaccactettatcgagccaatcatgacte gtgaccacactgaaaagatgcttcaagettttgstectaaccttaccettgagactgatectgacgstetecetaccatecetettgaaget cetgetaagctcaccgetcaagtgattgatettccagetgatecateetctactecttteccattgettecteccttecttettccagettecga cgtcaccatccttaacgttttgatgaacccaacccgtactggtcetcatcttgactctgcaggaaatgggtgecgacatcgaagtgatcaace cacgtettectgetegagaagacatgectgacttecetettcettettctactttgaaggetettactettccagaagaccetecteettctat gatcgacgagtatccaattetcgctettecagctecattcectgaagetectaccettatgaacgetttggaagaactecetattaaggaaa gcgaccgtctttctgetgtcgcaaacggtctcaagetcaacggtgttgattgegatgaaggtgagacttctetegtegtecgtggtegtect gacggtaagggtctcggtaacgcttctggageagetgtegetacccacctegatcaccgtategetatgagcettectegttatgggtcetegt ttctgaaaaccctgttactgttgatgatgctactatgatcgctactagettcccagagttcatggatttgatggctggtettggagetaagateg aactctccgacactaaggetgcttga

[023] OXY gene (SEQ ID No: 3)

[024] Atggacaccactttcaaagcagecgetgttcaggecgaaccggtatggatggatgecgetgecaacagecgataagaccgte acgctagtagctaaagecgeageggetggegegeagetegtegeatttcccgaattgtggattccgggctacccaggattcatgetcacg cacaaccaaaccgaaaccctaccattcatcattaaataccgcaagcaggeaatcgecgecgatggaccagaaatcgaaaaaattcgetg cgeggctcaggageataacattgegetetectttgggtacagegaacgggcetggecgtacgcetctacatgtcacaaatgettatcgatgee gatggcatcaccaaaattcgtcgtcgaaagetcaaaccaacccgetttgaacgagaactcetttggegaaggtgacggatcggacttacag gtcgeccaaactagegttggtegggtgggtacectcaactgecgeggagaatttgcagtegetaaacaagtttgegettgetgecgagggt gaacagatacatatctccgectggecattcacgettggaagecectgtgctegteggagactecatcggegecatcaaccaggtetacgeg gccgagacggggaccttegttctcatgtcgacgeaggtggttggaccgaccggeatcgecgecttcgagatcgaagacaggtacaace cgaatcagtatcttggtggtggstacgcgeggatctacgggectgacatgeagttgaagagceaagtegttgtcaccgaccgaagagggc atcetctacgccgagategacctetcgatecttgaggcagcaaagtactegctegateccacggeccactattegcgcectgatetettca gcetetegattaaccggcaacgecagectecgetetcagaagttatcgactcaaacgetgacgaggacecgagagcagcatecgage ccgacgagegegatcatgagetegtaatetctacgecaatagegettctaccecettattecegacattectaa

[025] Construction method:

[026] (1) Vector preparation: A vector backbone pCAMBIA1300 was treated through plasmid linearization by PCR, aiming to obtain other backbone fragments except left and right border 4 including fragments. PCR primers included: L: gtgtttgacaggatatattgge (SEQ ID No: 12); R: agcgtcaatttgtttacaccac (SEQ ID No: 13). The amplified fragment included right border, kanamycin, pBR322 ori, pBR322 bom, pVS1 rep, pVS1 sta, and left border (FIG. 3). High- fidelity Pfu DNA Polymerase (Invitrogen™Platinum™ SuperFi™ DNA Polymerase) was used for amplification. The length of the amplified fragment was 6,300 bp. The vector fragment amplified by PCR was recovered by gel extraction, and the correctness of the sequence was determined by sequencing. The vector fragment served as a vector backbone for pC35Spro::T7RP and pCT7pro::Cre.

[027] (2) Preparation of insert of interest: The plant expression vector pC35Spro::T7RP was synthesized into a 7,316 bp fragment having a left border, a 35S promoter, a lox site, a Bar gene, an NOS terminator, a 35S promoter, a T7 RNA polymerase gene, an NOS terminator, a lox site, an OXY gene (bromoxynil-resistant gene), and a right border (FIG. 1A) in Tsingke Biotechnology

Co., Ltd. The plant expression vector pCT7pro::Cre was synthesized into a 5,935 bp fragment including a left border, a 35S promoter, a lox site, a Bar gene, an NOS terminator, a T7 promoter, a Cre gene, a T7 terminator, a lox site, and a CP4 EPSPS gene (glyphosate-resistant gene), and a right border (FIG. 1B) in Tsingke Biotechnology Co., Ltd. The fragments synthesized by the company were loaded in a pUCS57 vector and electroporated into competent Escherichia coli cells to culture Æ. coli; the plasmid was extracted and recovered by digestion to enrich and purify the fragment of interest. Both ends of the linearized fragment of interest included a left border (26 bp) and a right border (26 bp), respectively, which were consistent with both ends of the linearized vector and convenient for the conduct of splicing.

[028] (3) Preparation of a reaction system by thawing HB-infusion™ Master mix on ice and mixing well: The insert of interest and the linearized vector plasmid were 0.3 pmol in total, and the insert of interest and the linearized vector plasmid had a molar ratio of 3:1; HB-infusion™

Master mix (2x) was 10 pL in volume diluted with ultrapure water to 20 uL. The reaction system was incubated at 50°C for 20 min, transformed into DHS5a competent £. coli, and spread onto an

LB plate supplemented with kanamycin for culture at 37°C overnight; clones on the plate were picked for PCR identification. Two vectors, pC35Spro::T7RP (FIG. 3) and pCT7pro::Cre (FIG. 4), were produced by fusion reaction of respective insert of interest and linearized vector backbone.

[029] Plant genetic transformation

[030] pC3SSpro::T7RP and pCT7pro::Cre plasmids were introduced into Agrobacterium 5 tumefaciens GV3101 by electroporation and cultured on a LB agar plate (supplemented with 50 mg/L gentamycin, 50 mg/L rifampicin, and 50 mg/L kanamycin) at 37°C, and positive clones were screened and verified by PCR. A single positive Agrobacterium colony was transformed into B. napus, and ‘ZS6’ was used as a recipient. Seeds of ‘ZS6’ were soaked in 75% ethanol for 1 min and 1.5% mercuric chloride for 10-15 min; after germination in the dark for 5-6 days, etiolated hypocotyl was cut into 7 mm segments and soaked with 50 mL of Agrobacterium sp. (OD value = ~0.3) in liquid DM medium (MS + 30 g/L sucrose + 100 uM acetosyringone, pH 5.8) for 0.5 h. Subsequently, the hypocotyl air-dried on the surface was transferred into a co- culture medium (MS + 30 g/L sucrose + 18 g/L mannitol + 1 mg/L 2,4-D + 0.3 mg/L kinetin + 100 uM acetosyringone + 8.5 g agarose, pH 5.8) to culture for 2 days and proliferated in a selection medium (MS + 30 g/L sucrose + 18 g/L. mannitol + 1 mg/L 2,4-D + 0.3 mg/L kinetin + 20 mg/L AgNOs + 8.5 g/L agarose + 20 mg/L glufosinate + 250 mg/L carbencillin disodium, pH 5.8). Three weeks later, the hypocotyl-derived callus was transferred into a regeneration medium (MS + 10 g/L sucrose + 0.25 g/L xylose + 0.6 g/L 2-(N-morpholino)ethanesulfonic acid monohydrate + 2 mg/L zeatin + 0.1 mg/L indole-3-acetic acid + 8.5 g/L agarose + 20 mg/L glufosinate + 250 mg/L carbencillin disodium, pH 5.8) to culture for two weeks. The hypocotyl was transferred into a new regeneration medium every other week. A total of 3-4 regeneration cycles were needed. The formed seedling was transferred into a rooting medium (MS + 10 g/L. sucrose + 10 g/L. agar, pH 5.8) for rooting (for approximately three weeks). The transformed plant with roots was transplanted in a flowerpot for growth. The positive transformation efficiency was calculated according to the percentage of the number of PCR-positive and test strip-positive transformed plants to the total number of rooted seedlings.

[031] Identification of transgenic B. napus

[032] Genomic DNA was extracted from leaves of To and T1 transgenic plants using Plant

Genomic DNA Kit (DP305, TIANGEN, China); a 440 bp fragment was amplified by PCR using a primer pair, 5'-gaagtcagctccagaac-3' (SEQ ID No: 6) and S'-gcccagtcagctaac-3' (SEQ ID No: 7), demonstrating that the Bar gene was present in the transgenic plants. A 459 bp fragment was amplified by using a primer pair, 5'-cgtgaactgatgctgacg-3' (SEQ ID No: 8) and 5'- ttgacttgagacgcgtge-3' (SEQ ID No: 9), demonstrating that the EPSPS gene was present in the transgenic plants. A 496 bp fragment was amplified by using a primer pair, 5'- caacagccgataagaccgtg-3' (SEQ ID No: 10) and 5'-ggccaggeggagatagttat-3' (SEQ ID No: 11), demonstrating that the OXY gene was present in the transgenic plants.

[033] The system of the above PCR included: 10x Amplification Buffer (5 pL), four dNTP 6

Mixes (each 200 pmol/L), primers (each 10-100 pmol), template DNA (0.1-1 pg), Taq DNA

Polymerase (1.25 U), Mg” (1.5 mmol/L), and double distilled water (to 50 pL). The PCR program included initial denaturation, cycles of denaturation, annealing and extension, and extension. The target fragment was amplified. Specifically, the target fragment underwent the following steps: initial denaturation at 94°C for 3 min, 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s and extension at 72°C for 30 s, and finally extension at 72°C for 10 min. The PCR amplification result was obtained by 0.5%-3% agarose gel electrophoresis, and bands of PCR products were finally observed by staining.

[034] Using the test strip assay kit, transgenic rape and its selfed or ‘ZS6’ hybrid progenies were identified by test strips, and Bar or CP4-EPSPS protein was detected.

[035] Under greenhouse conditions, leaves of 3-week-old B. napus seedlings, used as experimental materials, were applied with 500 mg/L. glufosinate solution so that B. napus seedlings were resistant to Bar protein. One week later, the expression of Bar in plants was evaluated. Necrotic lesions appeared on the leaves, indicating the deficiency of Bar protein, but necrosis did not appear on the leaves of positive plants. For the evaluation of To transgenic plants, the statistical data summarized in Table 2 was from the intersection set of the above results; for

T1 seedlings, the statistical data in the table were PCR results.

[036] Experimental results

[037] Transformation of B. napus

[038] Expression vectors of pC35Spro::T7RP and pCT7pro::Cre were constructed (FIG. 1 and

Table 1) and transformed into B. napus by the Agrobacterium-mediated method, respectively, in order to test the marker gene excision effect based on the crossing and automatic excision strategies. OXY and CP4 EPSPS genes were used as target genes, and Bar was used as a selectable marker gene (FIG. 1 and Table 1). pC35Spro::T7RP contained two lox sites: one was located between the 35S promoter and the open reading frame (ORF) of Bar; the other was followed by the NOS terminator, the 35S promoter and the T7 RNA polymerase gene, located downstream of the second NOS terminator, and followed by a promoter-deleted OXY gene.

Excision of Cre/lox-mediated marker gene Bar and T7 RNA polymerase gene led to the expression of the OXY gene under the control of the 35S promoter, providing a biological detection means for the expression of the OXY gene. pCT7pro::Cre included Cre and lox structures, which were also necessary for marker gene excision in the crossing strategy. It had two lox sites: one was located between the 35S promoter and the ORF of Bar; the other was 7 followed by the NOS terminator, the T7 promoter and the Cre gene, located downstream of the

T7 terminator, and followed by a promoter-free CP4 EPSPS gene. Excision of marker genes Bar and Cre led to the expression of the CP4 EPSPS gene under the control of the 35S promoter, so the excision effect could be detected and verified by the expression of the OXY gene.

Agrobacterium sp. strains carrying pC3SSpro::T7RP and pCT7pro::Cre were infected into the etiolated hypocotyl part of ‘ZS6’, respectively. Hypocotyl explants were placed on a selection medium supplemented with 20 mg/L glufosinate, and rooted seedlings were transplanted in soil for further analysis.

[039] Table 1 The information on the construction of two vectors of the Cre/lox system

Name of the vector Key factor Target gene Marker gene to be selected pC35Spro::T7RP lox and T7 RNA polymerase OXY Bar pCT7pro::Cre lox,Cre and T7 promoter CP4 EPSPS Bar

[040] Identification of To transgenic B. napus

[041] For all To pC3SSpro::T7RP and pCT7pro::Cre transgenic B. napus plants (lines), the presence of the Bar gene was detected by PCR and Bar protein test strips (FIG. 2 and Table 2).

Detection results are shown Table 2, and the statistical data are from the intersection set of genomic PCR and strip tests. pC35Spro::T7RP was transformed into 385 B. napus hypocotyl explants to obtain 76 transgenic plants, 52 of which were Bar-positive (FIG. ZA and 2B); pCT7pro::Cre was transformed into 304 explants to obtain 62 transgenic plants, 46 of which were Bar-positive (FIG. 2C and 2D). The regeneration rate and positive transformation efficiency of pC35Spro:: T7RP were 19.74% and 68.42%, respectively; the regeneration rate and positive conversion rate of pCT7pro::Cre were 20.39% and 74.19%, respectively (Table 2).

[042] Table 2 The transformation efficiency of To pC3SSpro::T7RP and pCT7pro::Cre transgenic plants

Total number of Number of Regeneration Bar+ Transformation

Vector en en explants regenerated seedlings efficiency (%) seedling efficiency (%) pC35Spro::T7RP 385 76 19.74 52 68.42 8 pCT7pro::Cre 304 62 20.39 46 74.19

9

SEQUENCE LISTING

<110> Oil Crops Research Institute, Chinese Academy of

Agricultural Sciences <120> Cre/lox TRANSIENT EXPRESSION VECTOR SYSTEM AND USE THEREOF <130> HKJU202201591 <160> 13 <170> PatentIn version 3.5 <210> 1 <211> 552 <212> DNA <213> Artificial Sequence <220> <223> Bar gene <400> 1 atggacccag aacgacgcec ggecgacate cgccgtecca ccgaggcgga catgecggcg 60 gtctgcacca tcgtcaacca ctacatcgag acaagcacgg tcaacttecg taccgagceg 120 10 caggaaccgc aggagtggac ggacgacete gtecgtetge gggagegeta tecctggcte 180 gtcgccgagg tggacggcga ggtegccggc atcgectacg cgggcecctg gaaggcacgc 240 aacgcctacg actggacgge cgagtegacc gtgtacgtct CCCCCCHCCA ccageggacg 300 ggactgggct ccacgctcta cacccacctg ctgaagtecc tggaggcaca gggcttcaag 360 agcetggtcg ctgtcatcgg gctgcccaac gaccecgageg tgcgcatgca cgaggcgcte 420 ggatatgccc cecgcggcat getgegggeg gccgecttca agcacgggaa ctggcatgac 480 gtgggtttect ggcagctgga cttcagectg ccggtaccgc ceegtecggt cetgeeegte 540 accgaaatctga 552

<210> 2 <211> 1596 <212> DNA <213> Artificial Sequence

<220> <223> CP4 EPSPS gene <400> 2 atggcgcaag ttagcagaat ctgcaatggt gtgcagaacc catctcttat ctccaatcte 60 tcgaaatcca gtcaacgcaa atctccctta tcggtttetc tgaagacgca gcagcatcca 120 cgagcttatc cgatttcgtc gtcgtgggga ttgaagaaga gtgggatgac gttaattggc 180 tctgagcttc gtectcttaa ggtcatgtct tctetttcca cggegtgeat gettcacggt 240 gcaagcagce gtccageaac tgetegtaag tectetggte tttctggaac cgtecgtatt 300

11 ccaggtgaca agtctatctc ccacaggtece ttcatatttg gaggtctcge tagcggtgaa 360 actcgtatca ccggtctttt ggaagetgaa gatgttatca acactggtaa ggctatgcaa 420 gctatgggtg ccagaatccg taaggaaggt gatacttgga tcattgatgg tgttggtaac 480 ggtggactcce ttgctectga ggeteetete gatttcggta acgetgeaac tggttgecgt 540 ttgactatgg gtcttgttgg tetttacgat ttcgatagea ctttcattgg tgacgcettct 600 ctcactaagc gtccaatggg tcgtgtgttg aacccacttc gcgaaatggg tgtgcaggtg 660 aagtctgaag acggtgatcg tcttccagtt accttgegtg gaccaaagac tccaacgcca 720 atcacctaca gggtacctat ggcttccget caagtgaagt ccgctattet gettgctggt 780 ctcaacaccc caggtatcac cactgttatc gagccaatca tgactcgtga ccacactgaa 840 aagatgcttc aaggttttgg tectaacctt accgttgaga ctgatgetga cggtgtacgt 900 accatccgtc ttgaaggtcg tggtaagctc accggtcaag tgattgatgt tccaggtgat 960 ccatcctcta ctgctttecc attgattect gecttgettg ttccaggtte cgacgtcace 1020 atccttaacg ttttgatgaa cccaacccgt actggtetca tettgactct gcaggaaatg 1080 ggtgccgaca tcgaagtgat caacccacgt cttgetggtg gagaagacgt ggctgacttg 1140 cgtgttcgtt ctictacttt gaagggtgtt actgttccag aagaccgtge tecttctatg 1200 atcgacgagt atccaattct cgetgttgea gctgcatteg ctgaaggtge taccgttatg 1260 aacggtttge aagaactccg tgttaaggaa agegaccgtc tttetgetgt cgcaaacggt 1320 ctcaagctca acggtgttga ttgcgatgaa ggtgagactt ctetcgtegt gegtggtegt 1380 cctgacggta agggtctcgg taacgcttet ggageagetg tcgctaccca cetegatcac 1440 cgtatcgcta tgagcttect cgttatgggt ctegtttctg aaaaccctgt tactgttgat 1500 gatgctacta tgatcgctac tagcttecca gagttcatgg atttgatggc tggtcttgga 1560 gctaagatcg aactctecga cactaaggct gettga 1596 <210> 3

12

<211> 1050 <212> DNA <213> Artificial Sequence <220> <223> OXY gene <400> 3 atggacacca ctttcaaagc agecgetgtt cageccgaac cggtatggat ggatgccect 60 gcaacagccg ataagaccgt gacgctagta getaaagecg cageggetgg cgegeagete 120 gtcgcattte ccgaattgtg gattccggec tacccaggat tcatgctcac gcacaaccaa 180 accgaaaccc taccattcat cattaaatac cgcaagcagg caatcgccgc cgatggacca 240 gaaatcgaaa aaattcgctg cecgectcag gagcataaca ttgegcetete ctttgggtac 300 agcgaacggg ctggeegtac getctacatg tcacaaatec ttatcgatge cgatggeate 360 accaaaattc gtcgtcgaaa gctcaaacca acccectttg aacgagaact ctttggcgaa 420 getgacggat cggacttaca gatcgcccaa actagcettg gtcggetggs tgcectcaac 480 tgcgeggaga atttgeagte gctaaacaag tttgcecttg ctgecgaggg tgaacagata 540 catatctccg cctggccatt cacgettgga agcectetec tegtcggaga ctecatcgge 600 gccatcaacc aggtctacge ggecgagacg gggacctteg ttctcatetc gacgeaggtg 660 gttggaccga ccggeatcge ceccttegag atcgaagaca ggtacaacce gaatcagtat 720 cttggtggtg ggtacgegeg gatctacggg cctgacatec agttgaagag caagtcettg 780 tcaccgaccg aagagggcat cgtctacgee gagategacc tetegatect tgaggcagca 840 aagtactcgc tegateccac gggecactat tcgegeectg atgtgttcag catetcgatt 900 aaccggcaac ggeagectge ggtgtcagaa gttatcgact caaacgetga cgaggacceg 960 13 agagcagcat gcgagcccga cgagggggat cgtgaggteg taatctctac ggcaataggg 1020 gttctacccc gttattgegg acattectaa 1050 <210> 4 <211> 13550

<212> DNA <213> Artificial Sequence <220>

<223> nucleotide sequence of the plant expression vector pC3SSpro::T7RP <400> 4 gttactagat cgaattcacc caacttaatc gccttgcagc acatccecect ttcgecaget 60 ggcgtaatag cgaagaggec cgeaccgate geecttecca acagttgege agectgaatg 120 gcgaatgcta gagcagcttg agettggate agattetcet ttccegectt cagtttaaac 180 tatcagtgtt tgacaggata tattggcggg taaacctaag agaaaagage gtttattaga 240 ataacggata tttaaaaggg cgtgaaaagg tttatccgtt cgtecatttg tatgtgcatg 300 ccaaccacag gatteccctc gggatcaaag tactttgate caaccectec getgetatag 360 tecagtcggc ttetgacgtt cagtgeagece gtettctgaa aacgacatgt cgcacaagtc 420 ctaagttacg cgacagectg ccgccectecc cttttectgg cgttttcttg tcgegtgttt 480 tagtcgcata aagtagaata cttgcgacta gaaccggaga cattacgcca tgaacaagag 540 ceccgccect gecctectgs getatgeccg cetcagcacc gacgaccagg acttgaccaa 600 ccaacgggce gaactgcacg cggccgectg caccaagctg ttttccgaga agatcaccgg 660 caccaggcgc gaccgcecgg agctggccag gatecttgac cacctacgec ctggegacgt 720

14 tgtgacagtg accaggctag accgectgge ccgeageacce cgcgacctac tggacattge 780 cgagcgcatc caggaggceg gegegggcect gegtagectg gecagageegt gggecgacac 840 caccacgccg gccggccgca tggtgttgac cgtgttegee ggeattgecg agttcgageg 900 ttccctaatc atcgaccgea cccggagegg gegegaggee gccaaggcec gaggcetgaa 960 gtttggccee cgeectacce tcaccecggc acagatcgeg cacgeecgeg agetgatcga 1020 ccaggaaggc cgcaccetga aagaggeggc tgeactgctt ggegtgeate getcgaccect 1080 gtaccgcgca cttgagcgca gcgaggaagt gacgeeccace gaggecagge ggcgcggtgc 1140 cttccgtgag gacgcattga ccgaggecga cgeectggeg gccgccgaga atgaacgcca 1200 agaggaacaa gcatgaaacc gcaccaggac ggccaggacg aaccgttttt cattaccgaa 1260 gagatcgagg cggagatgat cgcggccggg tacgtetteg agccgcccgc gcacgtetca 1320 accgtgcggc tgcatgaaat cctggccggt ttgtetgatg ccaagetgge ggectggecg 1380 gccagcttgg ccgctgaaga aaccgagege cgecgtetaa aaaggtgatg tgtatttgag 1440 taaaacagct tgegtcatge ggtegetgeg tatatgatge gatgagtaaa taaacaaata 1500 cgcaagggga acgcatgaag gttatcgetg tacttaacca gaaaggeggg tcaggcaaga 1560 cgaccatcge aacccatcta geccgcgcec tecaactegc cggggecgat gttetgttag 1620 tcgattccga tccccagggc agtgcccgcg attgggcggc cetgcgggaa gatcaaccgc 1680 taaccgttgt cggcategac cgcccgacga ttgaccgcga cgtgaaggec atcggccggc 1740 gcegacttcgt agtgatcgac ggagcgcecc aggeggcgga cttgectatg tecgcgatca 1800 aggcagcega cttegtgetg attccggtge agecaagecc ttacgacata tgggecaccg 1860 ccgacctggt ggagetggtt aagcagceca ttgaggtcac ggatggaagg ctacaagegg 1920 cctttgtcgt gtcgcgggcg atcaaaggea cgegeategg cggtgaggtt gecgaggege 1980 tggccgggta cgagetgecc attettgagt cecgtatcac gecagegegtg agctacccag 2040 gcactgeege cgccggcaca accgttettg aatcagaacc cgagggegac getgeecgeg 2100 aggtccaggc getggecget gaaattaaat caaaactcat ttgagttaat gaggtaaaga 2160

15 gaaaatgagc aaaagcacaa acacgctaag tgeccggecgt ccgagegeac gcagcagcaa 2220 ggctgcaacg ttggccagee tggcagacac gccagccatg aagcgggtca actttcagtt 2280 gccggcegag gatcacacca agctgaagat gtacgeggta cgccaaggca agaccattac 2340 cgagctgcta tetgaataca tcgegeaget accagagtaa atgagcaaat gaataaatga 2400 gtagatgaat tttagcggct aaaggaggcg gcatggaaaa tcaagaacaa ccaggcaccg 2460 acgcegtgga atgcoccatg tgtggaggaa cgggeggttg gccaggceta agcggctggg 2520 ttgtctgeeg gccctgcaat ggcactggaa cecccaagec cgaggaateg gegtgacggt 2580 cgcaaaccat ccggcccggt acaaatcgge gcggcectgg gtgatgacct ggtggagaag 2640 ttgaaggccg cgcaggccgc ccageggeaa cgeatcgagg cagaagcacg ceccggtgaa 2700 tcgtggcaag cggccectga tcgaatecgc aaagaatecc ggcaaccgce ggeageeggt 2760 gcgccgtega ttaggaagee goccaagggc gacgagcaac cagatttttt cettecgatg 2820 ctctatgacg tgggcacceg cgatagtcge agcatcatgg acgtggcegt tttecgtetg 2880 tcgaagcgtg accgacgagc tggcgagetg atccgctacg agcttccaga cgggcacgta 2940 gaggtttccg cagggccggc cggcatggce agtgtgtggg attacgacct ggtactgatg 3000 gcggtttcee atctaaccga atccatgaac cgataccggg aagggaaggg agacaagece 3060 ggccgegtgt tecgtecaca cgttgeggac gtactcaagt tetgecggeg agccgatgge 3120 ggaaagcaga aagacgacct ggtagaaacc tgcattcggt taaacaccac gcacgttgec 3180 atgcagcgta cgaagaaggc caagaacggc cgectggtga cggtatccga gggtgaagec 3240 ttgattagcc gctacaagat cgtaaagage gaaaccgggc ggecggagta catcgagate 3300 gagctagctg attggatgta ccgegagate acagaaggca agaacccgga cgtgetgacg 3360 gttcaccccg attacttttt gatcgatcce ggeatcggec gttttetcta ccgectggca 3420 cgeecgegecg caggcaaggc agaagccaga tggttgttca agacgatcta cgaacgcagt 3480 ggcagcgceg gagagttcaa gaagttetgt ttcaccgtec gcaagctgat cgggtcaaat 3540 gacctgccgg agtacgattt gaaggaggag gcggggcagg ctggeccgat cctagtcatg 3600

16 cgctaccgea acctgatcga gggcgaagca tecgccgett cctaatetac ggagcagatg 3660 ctagggcaaa ttgccctagc aggggaaaaa ggtecgaaaag gtetctttee tgtggatage 3720 acgtacattg ggaacccaaa gccgtacatt gggaaccgga acccgtacat tgggaaccca 3780 aagccgtaca ttgggaaccg gtcacacatg taagtgactg atataaaaga gaaaaaaggc 3840 gatttttccg cctaaaactc tttaaaactt attaaaactc ttaaaacccg cctggectgt 3900 gcataactgt ctggccagcg cacagecgaa gagctgcaaa aagcgcctac cetteggteg 3960 ctgcgctecc tacgeeeege cgettegegt cggectatcg cggeegetgg cecgetcaaaa 4020 atggctggec tacggecagg caatctacca gggegeggac aagecgegec gtcgccacte 4080 gaccgeegge geecacatca aggeaccctg cetecgegegt ttcggtgatg acggtgaaaa 4140 cctctgacac atgcagctec cggagacggt cacagettgt ctgtaagcgg atgccgggag 4200 cagacaagcc cgtcagggeg cetcagcggg tattggcggg tgetcggggcg cagccatgac 4260 ccagtcacgt agcgatageg gagtgtatac tggcttaact atgcggcatc agagcagatt 4320 gtactgagag tgcaccatat gcggtetgaa ataccgcaca gatgcgtaag gagaaaatac 4380 cgcatcaggce gctettecgc ttectegete actgactege tgegeteggt cettegectg 4440 cggcgagegg tatcagctca ctcaaaggeg gtaatacggt tatccacaga atcaggggat 4500 aacgcaggaa agaacatgtg agcaaaagge cagcaaaagg ccaggaaccg taaaaaggcec 4560 gcattectgg catttttcca taggctecgc ceccctgacg agcatcacaa aaategacge 4620 tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggegtt tecccctgga 4680 agcteccteg tgegetetee tgttccgacce ctgccgctta ccggatacct gtecgecttt 4740 ctcccttcgg gaagcatggc gctttetcat agctcacect gtaggtatct cagttegatg 4800 taggtcgttc gctccaagct gggetgtgtg cacgaaceec cegttcagee cgaccgetge 4860 gcecttatceg gtaactateg tettgagtec aacccggtaa gacacgactt atcgecactg 4920 gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc tacagagttc 4980 ttgaagtggt ggcctaacta cggctacact agaaggacag tatttggtat ctgcgctetg 5040

17 ctgaagccag ttaccttcgg aaaaagagtt ggtagctett gatccggcaa acaaaccace 5100 gctggtageg gtggtttttt tetttgcaag cagcagatta cgcgcagaaa aaaaggatct 5160 caagaagatc ctttgatctt ttctacgggg tetgacgctc agtggaacga aaactcacgt 5220 taagggattt tggtcatgca ttctaggtac taaaacaatt catccagtaa aatataatat 5280 tttattttct cccaatcagg cttgateccc agtaagtcaa aaaatagcte gacatactgt 5340 tettecccga tatectecct gategaccgg acgcagaagg caatgtcata ccacttgtec 5400 geectgeege ttecteccaag atcaataaag ccacttactt tgecatcttt cacaaagatg 5460 ttgctatetc ccaggtegee gtgggaaaag acaagttect cttecgggctt ttecgtettt 5520 aaaaaatcat acagctcgeg cggatcttta aatggagtgt cttcttccca gttttcgcaa 5580 tccacatcgg ccagatcgtt attcagtaag taatccaatt cggctaagcg getgtctaag 5640 ctattcgtat agggacaatc cgatatgtcg atggagtgaa agagectgat gcactecgca 5700 tacagctcga taatcttttc agggctttgt tcatcttcat actcttccga gcaaaggacg 5760 ccatcggect cactcatgag cagattgcte cagccatcat gccettcaaa gtgcaggacc 5820 tttggaacag gcagctttec ttccagecat agcatcatgt cetttteccg ttccacatca 5880 taggtggtcc ctttataccg getgteegte atttttaaat ataggtttte attttctccc 5940 accagcttat ataccttagc aggagacatt cettecgtat cttttacgca geggtatttt 6000 tcgatcagtt ttttcaattc cggtgatatt ctcattttag ccatttatta tttccttect 6060 cttttctaca gtatttaaag ataccccaag aagctaatta taacaagacg aactccaatt 6120 cactgttcct tgcattctaa aaccttaaat accagaaaac agctttttca aagttgtttt 6180 caaagttggc gtataacata gtatcgacgg agccgatttt gaaaccgegg tgatcacagg 6240 cagcaacgct ctgtcatcgt tacaatcaac atgctaccct ccgegagatce atcegtgttt 6300 caaacccgge agcttagttg cegttettec gaatagcatc ggtaacatga gcaaagtctg 6360 ccgecttaca acggctetec cectgacgce gteccggact gatggectec ctgtatcgag 6420 tggtgatttt gtgcegagct gccggtcggg gagctattgg ctggctgetg gcaggatata 6480

18 ttgtggtgta aacaaattga cecttagaca acttaataac acattgcgga cgtttttaat 6540 gtactgaatt aacgccgaat taattcgggg gagatctatt gectagagca gettgecaac 6600 atggtggagc acgacactct cetctactec aagaatatca aagatacagt ctcagaagac 6660 caaagggcta ttgagacttt tcaacaaagg gtaatatcgg gaaacctect cggattecat 6720 tgcccagcta tetgtcactt catcaaaagg acagtagaaa aggaaggtgg cacctacaaa 6780 teccatcatt gcgataaagg aaaggctatc gttcaagatg cetctgccga cagtggtecc 6840 aaagatggac ceccacccac gaggagcate gtggaaaaag aagacgttec aaccacgtet 6900 tcaaagcaag tggattgatg tgataacatg gtggagcacg acactctcgt ctactccaag 6960 aatatcaaag atacagtctc agaagaccaa agggctattg agacttttca acaaagggta 7020 atatcgggaa acctectegg attccattge ccagctatct gtcacttcat caaaaggaca 7080 gtagaaaagg aaggtggcac ctacaaatgc catcattgcg ataaaggaaa ggctatcgtt 7140 caagatgcct ctgecgacag tggtcccaaa gatggaccee cacccacgag gagcategtg 7200 gaaaaagaag acgttccaac cacgtcttca aagcaagtgg attgatgtga tatctccact 7260 gacgtaaggg atgacgcaca atcccactat cettcgcaag accttectct atataaggaa 7320 gttcatttca tttggagagg acacgctgaa atcaccagtc tetetetaca aatctatcte 7380 aagcttataa cttcgtatag catacattat acgaacggta atggacccag aacgacgcec 7440 ggccgacatc cgccgtgcca ccgaggegga catgecggeg gtetgcacca tegtcaacca 7500 ctacatcgag acaagcacgg tcaacttccg taccgagecg caggaaccge aggagtggac 7560 ggacgacctc gteegtetge gggagegcta tecctgecte gtcgccgagg tggacggega 7620 ggtcgccggc atcgectacg cgggeccctg gaaggcacgc aacgectacg actggacgge 7680 cgagtcgacc gtgtacgtct ccceecgeca ccageggacg ggactgggct ccacgctcta 7740 cacccacctg ctgaagtecc tggaggcaca gggcttcaag agegtggteg ctetcatcgg 7800 gctgcccaac gacccgageg tgcgcatgca cgaggegete ggatatgeee ceegeggeat 7860 gctgcgggcg gecggcttca agcacgggaa ctggcatgac gtgggtttet ggeagetgga 7920

19 cttcagcctg ceggtaccgc cecgtecgat cctgeccgte accgaaatet gagategtte 7980 aaacatttgg caataaagtt tcttaagatt gaatectett gccggtcettg cgatgattat 8040 catataattt ctgttgaatt acgttaagca tgtaataatt aacatgtaat gcatgacgtt 8100 atttatgaga tgggttttta tgattagagt cccgcaatta tacatttaat acgcgataga 8160 aaacaaaata tagcgcgcaa actaggataa attatcgcgc geggtgteat ctatgttact 8220 agatcgggct cgagagatta gecttttcaa tttcagaaag aatgctaacc cacagatggt 8280 tagagaggct tacgcagcag gtctcatcaa gacgatctac ccgagcaata atctccagga 8340 aatcaaatac cttcccaaga aggttaaaga tgcagtcaaa agattcagga ctaactgcat 8400 caagaacaca gagaaagata tatttctcaa gatcagaagt actattccag tatggacgat 8460 tcaaggcttg cttcacaaac caaggcaagt aatagagatt ggagtctcta aaaaggtagt 8520 tcccactgaa tcaaaggcca tggagtcaaa gattcaaata gaggacctaa cagaactcge 8580 cgtaaagact ggcgaacagt tcatacagag tctcttacga ctcaatgaca agaagaaaat 8640 cttcgtcaac atggtggagce acgacacact tgtctactcc aaaaatatca aagatacagt 8700 ctcagaagac caaagggcaa ttgagacttt tcaacaaagg gtaatatccg gaaacctect 8760 cggattccat tgcccagcta tetgtcactt tattetgaag atagtggaaa aggaaggteg 8820 ctcctacaaa tgccatcatt gcgataaagg aaaggccatc gttgaagatg cetetgccga 8880 cagtggtccc aaagatggac ceccacccac gaggageate gtggaaaaag aagacgttec 8940 aaccacgtct tcaaagcaag tggattgatg tgatatctce actgacgtaa gggatgacgc 9000 acaatcccac tatccttcge aagaccctte ctctatataa ggaagttcat ttcatttgga 9060 gagaacacgg gggactctag aggatccccg ggtggtcagt cecttgtgea cccaccatgg 9120 gtcctaagaa gaagagaaag gtgatcggat ctatgaacac gattaacate gctaagaacg 9180 acttctctga catcgaactg gctectatec cgttcaacac tetggetgac cattacggtg 9240 agcgtttage tcgcgaacag ttggeccttg agcatgagte ttacgagatg ggtgaageac 9300 gctteccgcaa gatgtttgag cgtcaactta aagetggtga gettgcggat aacgetgecg 9360

20 ccaagcctct catcactacc ctacteccta agatgattge acgcatcaac gactggtttg 9420 aggaagtgaa agctaagcgc ggcaagegce cgacagectt ccagttectg caagaaatca 9480 agccggaage cgtagegtac atcaccatta agaccactet ggettgecta accagtectg 9540 acaatacaac cgttcaggct gtagcaagcg caatcggtcg ggccattgag gacgaggcte 9600 gcttcggteg tatccatgac cttgaagcta agcacttcaa gaaaaacgtt gaggaacaac 9660 tcaacaagcg cgtagggcac gtctacaaga aagcatttat gcaagttgtc gaggctgaca 9720 tectetctaa ggatctacte ggtggegagg cgtggtettc gtggcataag gaagactcta 9780 ttcatgtagg agtacgctge atcgagatgc tcattgagtc aaccggaatg gttagcttac 9840 accgccaaaa tgetggegta gtaggtcaag actctgagac tatcgaactc gcacctgaat 9900 acgctgaggc tatcgcaacc cgtgeaggtg cgetggctgg catcteteeg atgttccaac 9960 cttgcgtagt tectectaag cegtggactg geattactgg tggtggctat tgggctaacg 10020 gtegtegtee tetggegetg gtgegtacte acagtaagaa agcactgatg cgetacgaag 10080 acgtttacat gcctgaggtg tacaaagcga ttaacattge gcaaaacacc gcatggaaaa 10140 tcaacaagaa agtcctagecg gtcgccaacg taatcaccaa gtggaagcat tgtecggteg 10200 aggacatcce tgegattgag cgtgaagaac teccgatgaa accggaagac atcgacatga 10260 atcctgaggc tetcaccgcg tggaaacgtg ctgecgetge tgtgtaccge aaggacaagg 10320 ctcgcaagtc tcgecgtate agecttgagt tcatecttga gcaagccaat aagtttgcta 10380 accataaggc catctggttc ccttacaaca tggactggeg cggtegtgtt tacgetgtgt 10440 caatgttcaa cccgcaaggt aacgatatga ccaaaggact gcttacgctg gcgaaaggta 10500 aaccaatcgg taaggaaggt tactactgge tgaaaatcca cggtgcaaac tgtgegggte 10560 tcgataaggt tecattecct gagcecatca agttcattga ggaaaaccac gagaacatca 10620 tggcttgege taagtcteca ctggagaaca cttggtggec tgagcaagat tetecgttet 10680 gcttecttge gttetgettt gagtacgctg gggtacagea ccacggectg agctataact 10740 gcteccttec getggegttt gacgggtcett getetggeat ccageactte tecgcgatge 10800 21 tccgagatga ggtaggtggt cgcgcgetta acttgettee tagtgaaacc gttcaggaca 10860 tctacgggat tgttgctaag aaagtcaacg agattctaca agcagacgca atcaatggga 10920 ccgataacga agtagttacc gtgaccgatg agaacactgg tgaaatctct gagaaagtca 10980 agctgggcac taaggcactg gctggtcaat ggctggctta cggtgttact cgcagtetga 11040 ctaagcgttc agtcatgacg ctggcttacg ggtccaaaga gtteggcttce cgtcaacaag 11100 tgctggaaga taccattcag ccagctattg attccggceaa gggtetgatg ttcactcage 11160 cgaatcaggce tectggatac atgectaagc tgatttggga atctgtgage gtgacggtgg 11220 tagctgecggt tgaagcaatg aactggctta agtctgetge taagctectg gctectgagg 11280 tcaaagataa gaagactgga gagattcttc gcaagcgttg cgetgtgcat tgggtaactc 11340 ctgatggttt ccctgtgtgg caggaataca agaagcectat tcagacgegc ttgaacctga 11400 tattectcgg tcagtteccgc ttacagecta ccattaacac caacaaagat agcgagattg 11460 atgcacacaa acaggagtct ggtatcgctc ctaactttgt acacagccaa gacggtagec 11520 accttcgtaa gactgtagtg tgggcacacg agaagtacgg aatcgaatct tttgcactga 11580 ttcacgactc cttcggtacc attccggetg acgetgegaa cetgttcaaa gcagtgcgcg 11640 aaactatggt tgacacatat gagtcttgtg atgtactggce tgatttctac gaccagttcg 11700 ctgaccagtt gcacgagtct caattggaca aaatgccagc acttccgget aaaggtaact 11760 tgaacctecg tgacatctta gagtcggact tegegttcge gtaaccgegg atcaacaact 11820 cteetggege accategteg getacagect cgggaattge taccgagete gaattteccc 11880 gatcgttcaa acatttggca ataaagtttc ttaagattga atcctgttge cggtettgeg 11940 atgattatca tataatttct gttgaattac gttaagcatg taataattaa catgtaatgc 12000 atgacgttat ttatgagatg ggtttttatg attagagtec cgcaattata catttaatac 12060 gcgatagaaa acaaaatata gcgcgcaaac taggataaat tatcgegege ggtgtceatcet 12120 atgttactag atcgggatac cgttcgtata gcatacatta tacgaagtta tgcggecgct 12180 atggacacca ctttcaaagc agccgctett caggecgaac cggtatggat ggatgecget 12240

22 gcaacagccg ataagaccgt gacgctagta gctaaagccg cageggctgg cgegeagete 12300 gtcgcatttc ccgaattgtg gattecgggc tacccaggat tcatgctcac gcacaaccaa 12360 accgaaaccc taccattcat cattaaatac cgcaagcagg caategccgc cgatggacca 12420 gaaatcgaaa aaattcgctg cgcggctcag gagcataaca ttgcgctetc ctttgggtac 12480 agcgaacggg ctggecgtac gctctacatg tcacaaatge ttatcgatge cgatggcate 12540 accaaaattc gtcgtcgaaa gctcaaacca acccgctttg aacgagaact ctttggcgaa 12600 ggtgacggat cggacttaca ggtcgeccaa actagegttg gteggetggg tgcectcaac 12660 tgcgeggaga atttgcagte getaaacaag tttgegettg ctgecgaggg tgaacagata 12720 catatctccg cctggccatt cacgcttgga agecctgtgc tegteggaga ctecatcgge 12780 gccatcaacc aggtctacge ggcegagacg gggacctteg ttctcatgte gacgcagetg 12840 gttggaccga ccggcatcgc cgecttcgag atcgaagaca ggtacaacce gaatcagtat 12900 cttggtggtg ggtacgcgcg gatctacggg cctgacatgc agttgaagag caagtegttg 12960 tcaccgaccg aagagggcat cgtctacgee gagategacc tetcgatgct tgaggcagca 13020 aagtactcgc tegateccac gggccactat tegcgcectg atgtgttcag cetetcgatt 13080 aaccggcaac ggcagectge ggtgtcagaa gttatcgact caaacggtga cgaggacceg 13140 agagcagcat gcgagcccga cgagggggat cgtgaggtcg taatetctac gecaataggg 13200 gttctacccc gttattgegg acattcctaa taaaaagaga cacgttgtac caaaggggtg 13260 ttcatgtcca gacgcagaaa atatagccca gagttaaaac gecgaagecat cgcetttaace 13320 catecggtac cgggcatgca agcttgggct gcagetegac tctaggegat gattatcata 13380 taatttctet tgaattacgt taagcatgta ataattaaca tgtaatgcat gacgttattt 13440 atgagatggg tttttatgat tagagteccg caattataca tttaatacgc gatagaaaac 13500 aaaatatagc gcgcaaacta ggataaatta tcgegegegg tetcatctat 13550 <210> 5

23

<211> 12169 <212> DNA <213> Artificial Sequence <220>

<223> nucleotide sequence of the plant expression vector pCT7pro::Cre <400> 5 actagatcgg ggaattcacc caacttaatc gecttgeage acatececct ttegccagct 60 ggcgtaatag cgaagaggec cgeaccgate gcecttecca acagttgege agectgaatg 120 gcgaatgeta gagcagcttg agcttggatc agattgtegt tteccgcett cagtttaaac 180 tatcagtgtt tgacaggata tattggcggg taaacctaag agaaaagagc gtttattaga 240 ataacggata tttaaaaggg cgtgaaaagg tttatccett cetccatttg tatgtgcatg 300 ccaaccacag ggttccecte gggatcaaag tactttgatc caaccectec getgetatag 360 tgcagtcgge ttctgacett cagtgcagcc gtettctgaa aacgacatgt cgcacaagte 420 ctaagttacg cgacagectg cegcectecc cttttectgg cgttttettg tegegtgttt 480 tagtcgcata aagtagaata cttgcgacta gaaccggaga cattacgcca tgaacaagag 540 cecceccect ggeetgetgg getatgeeeg cetcagcacc gacgaccagg acttgaccaa 600 ccaacgggce gaactgeacg cggecggctg caccaagetg ttttccgaga agatcaccgg 660 caccaggcec gaccgcccgg agetggecag gatecttgac cacctacgec ctggegacgt 720 tgtgacagtg accagectag accgectgge ccgcagcace cgegacctac tggacattgc 780 cgagcgceatc caggageceg gegegggect gegtagectg gcagagccet gggccgacac 840 caccacgceg gccggccgca tggtgttgac cgtgttecgee ggceattgeeg agttcgageg 900 ttecctaatc atcgaccgea cecggagcgg gegegaggee gccaaggcec gaggegtgaa 960

24 gtttggeece cgcectacee tcaccecggc acagatcgcg cacgeccgcg agetgatega 1020 ccaggaaggc cgcaccetga aagaggcggc tgeactgctt ggegtgeate getcgaccect 1080 gtaccgcgca cttgagcgca gcgaggaagt gacgeeccace gaggecagge ggcgcggtgc 1140 cttccgtgag gacgcattga ccgaggecga cgeectggeg gccgccgaga atgaacgcca 1200 agaggaacaa gcatgaaacc gcaccaggac ggccaggacg aaccgttttt cattaccgaa 1260 gagatcgagg cggagatgat cgcggccggg tacgtgttcg agccgcccgc gcacgtetca 1320 accgtgeggc tgcatgaaat cctggecggt ttgtetgatg ccaagetgge ggectggecg 1380 gccagcttgg ccgctgaaga aaccgagege cgecgtetaa aaaggtgatg tgtatttgag 1440 taaaacagct tgegtcatge ggtegetgeg tatatgatge gatgagtaaa taaacaaata 1500 cgcaagggga acgcatgaag gttatcgetg tacttaacca gaaaggeggg tcaggcaaga 1560 cgaccatcge aacccatcta geccgcgcec tgcaactege cggggecgat gttetgttag 1620 tcgattccga tecccagggc agtgcccgcg attgggcggc cetgcgggaa gatcaaccgc 1680 taaccgttgt cggcategac cgcccgacga ttgaccgcga cgtgaaggec atcggccggc 1740 gcegacttcgt agtgatcgac ggagcgcecc aggeggcgga cttgectatg tecgcgatca 1800 aggcagccga cttegtgetg attccggtgc agecaagecc ttacgacata tgggccaccg 1860 ccgacctggt ggagcetggtt aagcagcgca ttgaggtcac ggatggaagg ctacaagegg 1920 cctttgtcgt gtcgcgggcg atcaaaggea cgegeategg cggtgaggtt gecgaggege 1980 tggccgggta cgagetgecc attettgagt cecgtatcac gecagegegtg agctacccag 2040 gcactgeege cgccggcaca accgttettg aatcagaacc cgagggegac getgeecgceg 2100 aggtccagge gctggccgct gaaattaaat caaaactcat ttgagttaat gaggtaaaga 2160 gaaaatgagc aaaagcacaa acacgctaag tgeccggecgt ccgagegeac gcagcagcaa 2220 ggctgcaacg ttggccagee tggcagacac gccagccatg aagcgggtca actttcagtt 2280 gccggcegag gatcacacca agctgaagat gtacgeggta cgccaaggca agaccattac 2340 cgagctgcta tetgaataca tcgegeaget accagagtaa atgagcaaat gaataaatga 2400 gtagatgaat tttagcggct aaaggaggcg gcatggaaaa tcaagaacaa ccaggcaccg 2460 acgcegtgga atgcoccatg tgtggaggaa cgggeggttg gccaggceta agcggctggg 2520 ttgtctgeeg gccctgcaat ggcactggaa cecccaagec cgaggaateg gegtgacggt 2580 cgcaaaccat ccggcccggt acaaatcgge gcggcectgg gtgatgacct ggtggagaag 2640 ttgaaggcceg cgcaggccgc ccageggeaa cgeatcgagg cagaagcacg ceccgetgaa 2700 tcgtggcaag cggccgctga tegaatccgc aaagaatcce ggcaaccgce ggeagecggt 2760 gcgccgtega ttaggaagee goccaagggc gacgagcaac cagatttttt cettecgatg 2820 ctctatgacg tgggcacceg cgatagtcge agcatcatgg acgtggcegt tttecgtetg 2880 tcgaagcgtg accgacgage tggcgaggtg atccgctacg agcttccaga cgggcacgta 2940 gaggtttccg cagggecgge cggcatggcc agtgtgtggg attacgacct ggtactgatg 3000 geggtttccc atctaaccga atccatgaac cgataccggg aagggaaggg agacaagecc 3060 ggccgegtgt tecgtecaca cgttgeggac gtactcaagt tetgecggeg agecgatggc 3120 ggaaagcaga aagacgacct ggtagaaacc tgcattcggt taaacaccac gcacgttgec 3180 atgcagcgta cgaagaaggc caagaacggc cgectggtga cggtatccga gggtgaagec 3240 ttgattagcc gctacaagat cgtaaagage gaaaccggge ggecggagta catcgagate 3300 gagctagctg attggatgta ccgcgagatc acagaaggca agaacccgga cgtgctgacg 3360 gttcaccccg attacttttt gatcgatcce ggeatcggec gttttetcta ccgectggca 3420 cgeecgegecg caggcaaggc agaagccaga tggttgttca agacgatcta cgaacgcagt 3480 ggcagcgceg gagagttcaa gaagttetgt ttcaccgtec gcaagctgat cgggtcaaat 3540 gacctgcecgg agtacgattt gaaggaggag gcggggcagg ctggeccgat cctagtcatg 3600 cgctaccgea acctgatcga gggcgaagca tecgccgett cctaatgtac ggagcagatg 3660 ctagggcaaa ttgccctagc aggggaaaaa ggtecgaaaag gtetctttee tgtggatage 3720 acgtacattg ggaacccaaa gccgtacatt gggaaccgga acccgtacat tgggaaccca 3780 aagccgtaca ttgggaaccg gtcacacatg taagtgactg atataaaaga gaaaaaaggc 3840

26 gatttttccg cctaaaactc tttaaaactt attaaaactc ttaaaacccg cctggcctet 3900 gcataactgt ctggccagcg cacagecgaa gagctgcaaa aagcgcctac cettcgatcg 3960 ctgcgctecc tacgececgc cgettegegt cggcctateg cggeegetgg ccgctcaaaa 4020 atggctggcc tacggccagg caatctacca gggegeggac aagecgegec gtcgccacte 4080 gaccgceggc gcccacatca aggeacccetg cetegegegt ttcggtgatg acggtgaaaa 4140 cctetgacac atgcagctec cggagacggt cacagettgt ctgtaagcgg atgccgggag 4200 cagacaagcc cgtcagggeg cetcagcggg tattggcggg tgetcggggcg cagccatgac 4260 ccagtcacgt agcgatageg gagtgtatac tggcttaact atgcggcatc agagcagatt 4320 gtactgagag tgcaccatat gcggtetgaa ataccgcaca gatgcgtaag gagaaaatac 4380 cgcatcaggce gctettecgc ttectegete actgactege tgegeteggt cettegectg 4440 cggcgagegg tatcagctca ctcaaaggeg gtaatacggt tatccacaga atcaggggat 4500 aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcec 4560 gcattectgg catttttcca taggctecgc ceccctgacg agcatcacaa aaategacge 4620 tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggegtt tecccctgga 4680 agctcecteg tgegetetee tgttecgacc ctgccectta ccggatacct gtecgecttt 4740 cteccttcgg gaagegtgge gctttctcat agctcacgct gtaggtatct cagttcggtg 4800 taggtcgttc gctccaagct gggetgtgtg cacgaaceec cegttcagee cgaccgetge 4860 gcecttatceg gtaactateg tettgagtec aacccggtaa gacacgactt atcgecactg 4920 gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc tacagagttc 4980 ttgaagtget ggcctaacta cggctacact agaaggacag tatttggtat ctgegetctg 5040 ctgaagccag ttaccttcgg aaaaagagtt ggtagctett gatccggcaa acaaaccace 5100 gctggtageg gtggtttttt tetttgcaag cagcagatta cgcgcagaaa aaaaggatct 5160 caagaagatc ctttgatctt ttctacgggg tetgacgctc agtggaacga aaactcacgt 5220 taagggattt tggtcatgca ttctaggtac taaaacaatt catccagtaa aatataatat 5280 27 tttattttet cccaatcagg cttgateccc agtaagtcaa aaaatagcte gacatactgt 5340 tettecccga tatectecct gatcgaccgg acgcagaagg caatgtcata ccacttgtec 5400 geectgeege ttecteccaag atcaataaag ccacttactt tgecatcttt cacaaagatg 5460 ttgctatetc ccaggtegee gtgggaaaag acaagttect cttecgggctt ttecgtettt 5520 aaaaaatcat acagctcgeg cggatcttta aatggagtgt cttettccca gttttcgeaa 5580 tccacatcgg ccagatcgtt attcagtaag taatccaatt cggctaageg getgtctaag 5640 ctattcgtat agggacaatc cgatatgtcg atggagtgaa agagectgat gcactecgca 5700 tacagctcga taatcttttc agggctttgt tcatettcat actcttccga gcaaaggacg 5760 ccatcggect cactcatgag cagattgcte cagccatcat gccettcaaa gtgcaggacc 5820 tttggaacag gcagctttec ttccagccat agcatcatgt cetttteccg ttecacatca 5880 taggtggtce ctttataccg getgtecgtce atttttaaat ataggtttte attttetccc 5940 accagcttat ataccttagc aggagacatt cettecgtat cttttacgca geggtatttt 6000 tcgatcagtt ttttcaattc cggtgatatt ctcattttag ccatttatta tttccttect 6060 cttttctaca gtatttaaag ataccccaag aagctaatta taacaagacg aactccaatt 6120 cactgttcct tecattctaa aaccttaaat accagaaaac agctttttca aagttgtttt 6180 caaagttggc gtataacata gtatcgacgg agccgatttt gaaaccgegg tgatcacagg 6240 cagcaacgct ctgtcatcgt tacaatcaac atgctaccct ccgegagatce atcegtgttt 6300 caaacccgge agcttagttg cegttettec gaatagcatc ggtaacatga gcaaagtctg 6360 ccgccttaca acggctetec cgetgacgee gteccggact gatggectec ctgtatcgag 6420 tggtgatttt gtgcegagct gccggtcggg gagctattgg ctggctgetg gcaggatata 6480 ttgtggtgta aacaaattga cecttagaca acttaataac acattgcgga cgtttttaat 6540 gtactgaatt aacgccgaat taattcgggg gagatctatt gectagagca gcttgccaac 6600 atggtggagc acgacactct cetctactec aagaatatca aagatacagt ctcagaagac 6660 caaagggcta ttgagacttt tcaacaaagg gtaatatcgg gaaacctect cggattecat 6720

28 tecccagcta tetetcactt catcaaaagg acagtagaaa aggaaggtgg cacctacaaa 6780 teccatcatt gcgataaagg aaaggctatc gttcaagatg cetctgccga cagtggtecc 6840 aaagatggac ceccacccac gaggagcate gtggaaaaag aagacgttec aaccacgtet 6900 tcaaagcaag tggattgatg tgataacatg gtggagcacg acactctcgt ctactccaag 6960 aatatcaaag atacagtctc agaagaccaa agggctattg agacttttca acaaagggta 7020 atatcgggaa acctectegg attccattge ccagctatct gtcacttcat caaaaggaca 7080 gtagaaaagg aaggtggcac ctacaaatgc catcattgcg ataaaggaaa ggctatcgtt 7140 caagatgcct ctgecgacag tggtcccaaa gatggaccec cacccacgag gagcategtg 7200 gaaaaagaag acgttccaac cacgtcttca aagcaagtgg attgatgtga tatctccact 7260 gacgtaaggg atgacgcaca ateccactat ccttcgcaag accttectct atataaggaa 7320 gttcatttca tttggagagg acacgctgaa atcaccagtc tetetctaca aatctatetc 7380 aagcttataa cttcgtatag catacattat acgaacggta atggacccag aacgacgcec 7440 ggccgacatc cgccgtgcca ccgaggegga catgecggeg gtetgcacca tegtcaacca 7500 ctacatcgag acaagcacgg tcaacttccg taccgagecg caggaaccge aggagtggac 7560 ggacgacctc gteegtetge gggagegeta tecctgecte gtcgccgagg tggacggega 7620 ggtcgeegge atcgectacg cgggeccctg gaaggcacgc aacgectacg actggacgge 7680 cgagtcgacc gtgtacgtct ccceecgeca ccageggacg ggactgggct ccacgctcta 7740 cacccacctg ctgaagtecc tggaggcaca gggcttcaag agegtggteg ctetcatcgg 7800 gctgcccaac gacccgageg tgcgcatgca cgaggegete ggatatgeee ceegeggeat 7860

— gctgcgggcg gccggcttca agcacgggaa ctggcatgac gtgggtttct ggcagetgga 7920 cttcagcctg ceggtaccgc cecgtecgat cctgeccgte accgaaatet gagategtte 7980 aaacatttgg caataaagtt tcttaagatt gaatcctgtt gccggtcettg cgatgattat 8040 catataattt ctgttgaatt acgttaagca tgtaataatt aacatgtaat gcatgacgtt 8100 atttatgaga tgggttttta tgattagagt cccgcaatta tacatttaat acgcgataga 8160

29 aaacaaaata tagcgcgcaa actaggataa attatcgcgc geggtgtcat ctatgttact 8220 agatcgggct cgagggatct gacattettg aattgatcte gatcccgega aattaatacg 8280 actcactata ggggaattgt gagcggataa caattccgag accacaacgg tttccctcta 8340 gcgggatcaa ttccgeccce ceeectaacg ttactggecg aagccecttg gaataaggec 8400 ggtetocgtt tgtctatatg ttattttcca ccatattgee gtettttgge aatgtgaggg 8460 ccecggaaace tggeectgte ttettgacga gcattectag gggtctttee cetetegeca 8520 aaggaatgca aggtctgttg aatgtcgtga aggaagcagt tectctggaa gettettgaa 8580 gacaaacaac gtctgtagcg accctttgea ggcagcggaa ceccccacct ggcgacaget 8640 gcctctgcgg ccaaaagcca cetgtataag atacacctge aaaggeggea caaccccagt 8700 gccacgttet gagttggata gttgtggaaa gagtcaaatg gctctectca agcgtattca 8760 acaaggggct gaaggatgcc cagaaggtac cccattgtat gggatctgat ctggggecte 8820 ggtgcacatg ctttacatgt gtttagtcga ggttaaaaaa cgtctaggee ceccgaacca 8880 cggggacgtg gttttccttt gaaaaacacg ataataccat ggggatctga tctatggcca 8940 atttactgac cgtacaccaa aatttgcctg cattaccggt cgatgcaacg agtgatgagg 9000 ttcgcaagaa cctgatggac atgttcaggg atcgccagec gttttctgag catacctgga 9060 aaatgcttct gteegtttge cggtegtggge cggcatgets caagttgatc aataaccgga 9120 aatggtttcc cgcagaacct gaagatgttc gegattatct tctatatett caggegegeg 9180 gtctggcagt aaaaactatc cagcaacatt tgggccagct aaacatgctt catcgtecggt 9240 ccgggctgec acgaccaagt gacagcaatg ctgtttcact ggttatgegg cggatccgaa 9300 aagaaaacgt tgatgccggt gaacgtgcaa aacaggctct agegttcgaa cgeactgatt 9360 tcgaccaggt gaacatttct cctgtatcca aactcaaggt tgttgtagga acccataaag 9420 tttaaattct ggattcgect ctectectga ttaatttttt ccttgaaatt atctagaget 9480 tggacgattc tgctttaaca tcagatgttt taatgttacg taggttcgtt cactcatgga 9540 aaatagcgat cgctgecagg atatacgtaa tctggcattt ctggggattg cttataacac 9600 cctgttacgt atagccgaaa ttgccaggat cagggttaaa gatatctcac gtactgacgg 9660 tgggagaatg ttaatccata ttggcagaac gaaaacgctg gttagcaccg caggtgtaga 9720 gaaggcactt agcctggggg taactaaact ggtcgagega tggatttccg tetetggtat 9780 agctgatgat ccgaataact acctgttttg ccgggtcaga aaaaatggtg ttgccgcgec 9840 atctgccacc agccagctat caactcgege cctggaaggg atttttgaag caactcateg 9900 attgatttac ggcgctaagg atgactctgg tcagagatac ctggectggt ctggacacag 9960 tgeeegtgte ggagecgege gagatatgge cegegetgga gtttcaatac cggagatcat 10020 gcaagctggt ggctggacca atgtaaatat tgtcatgaac tatatccgta acctggatag 10080 tgaaacaggg gcaatggtgc gectgetgga agatggcgat tagaataaaa agacagaata 10140 aatagcataa ccccttgggg cctctaaacg ggtettgagg gettttttat agttattaat 10200 agtaatcaat tacggggtca ttagttcata gcccatatat ggagttecgc gttactaceg 10260 ttcgtatage atacattata cgaagttatc cgeggatgge gcaagttage agaatctgea 10320 atggtgtgca gaacccatct cttatctcca atctctcgaa atccagtcaa cgcaaatetc 10380 ccttatcggt ttetctgaag acgcagcagc atccacgage ttatecgatt tegtegtegt 10440 ggggattgaa gaagagtggg atgacgttaa ttggcetctga gettegtect cttaaggtca 10500 tgtettetgt ttccacggeg tgcatgcttc acggtgcaag cagecgteca geaactgcete 10560 gtaagtccte tggtetttct ggaaccgtec gtattccagg tgacaagtcet atctcccaca 10620 ggtccttcat gtttggaggt ctcgetageg gtgaaactcg tatcaccggt cttttggaag 10680 gtgaagatgt tatcaacact ggtaaggcta tgcaagctat gggtgccaga atecgtaagg 10740 aaggtgatac ttggatcatt gatggtgttg gtaacggtgge actecttgct cetgaggcte 10800 ctetcgattt cggtaacgct gcaactgett gccetttgac tatgggtctt gttggtgattt 10860 acgatttcga tagcactttc attggtgacg cttctctcac taagcgtcca atgggtegtg 10920 tattgaaccc acttcgcgaa atggetetgc aggtgaagtce tgaagacggt gategtette 10980 cagttacctt gcgtggacca aagactccaa cgccaatcac ctacagggta cctatggett 11040

31 ccgctcaagt gaagtecgct gttetgettg ctggtetcaa caccccaget atcaccactg 11100 ttatcgagcc aatcatgact cgtgaccaca ctgaaaagat gcttcaaggt tttggtecta 11160 accttaccgt tgagactgat gctgacggtg tgcgtaccat cegtcttgaa gatcgtggta 11220 agctcaccgg tcaagtgatt gatgttccag gtgatccate ctetactgcet ttecccattgg 11280 ttgctgectt gcttottcca ggttccgacg tcaccatect taacgttttg atgaacccaa 11340 ccegtactgg tetcatcttg actctgcagg aaatgggtge cgacatcgaa gtgatcaacc 11400 cacgtcttge tggtggagaa gacgtggctg acttgegtgt tegttettet actttgaagg 11460 gtattactet tccagaagac cgtgetectt ctatgatcga cgagtatcca attctcgetg 11520 ttgcagctgc attcgetgaa ggtectaccg ttatgaacgg tttggaagaa ctecgtgtta 11580 aggaaagcga ccgtctttct getgtcgeaa acggtetcaa getcaacggt gttgattgeg 11640 atgaaggtga gacttctctc gtcgtgcgtg gtegtectga cggtaagggt ctcggtaacg 11700 cttctggage agctetcgct acccaccteg atcaccgtat cgetatgage ttectegtta 11760 tgggtctegt ttetgaaaac cetgttactg ttgatgatgc tactatgate getactaget 11820 tcccagagtt catggatttg atggctggtce ttggagctaa gatcgaacte tecgacacta 11880 aggctgcttg aagatccgga actagtaact gcagectcag atccgatcgt tcaaacattt 11940 ggcaataaag tttcttaaga ttgaatcctg ttgecggtct tgegatgatt atcatataat 12000 ttctgttgaa ttacgttaag catgtaataa ttaacatgta atgcatgacg ttatttatga 12060 gatgggtttt tatgattaga gtcccgcaat tatacattta atacgcgata gaaaacaaaa 12120 tatagcgcgc aaactaggat aaattatcgc gegeggtgte atctatgtt 12169

<210> 6 <211> 17 <212> DNA 32

<213> Artificial Sequence

<220>

<223> primer for amplifying 440 bp fragment

<400> 6 gaagtcagct ccagaac 17 <210> 7

<211> 15

<212> DNA

<213> Artificial Sequence <220>

<223> primer for amplifying 440 bp fragment

<400> 7 gcccagtcag ctaac 15

<210> 8

<211> 18

<212> DNA

33

<213> Artificial Sequence

<220>

<223> primer for amplifying 459 bp fragment

<400> 8 cgtgaactga tectgacg 18 <210> 9

<211> 18

<212> DNA

<213> Artificial Sequence <220>

<223> primer for amplifying 459 bp fragment

<400> 9 ttgacttgag acgcetgc 18

<210> 10

<211> 20

<212> DNA

34

<213> Artificial Sequence

<220>

<223> primer for amplifying 496bp fragment

<400> 10 caacagccga taagaccgtg 20 <210> 11

<211> 20

<212> DNA

<213> Artificial Sequence <220>

<223> primer for amplifying 496bp fragment

<400> 11 ggccaggcgg agatagttat 20

<210> 12

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> primer L

<400> 12 gtotttgaca ggatatattg gc 22 <210> 13

<211> 22

<212> DNA

<213> Artificial Sequence <220>

<223> primer R

<400> 13 agcgtcaatt tgtttacacc ac 22

36

Claims (6)

WHAT IS CLAIMED IS:

1. A Cre/lox transient expression vector system, comprising plant expression vectors pC3SSpro::T7RP and pCT7pro::Cre; wherein the plant expression vector pC35Spro::T7RP comprises a 35S promoter, a lox site, a Bar gene, an NOS terminator, a 35S promoter, a T7 RNA polymerase gene, an NOS terminator, a lox site, and an OXY gene; the plant expression vector pCT7pro::Cre comprises a 35S promoter, a lox site, a Bar gene, an NOS terminator, a T7 promoter, a Cre gene, a T7 terminator, a lox site, and a CP4 EPSPS gene; and the Bar gene is a glufosinate-resistant gene; the CP4 EPSPS gene is a glyphosate-resistant gene; and the OXY gene is a bromoxynil-resistant gene.

2. The Cre/lox transient expression vector system according to claim 1, wherein the OXY gene has a nucleotide sequence shown in SEQ ID NO: 3.

3. The Cre/lox transient expression vector system according to any one of claims 1 to 2, wherein the plant expression vector pC35Spro:: T7RP has a nucleotide sequence shown in SEQ ID NO: 4.

4. The Cre/lox transient expression vector system according to any one of claims 1 to 2, wherein the plant expression vector pCT7pro::Cre has a nucleotide sequence shown in SEQ ID NO: 5.

5. Use of the Cre/lox transient expression vector system according to any one of claims 1 to 4 in the preparation of transgenic resistant plants. 37

6. The use according to claim 5, comprising the following steps: step 1, introducing the plant expression vectors pC35Spro:: T7RP and pCT7pro::Cre into Agrobacterium strains to obtain positive Agrobacterium strains, respectively; step 2, infecting a positive Agrobacterium strain carrying the plant expression vector pC35Spro::T7RP and a positive Agrobacterium strain carrying the plant expression vector pCT7pro::Cre into Brassica napus to obtain a transgenic resistant rape carrying the plant expression vector pC35Spro::T7RP and a transgenic resistant rape carrying the plant expression vector pCT7pro::Cre; and step 3, crossing the transgenic resistant rape carrying the plant expression vector pC35Spro::T7RP with the transgenic resistant rape carrying the plant expression vector pCT7pro::Cre to obtain a marker gene-deleted transgenic resistant rape. 38