CN106939316B - Method for site-directed knockout of rice OsPDCD5 gene second exon by CRISPR/Cas9 system - Google Patents

Abstract

The invention discloses a method for knocking out a second exon of a rice OsPDCD5 gene at a fixed point by using a CRISPR/Cas9 system, which comprises the following steps: selecting a target fragment in a second exon region of a rice OsPDCD5 gene, constructing a plant CRISPR/Cas9 recombinant vector, introducing the recombinant vector into rice callus by an agrobacterium infection method and regenerating seedlings, shearing double chains of the second exon of the OsPDCD5 gene under the combined action of guide RNA and Cas9 nuclease, and finally realizing random insertion or random deletion on the target gene fragment through a cell DNA repair function. The invention provides an efficient breeding mode for cultivating high-yield and high-quality rice varieties.

Description

Method for site-directed knockout of rice OsPDCD5 gene second exon by CRISPR/Cas9 system

Technical Field

The invention relates to a method for knocking out a second exon target sequence of a rice OsPDCD5 gene at a fixed point so as to obtain a rice mutant strain for improving the plant type and the panicle type of rice, belonging to the technical field of plant genetic engineering.

Background

Rice is one of the important food crops in the world, and the rice is taken as the staple food by about 2/3 people in the world. Under the condition that the cultivated land area is gradually reduced, the method has important significance for improving the unit yield of the rice in order to meet the demand of the growing population on the food. The traditional crossbreeding plays a key role in continuously improving the rice yield in China, but has the problems of low seed production efficiency, high labor intensity, long breeding time consumption, unstable seed yield and the like, and the problems are solved by the current plant genome engineering technology. For example, Zinc Finger Nucleases (ZFNs) that use engineered nucleases for gene editing, transcription activator-like effector nucleases (TALENs), and bacterial acquired immune system (CRISPR/Cas9) all use nucleases to induce double strand breaks at specific target sites, and then use Homologous Recombination (HR) or non-homologous end joining (NHEJ) for DNA repair, and this imprecise repair method can generate gene site-directed mutations, and then obtain mutant gene plants.

Compared with the CRISPR of the latest technology, ZFNs and TALENs have certain limitations, and particularly, the ZFNs recognize specific DNA sequences by using different zinc finger structures, and the recognizable sequences are limited, so that the aim of editing any target DNA cannot be fulfilled; the TALEN recognizes a specific DNA sequence by means of TAL effectors, can recognize and combine all target sequences, needs to repeatedly construct fusion proteins, is complicated in construction process and high in cost, and like ZFN, FokI nuclease is used, and dimers are needed to have nuclease activity, so that two fusion vectors need to be constructed to recognize two adjacent nucleotide sequences, and the limitation of target fragment selection is increased. The CRISPR/Cas9 system is a set of adaptive immune system widely existing in prokaryotes and aiming at foreign genes, and consists of a short highly conserved 21-48 bp repetitive sequence which is separated by 26-72bp spacer sequences, the short highly conserved 21-48 bp repetitive sequence can be transcribed to form CRISPR RNA (crRNAs), and the short highly conserved repetitive sequence are matched with another trans-acting crRNA (trans-activating crRNA) part to form a binary complex, and the binary complex jointly plays a role in guiding a Cas protein to cut a DNA sequence matched with the crRNA, so that double-strand break is formed. Compared with the first two editing technologies, the CRISPR has the advantages of wide applicability, capability of carrying out multi-target operation simultaneously, no need of repeatedly constructing fusion protein, short experimental period and low cost. To date, the CRISPR/Cas9 system realizes genome editing in various animals and plants, and rice, as an important food crop and monocotyledon model plant, has also performed partial related research.

Programmed Cell Death (PCD) is a self-regulated form of active death, is part of the normal vital activities of multicellular organisms, and is an important process that starts itself during plant development and under environmental stress. The OsPDCD5 gene is a programmed cell death gene in rice. The expression level of OsPDCD5 in mature tissues is obviously higher than that of young tissues, and the overexpression of OsPDCD5 can cause the death of transgenic regeneration plants. The rice lines with OsPDCD5 function deletion are obtained by performing site-directed mutagenesis on the second exon of the OsPDCD5 gene through a CRISPR/Cas9 system, and compared with wild type control, the rice lines have the phenotypes of increased plant height and increased grain number per spike, so that the purposes of improving the rice plant type and further increasing the rice yield are achieved.

Disclosure of Invention

Aiming at the prior art, the invention provides a method for performing site-directed mutagenesis on the second exon of the rice OsPDCD5 gene by using a CRISPR/Cas9 system so as to improve the panicle grain type of the rice plant type.

The invention is realized by the following technical scheme:

a method for performing site-directed knockout on a second exon of a rice OsPDCD5 gene by using a CRISPR/Cas9 system comprises the following steps: according to the structural characteristics of a CRISPR system target site, selecting a 23bp sequence (shown as SEQ ID NO. 2) in a second exon of an OsPDCD5 gene as a target sequence, amplifying a target fragment by adopting a specific primer, and connecting the target fragment to a pBWA (V) H-Cas9 vector in an enzyme digestion connection mode to obtain a fusion vector (a guide RNA expression frame containing the target sequence and a Cas9 nuclease expression frame), wherein the fusion vector is named as pBWA (V) H-Cas9-PDCD 5.2; the fusion vector is transformed into rice (such as indica rice variety rice 1B) in an agrobacterium-mediated mode, positive plants are identified in transgenic T1 progeny through PCR, and strains homozygous for mutation sites are searched in T2 generations and T3 generations.

Further, the nucleotide sequence of the specific primer is as follows:

yjstgt(+)：cagtGGTCTCaggcacccagagttggaagcta；

yjstgt (-): cagtGGTCTCaaaacgatagcttccaactctg, respectively; shown as SEQ ID NO.5 and SEQ ID NO. 6.

Further, the method for finding a strain homozygous for the mutation site in the T2 generation is as follows: primers MPCD6-F were used: TGGAGGGAGTACATGTTTTAGGTG and MPCD 6-R: ATAAACATGGTTGACAAATAGAGC (shown in SEQ ID NO.7 and 8), detecting the sequence of the second exon of the OsPDCD5 gene in the plant, and judging whether the second exon of the OsPDCD5 gene is successfully knocked out (OsPDCD5 protein function deletion mutation) according to the detection result; plants with OsPDCD5 protein function deletion mutation are selected (the plants are improved in plant height and yield character to different degrees).

According to the method for knocking out the second exon of the rice OsPDCD5 gene at a fixed point by using the CRISPR/Cas9 system, a target fragment is selected in the second exon region of the rice OsPDCD5 gene, a plant CRISPR/Cas9 recombinant vector is constructed, the recombinant vector is introduced into rice callus through an agrobacterium infection method and regenerated into seedlings, double chains of the second exon of the OsPDCD5 gene are cut under the combined action of guide RNA and Cas9 nuclease, and random insertion or random deletion on the target gene fragment is finally realized through the DNA repair function of a cell. The invention provides an efficient breeding mode for cultivating high-yield and high-quality rice varieties and provides good germplasm resources for rice breeding production.

Drawings

FIG. 1: a rice OsPDCD5 gene structure chart and a second exon sequence.

FIG. 2: the recombinant fusion vector pBWA (V) has the vector map of H-cas9-PDCD 5.2.

FIG. 3: schematic diagram of the second exon nucleotide mutation of the OsPDCD5 gene of 9 mutant strains and the polypropylene 1B.

FIG. 4: sequencing the second exon sequences of the OsPDCD5 gene of the mutant strain and the polypropylene 1B.

FIG. 5: schematic diagram of amino acid mutation of the second exon of OsPDCD5 gene of 9 mutant strains and the P1B.

FIG. 6: the mutant strain BPCD10 is compared with the control strain PP 1B in the mature period by the leaf length and the leaf width.

FIG. 7: the mature-period plant height ratio of the mutant strain BPCD10 and the control strain propylene 1B is compared.

FIG. 8: the mutant strain BPCD10 is compared with the control strain PP 1B in the mature period main stem length of five internodes.

FIG. 9: the mutant strain BPCD10 is compared with the middle section diameter of the second section of the main stem of the mature period of the control strain of the polypropylene 1B.

FIG. 10: the mutant strain BPCD10 is compared with the mature-period partial yield character of the control strain propylene 1B.

FIG. 11: the effective spike numbers of the mutant strain BPCD10 and the control strain propylene 1B in the maturation period are compared.

FIG. 12: comparing the mutant strain BPCD10 with the control strain of the polypropylene 1B in the mature period by the number of grains per spike, the number of grains per kernel and the number of empty grains.

FIG. 13: the mature-period seed setting rate of the mutant strain BPCD10 and the control strain P1B are compared.

FIG. 14: the yield of the mutant strain BPCD10 and the yield of the single strain of the control strain propylene 1B in the mature period are compared.

FIG. 15: mutant BPCD10 was grown for 14 days as control for 14 day seedlings with control P1B.

FIG. 16: mutant strain BPCD10 is compared with the stem type of the control strain propylene 1B at the heading stage.

FIG. 17: the mutant strain BPCD10 is compared with a control strain, namely the strain of the polypropylene 1B in the mature period.

FIG. 18: the mutant strain BPCD10 is compared with the control strain of the section growth of the main stem of the polypropylene 1B.

FIG. 19: mutant strain BPCD10 was compared with control strain P1B for main spike type.

FIG. 20: mutant strain BPCD10 was compared to control strain P1B pellet.

Detailed Description

The present invention will be further described with reference to the following examples.

The instruments, reagents, materials and the like used in the following examples are conventional instruments, reagents, materials and the like in the prior art and are commercially available in a normal manner unless otherwise specified. Unless otherwise specified, the experimental methods, detection methods, and the like described in the following examples are conventional experimental methods, detection methods, and the like in the prior art.

Example 1 knockout and application of second exon of OsPDCD5 gene of rice

Construction of pBWA (V) H-cas9-PDCD5.2 vector

(1) According to the CRISPR/Cas9 system, one strand of a double-stranded target sequence is required to have the following structure: 5' -N_xNGG-3', N represents any one of four basic groups of A, G, C and T, X is more than or equal to 14 and less than or equal to 30, and a 23bp sequence (shown as SEQ ID NO. 2) meeting the requirements in a second exon (shown as SEQ ID NO.1 and an amino acid sequence of a protein coded by the nucleotide sequence is shown as SEQ ID NO. 3; shown as a figure 1) of the OsPDCD5 gene is selected as a target sequence;

primers yjstgt (+): cagtGGTCTCaggcacccagagttggaagcta and yjstgt (-): cagtGGTCTCaaaacgatagcttccaactctg were used to amplify a 20bp target sequence (nucleotide sequence: acccagagttggaagctatc, shown in SEQ ID No. 9) in the second exon of the OsPDCD5 gene, and the amplified PCR product was: cagtGGTCTCaggcacccagagttggaagctatcgttttGAGACCagtg, as shown in SEQ ID NO. 10.

(2) The PCR product was recovered by tapping, and the DNA fragment was purified using a kit.

(3) Preparing an enzyme digestion connecting system: the components used and the amounts used in the system are shown in table 1.

TABLE 1

Component	Volumes
		pBWA(V)H-cas9i	4μL
PCR	4μL
		BsaI/Eco31I	1μL
T4_ligase:1	1μL
		Buffer	2μL
H2O	8μL
		Total	20μL

5cycles at 37 ℃ for 20 min; 37 ℃ for 10 min; 20 ℃ for 10 min; 37 ℃ for 20 min; ligation product was obtained at 80 ℃ for 5 min.

(4) And (3) transforming 5-10 mu L of the ligation product into escherichia coli competence, coating a (kanamycin) resistant plate for transformation, culturing for 12 hours at 37 ℃, and carrying out plaque PCR identification.

(5) 10 plaques were picked for simultaneous 1.5ml EP inoculation and PCR identification, pBWA (V) H-cas9i identifying primer Pbw2 +: GGCGTCTTCTACTGGTGCTA, Pbw 2-: GTCTTTACGGCGAGTTCTGT (shown in SEQ ID NO.11 and 12), and the length of the amplified fragment is 422 bp. And (4) taking bacterial liquids corresponding to the 3 positive bands, carrying out sample sequencing, and carrying out bacteria preservation treatment on the bacterial liquid with the correct sequencing result.

Genetic transformation of the pBWA (V) H-cas9-PDCD5.2 vector

(1) The pBWA (V) H-cas9-PDCD5.2 vector was transformed into EHA105 Agrobacterium (Wu ZM et. 2007) to obtain a transformant. The transformant extracted plasmid was subjected to sample-feeding sequencing, and the result showed that the plasmid was pBWA (V) H-cas9-PDCD5.2, so the transformant containing pBWA (V) H-cas9-PDCD5.2 was named EHA105/cas9-PDCD 5.2.

The sequence of pBWA (V) H-cas9-PDCD5.2 is shown in SEQ ID NO.4, the structure is shown in figure 2, and the vector structure and the annotation are as follows:

seg1, complementary 141 bp-166 bp 26bp LB element sequence;

Seg2:Tnos nos terminal 435bp—219bp 217bp；

seg3, HYG hygromycin resistance gene UP 1485 bp-463 bp 1023 bp;

Seg4:35s*2 double 35s 2291bp—1521bp 771bp；

seg5, PosU3 rice U6 promoter 2349 bp-2729 bp 381 bp;

seg6 yjstgt genome target, second exon, acccagagttggaagctatc 2730bp-2748 bp; seg7 RNAi framework [ part ]2749 bp-2831 bp 83 bp;

seg 8P 35S details 2840 bp-3379 bp 540 bp;

seg9, NLS 1N end NLS 3380 bp-3412 bp 33 bp;

Seg10:cas9 crisp cas9 orf 3413bp—7516bp 4104bp；

seg11, NLS 2C end signal peptide 7517 bp-7567 bp 51 bp;

Seg12:Tnos nos A3 terminal 7572bp—7888bp 317bp；

seg13 detailed description of [ part of ]7889 bp-7896 bp 8bp by LACmcs;

Seg14:TR T_Bord(right) 8330bp—8355bp 26bp；

Seg15:sta pVS1 sta 8511bp—9511bp 1001bp；

Seg16:rep pVS1 rep 10122bp—11122bp 1001bp；

Seg17:bom pBR322bom 11550bp—11290bp 261bp；

Seg18:ori pBR322ori 11970bp—11690bp 281bp；

Seg19:kanamycin kanamycin 13054bp—12260bp 795bp。

(2) inducing and culturing the callus of the mature seed of P1B

The culture medium for this experiment is shown in Table 2.

TABLE 2

(Note: 1. all the above media contained 30g/L sucrose +2.5g/L agar)

Taking mature seeds of the PP 1B, shelling, firstly soaking and washing with 70% ethanol for 10min under the aseptic condition, transferring into 0.1% mercuric chloride for soaking for 20min, washing with aseptic water for 3 times, and inoculating into an induction culture medium. Culturing at 26 deg.C in dark, and selecting callus after 20 days for subculture.

(3) Infection with Agrobacterium

Culturing EHA105/cas9-PDCD5.2 agrobacterium at 28 ℃ for 16 hours, collecting bacterial liquid, diluting the bacterial liquid into YEP liquid culture medium containing 100 mu mol/L until the concentration is OD600 about 0.5, and dividing the soaking time into three groups of 10min, 20min and 30min so as to obtain the optimal soaking time by comparison, wherein the soaking period is shaking up from time to time. And after soaking, taking out the callus blocks, paving the callus blocks on sterilized filter paper, sucking off redundant bacteria liquid, transferring the callus blocks to a co-culture medium, paving a layer of sterile filter paper on the surface of the culture medium, and enabling the callus blocks not to be in direct contact with the culture medium on the filter paper. The cells were cultured at 26 ℃ for 6 days.

(4) Selection of transformed calli

After the co-culture is completed, taking out the callus blocks, washing the callus blocks with sterile water for 3-5 times, then washing the callus blocks with sterile water containing rifampicin (50mg/L) and kanamycin (50mg/L) resistance for 2-3 times, after absorbing the excess water by sterile filter paper, transferring the callus blocks into a primary screening culture medium (MS culture medium added with 30ppm hygromycin) (transforming the callus blocks for primary and secondary screening for about 3 weeks), and then transferring the screened cell lines to a differentiation culture medium to induce the growth of buds and the rooting.

3. Screening and detecting of transformed plants

After the screening is completed, the screened cell line is transferred to a differentiation culture medium to regenerate plants, and the plants are continuously cultured for 30 days under the conditions of 26 ℃ and 16h of illumination per day. Transferring the plantlets into a rooting culture medium for culture after green plantlets are differentiated, removing the plantlets from the rooting culture medium when the plantlets grow to be about 10cm high, cleaning residual culture medium, hardening seedlings for a period of time, then transplanting the plantlets into a greenhouse, and detecting candidate transformed plants by adopting PCR amplification, wherein the used amplification primers are as follows: Hyg-CX-S: AGATGTTGGCGACCTCGTATT, respectively; Hyg-CX-A: AAGATCGTTATGTTTATCGGCACT (shown in SEQ ID NO.13 and 14), and detecting whether the T0 generation transformed plants contain hygromycin screening markers, and 21 positive T0 generation plants are obtained in summer 2014. In 2014 winter, the transgenic T1 generation is obtained by the generation-adding propagation in Hainan island, the positive transgenic lines are named as BPCDx in turn according to the sampling sequence, the genome DNA is extracted from leaves, and the primers MPCD6-F are used: TGGAGGGAGTACATGTTTTAGGTG and MPCD 6-R: ATAAACATGGTTGACAAATAGAGC, sequencing the sequence of the second exon of the OsPDCD5 gene, and finding that the total 9 strains contain insertion or deletion mutation, wherein the nucleotide sequence is shown in figure 3, the sequencing result is shown in figure 4, and the coding amino acid sequence is shown in figure 5. The result proves that the success rate of knocking out the propylene 1B by the CRISPR/Cas9 system reaches 43 percent.

4. Investigation and statistics of transgenic T2 generation population yield traits

The pBWA (V) H-cas9-PDCD5.2 transgenic T2 generation is sown in spring 2015, 3 transgenic T2 generation strains are planted in the test field of the university of Fudan at the four-leaf stage, 20 strains are planted in each strain, the row spacing is 6 inches multiplied by 6 inches, and the three times of sowing are repeated, and meanwhile, the indica rice stem 1B parent control is established. Selecting a mutant strain BPDCD5 and a control strain P1B with good phenotype in the mature period, and respectively counting the plant type characters of 20 single strains of each strain as follows: the flag leaf length, leaf width, plant height, internode height, second internode middle section diameter length, ear length, effective ear number, grain number per ear, solid number, solid weight, empty number, ear weight, thousand seed weight, seed set percentage, and the average value were calculated, the statistical results are shown in tables 3 and 4, and the comparative results are shown in fig. 6 to 20.

Table 3: plant type character comparison table of Japanese Styrax 1B and mutant strain BPCD10 in mature period

Table 4: comparison table of yield traits of the Japanese (1B) and the mutant strain BPCD10

According to the above seed test values, it can be known that the plant height of the mutant transformant BPCD10 is significantly increased compared with that of the wild-type P1B; meanwhile, the single-plant yield is calculated according to the measured effective spike number of the rice and the weight of each spike, and the single-plant yields of the rice 1B and the mutant transformant BPCD10 are respectively as follows: 31.91 g and 49.50 g, the yield of the single transformant strain with OsPDCD5 function deletion obtained by the CRISPR/Cas9 system is increased to about 50 percent, and the yield of the rice plant is obviously improved. The seed test result proves that the invention can increase the plant height and yield of rice plants and provide good germplasm resources for rice breeding production by using the CRISPR/Cas9 system to knock out the second exon of the OsPDCD5 gene of rice at a fixed point to obtain a functional mutant strain.

Although the specific embodiments of the present invention have been described with reference to the examples, the scope of the present invention is not limited thereto, and those skilled in the art will appreciate that various modifications and variations can be made without inventive effort by those skilled in the art based on the technical solution of the present invention.

SEQUENCE LISTING

<110> university of Compound Dan

<120> method for site-directed knockout of second exon of rice OsPDCD5 gene by using CRISPR/Cas9 system

<130>

<160>14

<170>PatentIn version 3.5

<210>1

<211>66

<212>DNA

<213> Rice

<400>1

gctgacccag agttggaagc tatcaggcag aggagaatgc aagagctaat ggcacagcat 60

ggtgcg 66

<210>2

<211>23

<212>DNA

<213> Rice

<400>2

acccagagtt ggaagctatc agg 23

<210>3

<211>22

<212>PRT

<213> Rice

<400>3

Ala Asp Pro Glu Leu Glu Ala Ile Arg Gln Arg Arg Met Gln Glu Leu

1 5 10 15

Met Ala Gln His Gly Ala

20

<210>4

<211>13402

<212>DNA

<213> Artificial sequence

<400>4

tagaatagca tcggtaacat gagcaaagtc tgccgcctta caacggctct cccgctgacg 60

ccgtcccgga ctgatgggct gcctgtatcg agtggtgatt ttgtgccgag ctgccggtcg 120

gggagctgtt ggctggctgg tggcaggata tattgtggtg taaacaaatt gacgcttaga 180

caacttaata acacattgcg gacgttttta atgttagact gaattaacgc cgaattaatt 240

cgggggatct ggattttagt actggatttt ggttttagga attagaaatt ttattgatag 300

aagtatttta caaatacaaa tacatactaa gggtttctta tatgctcaac acatgagcga 360

aaccctatag gaaccctaat tcccttatct gggaactact cacacattat tatggagaaa 420

ctcgagcttg tcgatcgaca gatccggtcg gcatctactc tatttctttg ccctcggacg 480

agtgctgggg cgtcggtttc cactatcggc gagtacttct acacagccat cggtccagac 540

ggccgcgctt ctgcgggcga tttgtgtacg cccgacagtc ccggctccgg atcggacgat 600

tgcgtcgcat cgaccctgcg cccaagctgc atcatcgaaa ttgccgtcaa ccaagctctg 660

atagagttgg tcaagaccaa tgcggagcat atacgcccgg agtcgtggcg atcctgcaag 720

ctccggatgc ctccgctcga agtagcgcgt ctgctgctcc atacaagcca accacggcct 780

ccagaagaag atgttggcga cctcgtattg ggaatccccg aacatcgcct cgctccagtc 840

aatgaccgct gttatgcggc cattgtccgt caggacattg ttggagccga aatccgcgtg 900

cacgaggtgc cggacttcgg ggcagtcctc ggcccaaagc atcagctcat cgagagcctg 960

cgcgacggac gcactgacgg tgtcgtccat cacagtttgc cagtgataca catggggatc 1020

agcaatcgcg catatgaaat cacgccatgt agtgtattga ccgattcctt gcggtccgaa 1080

tgggccgaac ccgctcgtct ggctaagatc ggccgcagcg atcgcatcca tagcctccgc 1140

gaccggttgt agaacagcgg gcagttcggt ttcaggcagg tcttgcaacg tgacaccctg 1200

tgcacggcgg gagatgcaat aggtcaggct ctcgctaaac tccccaatgt caagcacttc 1260

cggaatcggg agcgcggccg atgcaaagtg ccgataaaca taacgatctt tgtagaaacc 1320

atcggcgcag ctatttaccc gcaggacata tccacgccct cctacatcga agctgaaagc 1380

acgagattct tcgccctccg agagctgcat caggtcggag acactgtcga acttttcgat 1440

cagaaacttc tcgacagacg tcgcggtgag ttcaggcttt ttcatatctc attgcccccc 1500

cggatctgcg aaagctcgag agagatagat ttgtagagag agactggtga tttcagcgtg 1560

tcctctccaa atgaaatgaa cttccttata tagaggaagg tcttgcgaag gatagtggga 1620

ttgtgcgtca tcccttacgt cagtggagat atcacatcaa tccacttgct ttgaagacgt 1680

ggttggaacg tcttcttttt ccacgatgct cctcgtgggt gggggtccat ctttgggacc 1740

actgtcggca gaggcatctt gaacgatagc ctttccttta tcgcaatgat ggcatttgta 1800

ggtgccacct tccttttcta ctgtcctttt gatgaagtga cagatagctg ggcaatggaa 1860

tccgaggagg tttcccgata ttaccctttg ttgaaaagtc tcaatagccc tttggtcttc 1920

tgagactgta tctttgatat tcttggagta gacgagagtg tcgtgctcca ccatgttatc 1980

acatcaatcc acttgctttg aagacgtggt tggaacgtct tctttttcca cgatgctcct 2040

cgtgggtggg ggtccatctt tgggaccact gtcggcagag gcatcttgaa cgatagcctt 2100

tcctttatcg caatgatggc atttgtaggt gccaccttcc ttttctactg tccttttgat 2160

gaagtgacag atagctgggc aatggaatcc gaggaggttt cccgatatta ccctttgttg 2220

aaaagtctca atagcccttt ggtcttctga gactgtatct ttgatattct tggagtagac 2280

gagagtgtcg tgctccacca tgttggcaag ctgctctagc caatacgcaa accgcctgca 2340

ggtctagaaa ggaatcttta aacatacgaa cagatcactt aaagttcttc tgaagcaact 2400

taaagttatc aggcatgcat ggatcttgga ggaatcagat gtgcagtcag ggaccatagc 2460

acaagacagg cgtcttctac tggtgctacc agcaaatgct ggaagccggg aacactgggt 2520

acgttggaaa ccacgtgatg tgaagaagta agataaactg taggagaaaa gcatttcgta 2580

gtgggccatg aagcctttca ggacatgtat tgcagtatgg gccggcccat tacgcaattg 2640

gacgacaaca aagactagta ttagtaccac ctcggctatc cacatagatc aaagctgatt 2700

taaaagagtt gtgcagatga tccgtggcac ccagagttgg aagctatcgt tttagagcta 2760

gaaatagcaa gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg 2820

gtgctttttt tgtcgtagac atggagtcaa agattcaaat agaggaccta acagaactcg 2880

ccgtaaagac tggcgaacag ttcatacaga gtctcttacg actcaatgac aagaagaaaa 2940

tcttcgtcaa catggtggag cacgacacac ttgtctactc caaaaatatc aaagatacag 3000

tctcagaaga ccaaagggca attgagactt ttcaacaaag ggtaatatcc ggaaacctcc 3060

tcggattcca ttgcccagct atctgtcact ttattgtgaa gatagtggaa aaggaaggtg 3120

gctcctacaa atgccatcat tgcgataaag gaaaggccat cgttgaagat gcctctgccg 3180

acagtggtcc caaagatgga cccccaccca cgaggagcat cgtggaaaaa gaagacgttc 3240

caaccacgtc ttcaaagcaa gtggattgat gtgatatctc cactgacgta agggatgacg 3300

cacaatccca ctatccttcg caagaccctt cctctatata aggaagttca tttcatttgg 3360

agagaacacg ggggacaaca tgagggctga ccccaagaag aagaggaagg tggacaagaa 3420

gtactccatt gggctcgata tcggcacaaa cagcgtcggc tgggccgtca ttacggacga 3480

gtacaaggtg ccgagcaaaa aattcaaagt tctgggcaat accgatcgcc acagcataaa 3540

gaagaacctc attggcgccc tcctgttcga ctccggggaa acggccgaag ccacgcggct 3600

caaaagaaca gcacggcgca gatatacccg cagaaagaat cggatctgct acctccagga 3660

gatctttagt aatgagatgg ctaaggtgga tgactctttc ttccataggc tggaggagtc 3720

ctttttggtg gaggaggata aaaagcacga gcgccaccca atctttggca atatcgtgga 3780

cgaggtggcg taccatgaaa agtacccaac catatatcat ctgaggaaga agctggtaga 3840

cagtactgat aaggctgact tgcggttgat ctatctcgcg ctggcgcaca tgatcaaatt 3900

tcggggacac ttcctcatcg agggggacct gaacccagac aacagcgatg tggacaaact 3960

ctttatccaa ctggttcaga cttacaatca gcttttcgaa gagaacccga tcaacgcatc 4020

cggagttgac gccaaagcaa tcctgagcgc taggctgtcc aaatcccggc ggctcgaaaa 4080

cctcatcgca cagctccctg gggagaagaa gaacggcctg tttggtaatc ttatcgccct 4140

gtcactcggg ctgaccccca actttaaatc taacttcgac ctggccgaag atgccaagct 4200

gcaactgagc aaagacacct acgatgatga tctcgacaat ctgctggccc agatcggcga 4260

ccagtacgca gacctttttt tggcggcaaa gaacctgtca gacgccattc tgctgagtga 4320

tattctgcga gtgaacacgg agatcaccaa agctccgctg agcgctagta tgatcaagcg 4380

ctatgatgag caccaccaag acttgacttt gctgaaggcc cttgtcagac agcaactgcc 4440

tgagaagtac aaggaaattt tcttcgatca gtctaaaaat ggctacgccg gatacattga 4500

cggcggagca agccaggagg aattttacaa atttattaag cccatcttgg aaaaaatgga 4560

cggcaccgag gagctgctgg taaagctgaa cagagaagat ctgttgcgca aacagcgcac 4620

tttcgacaat ggaagcatcc cccaccagat tcacctgggc gaactgcacg ctatcctcag 4680

gcggcaagag gatttctacc cctttttgaa agataacagg gaaaagattg agaaaatcct 4740

cacatttcgg ataccctact atgtaggccc cctcgcacgc ggaaattcca gattcgcgtg 4800

gatgactcgc aaatcagaag aaaccatcac tccctggaac ttcgaggaag tcgtggataa 4860

gggggcctct gcccagtcct tcatcgaaag gatgactaac tttgataaaa atctgcctaa 4920

cgaaaaggtg cttcctaaac actctctgct gtacgagtac ttcacagttt ataacgaact 4980

caccaaggtc aaatacgtca cagaagggat gagaaagcca gcattcctgt ctggagagca 5040

gaagaaagct atcgtggacc tcctcttcaa gacgaaccgg aaagttaccg tgaaacagct 5100

caaagaggac tatttcaaaa agattgaatg tttcgactct gttgaaatca gcggagtgga 5160

ggatcgcttc aacgcatccc tgggaacgta tcacgatctc ctgaaaatca ttaaagacaa 5220

ggacttcctg gacaatgagg agaacgagga cattcttgag gacattgtcc tcacccttac 5280

gttgtttgaa gatagggaga tgattgaaga acgcttgaaa acttacgctc atctcttcga 5340

cgacaaagtc atgaaacagc tcaagaggcg ccgatataca ggatgggggc ggctgtcaag 5400

aaaactgatc aatgggattc gagacaagca gagtggaaag acaatcctgg attttcttaa 5460

gtccgatgga tttgccaacc ggaacttcat gcagttgatc catgatgact ctctcacctt 5520

taaggaggac atccagaaag cacaagtttc tggccagggg gacagtctgc acgagcacat 5580

cgctaatctt gcaggtagcc cagctatcaa aaagggaata ctgcagaccg ttaaggtcgt 5640

ggatgaactc gtcaaagtaa tgggaaggca taagcccgag aatatcgtta tcgagatggc 5700

ccgagagaac caaactaccc agaagggaca gaagaacagt agggaaagga tgaagaggat 5760

tgaagagggt ataaaagaac tggggtccca aatccttaag gaacacccag ttgaaaacac 5820

ccagcttcag aatgagaagc tctacctgta ctacctgcag aacggcaggg acatgtacgt 5880

ggatcaggaa ctggacatca atcggctctc cgactacgac gtggatcata tcgtgcccca 5940

gtcttttctc aaagatgatt ctattgataa taaagtgttg acaagatccg ataaaaatag 6000

agggaagagt gataacgtcc cctcagaaga agttgtcaag aaaatgaaaa attattggcg 6060

gcagctgctg aacgccaaac tgatcacaca acggaagttc gataatctga ctaaggctga 6120

acgaggtggc ctgtctgagt tggataaagc cggcttcatc aaaaggcagc ttgttgagac 6180

acgccagatc accaagcacg tggcccaaat tctcgattca cgcatgaaca ccaagtacga 6240

tgaaaatgac aaactgattc gagaggtgaa agttattact ctgaagtcta agctggtgtc 6300

agatttcaga aaggactttc agttttataa ggtgagagag atcaacaatt accaccatgc 6360

gcatgatgcc tacctgaatg cagtggtagg cactgcactt atcaaaaaat atcccaagct 6420

ggaatctgaa tttgtttacg gagactataa agtgtacgat gttaggaaaa tgatcgcaaa 6480

gtctgagcag gaaataggca aggccaccgc taagtacttc ttttacagca atattatgaa 6540

ttttttcaag accgagatta cactggccaa tggagagatt cggaagcgac cacttatcga 6600

aacaaacgga gaaacaggag aaatcgtgtg ggacaagggt agggatttcg cgacagtccg 6660

gaaggtcctg tccatgccgc aggtgaacat cgttaaaaag accgaagtac agaccggagg 6720

cttctccaag gaaagtatcc tcccgaaaag gaacagcgac aagctgatcg cacgcaaaaa 6780

agattgggac cccaagaaat acggcggatt cgattctcct acagtcgctt acagtgtact 6840

ggttgtggcc aaagtggaga aagggaagtc taaaaaactc aaaagcgtca aggaactgct 6900

gggcatcaca atcatggagc gatcaagttt cgaaaaaaac cccatcgact ttctggaggc 6960

gaaaggatat aaagaggtca aaaaagacct catcattaag ctgcccaagt actctctctt 7020

tgagcttgaa aacggccgga aacgaatgct cgctagtgcg ggcgagctgc agaaaggtaa 7080

cgagctggca ctgccctcta aatacgttaa tttcttgtat ctggccagcc actatgaaaa 7140

gctcaaaggg tcccccgaag ataatgagca gaagcagctg ttcgtggaac aacacaaaca 7200

ctaccttgat gagatcatcg agcaaataag cgagttctcc aaaagagtga tcctcgccga 7260

cgctaacctc gataaggtgc tttctgctta caataagcac agggataagc ccatcaggga 7320

gcaggcagaa aacattatcc acttgtttac tctgaccaac ttgggcgcac ctgcagcctt 7380

caagtacttc gacaccacca tagacagaaa gcggtacacc tctacaaagg aggtcctgga 7440

cgccacactg attcatcagt caattacggg gctctatgaa acaagaatcg acctctctca 7500

gctcggtgga gacagcaaga gtccagctgc taccaagaag gctggacagg ctaagaagaa 7560

gaagtgatgt agaagactga ccagctcgaa tttccccgat cgttcaaaca tttggcaata 7620

aagtttctta agattgaatc ctgttgccgg tcttgcgatg attatcatat aatttctgtt 7680

gaattacgtt aagcatgtaa taattaacat gtaatgcatg acgttattta tgagatgggt 7740

ttttatgatt agagtcccgc aattatacat ttaatacgcg atagaaaaca aaatatagcg 7800

cgcaaactag gataaattat cgcgcgcggt gtcatctatg ttactagatc gggccatccg 7860

cactgtagcg gatggcctaa aaaaaaaagt cgtagaggaa gagcagtctg agactcaggc 7920

tcttcggtcg cagtcataac ttcgtatagc atacattata cgaagttatg ggccgcatta 7980

ccctgttatc cctaggccgc ataacttcgt atagcctaca ttataggatg gagggatatc 8040

ctctcttaag gtagcgagca agctctaaga ggagtgtcga caagcttggc actggccgtc 8100

gttttacaac gtcgtgactg ggaaaaccct ggcgttaccc aacttaatcg ccttgcagca 8160

catccccctt tcgccagctg gcgtaatagc gaagaggccc gcaccgatcg cccttcccaa 8220

cagttgcgca gcctgaatgg cgaatgctag agcagcttga gcttggatca gattgtcgtt 8280

tcccgccttc agtttaaact atcagtgttt gacaggatat attggcgggt aaacctaaga 8340

gaaaagagcg tttattagaa taacggatat ttaaaagggc gtgaaaaggt ttatccgttc 8400

gtccatttgt atgtgcatgc caaccacagg gttcccctcg ggatcaaagt actttgatcc 8460

aacccctccg ctgctatagt gcagtcggct tctgacgttc agtgcaggag atgatcgcgg 8520

ccgggtacgt gttcgagccg cccgcgcatg tctcaaccgt gcggctgcat gaaatcctgg 8580

ccggtttgtc tgatgccaag ctggcggcct ggccggccag cttggccgct gaagaaaccg 8640

agcgccgccg tctaaaaagg tgatgtgtat ttgagtaaaa cagcttgcgt catgcggtcg 8700

ctgcgtatat gatgcgatga gtaaataaac aaatacgcaa ggggaacgca tgaaggttat 8760

cgctgtactt aaccagaaag gcgggtcagg caagacgacc atcgcaaccc atctagcccg 8820

cgccctgcaa ctcgccgggg ccgatgttct gttagtcgat tccgatcccc agggcagtgc 8880

ccgcgattgg gcggccgtgc gggaagatca accgctaacc gttgtcggca tcgaccgccc 8940

gacgattgac cgcgacgtga aggccatcgg ccggcgcgac ttcgtagtga tcgacggagc 9000

gccccaggcg gcggacttgg ctgtgtccgc gatcaaggca gccgacttcg tgctgattcc 9060

ggtgcagcca agcccttacg acatatgggc caccgccgac ctggtggagc tggttaagca 9120

gcgcattgag gtcacggatg gaaggctaca agcggccttt gtcgtgtcgc gggcgatcaa 9180

aggcacgcgc atcggcggtg aggttgccga ggcgctggcc gggtacgagc tgcccattct 9240

tgagtcccgt atcacgcagc gcgtgagcta cccaggcact gccgccgccg gcacaaccgt 9300

tcttgaatca gaacccgagg gcgacgctgc ccgcgaggtc caggcgctgg ccgctgaaat 9360

taaatcaaaa ctcatttgag ttaatgaggt aaagagaaaa tgagcaaaag cacaaacacg 9420

ctaagtgccg gccgtccgag cgcacgcagc agcaaggctg caacgttggc cagcctggca 9480

gacacgccag ccatgaagcg ggtcaacttt cagttgccgg cggaggatca caccaagctg 9540

aagatgtacg cggtacgcca aggcaagacc attaccgagc tgctatctga atacatcgcg 9600

cagctaccag agtaaatgag caaatgaata aatgagtaga tgaattttag cggctaaagg 9660

aggcggcatg gaaaatcaag aacaaccagg caccgacgcc gtggaatgcc ccatgtgtgg 9720

aggaacgggc ggttggccag gcgtaagcgg ctgggttgtc tgccggccct gcaatggcac 9780

tggaaccccc aagcccgagg aatcggcgtg acggtcgcaa accatccggc ccggtacaaa 9840

tcggcgcggc gctgggtgat gacctggtgg agaagttgaa ggccgcgcag gccgcccagc 9900

ggcaacgcat cgaggcagaa gcacgccccg gtgaatcgtg gcaagcggcc gctgatcgaa 9960

tccgcaaaga atcccggcaa ccgccggcag ccggtgcgcc gtcgattagg aagccgccca 10020

agggcgacga gcaaccagat tttttcgttc cgatgctcta tgacgtgggc acccgcgata 10080

gtcgcagcat catggacgtg gccgttttcc gtctgtcgaa gcgtgaccga cgagctggcg 10140

aggtgatccg ctacgagctt ccagacgggc acgtagaggt ttccgcaggg ccggccggca 10200

tggccagtgt gtgggattac gacctggtac tgatggcggt ttcccatcta accgaatcca 10260

tgaaccgata ccgggaaggg aagggagaca agcccggccg cgtgttccgt ccacacgttg 10320

cggacgtact caagttctgc cggcgagccg atggcggaaa gcagaaagac gacctggtag 10380

aaacctgcat tcggttaaac accacgcacg ttgccatgca gcgtacgaag aaggccaaga 10440

acggccgcct ggtgacggta tccgagggtg aagccttgat tagccgctac aagatcgtaa 10500

agagcgaaac cgggcggccg gagtacatcg agatcgagct agctgattgg atgtaccgcg 10560

agatcacaga aggcaagaac ccggacgtgc tgacggttca ccccgattac tttttgatcg 10620

atcccggcat cggccgtttt ctctaccgcc tggcacgccg cgccgcaggc aaggcagaag 10680

ccagatggtt gttcaagacg atctacgaac gcagtggcag cgccggagag ttcaagaagt 10740

tctgtttcac cgtgcgcaag ctgatcgggt caaatgacct gccggagtac gatttgaagg 10800

aggaggcggg gcaggctggc ccgatcctag tcatgcgcta ccgcaacctg atcgagggcg 10860

aagcatccgc cggttcctaa tgtacggagc agatgctagg gcaaattgcc ctagcagggg 10920

aaaaaggtcg aaaagatctc tttcctgtgg atagcacgta cattgggaac ccaaagccgt 10980

acattgggaa ccggaacccg tacattggga acccaaagcc gtacattggg aaccggtcac 11040

acatgtaagt gactgatata aaagagaaaa aaggcgattt ttccgcctaa aactctttaa 11100

aacttattaa aactcttaaa acccgcctgg cctgtgcata actgtctggc cagcgcacag 11160

ccgaagctcc cggatacggt cacagcttgt ctgtaagcgg atgccgggag cagacaagcc 11220

cgtcagggcg cgtcagcggg tgttggcggg tgtcggggcg cagccatgac ccagtcacgt 11280

agcgatagcg gagtgtatac tggcttaact atgcggcatc agagcagatt gtactgagag 11340

tgcaccatat gcggtgtgaa ataccgcaca gatgcgtaag gagaaaatac cgcatcaggc 11400

gttcatccgc ttcctcgctc actgactcgc tgcgctcggt cgttcggctg cggcgagcgg 11460

tatcagctca ctcaaaggcg gtaatacggt tatccacaga atcaggggat aacgcaggaa 11520

agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg 11580

cgtttttcca taggctccgc ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga 11640

ggtggcgaaa cccgacagga ctataaagat accaggcgtt tccccctgga agctccctcg 11700

tgcgctctcc tgttccgacc ctgccgctta ccggatacct gtccgccttt ctcccttcgg 11760

gaagcgtggc gctttctcat agctcacgct gtaggtatct cagttcggtg taggtcgttc 11820

gctccaagct gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc gccttatccg 11880

gtaactatcg tcttgagtcc aacccggtaa gacacgactt atcgccactg gcagcagcca 11940

ctggtaacag gattagcaga gcgaggtatg taggcggtgc tacagagttc ttgaagtggt 12000

ggcctaacta cggctacact agaaggacag tatttggtat ctgcgctctg ctgaagccag 12060

ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa acaaaccacc gctggtagcg 12120

gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct caagaagatc 12180

ctttgatctt ttctacgggg tctgacgctc agtggaacga aaactcacgt taagggattt 12240

tggtcatgca ttctaggtac taaaacaatt catccagtaa aatataatat tttattttct 12300

cccaatcagg cttgatcccc agtaagtcaa aaaatagctc gacatactgt tcttccccga 12360

tatcctccct gatcgaccgg acgcagaagg caatgtcata ccacttgtcc gccctgccgc 12420

ttctcccaag atcaataaag ccacttactt tgccatcttt cacaaagatg ttgctgtctc 12480

ccaggtcgcc gtgggaaaag acaagttcct cttcgggctt ttccgtcttt aaaaaatcat 12540

acagctcgcg cggatcttta aatggagtgt cctcttccca gttttcgcaa tccacatcgg 12600

ccagatcgtt attcagtaag taatccaatt cggctaagcg gctgtctaag ctattcgtat 12660

agggacaatc cgatatgtcg atggagtgaa agagcctgat gcactccgca tacagctcga 12720

taatcttttc agggctttgt tcatcttcat actcttccga gcaaaggacg ccatcggcct 12780

cactcatgag cagattgctc cagccatcat gccgttcaaa gtgcaggacc tttggaacag 12840

gcagctttcc ttccagccat agcatcatgt ccttttcccg ttccacatca taggtggtcc 12900

ctttataccg gctgtccgtc atttttaaat ataggttttc attttctccc accagcttat 12960

ataccttagc aggagacatt ccttccgtat cttttacgca gcggtatttt tcgatcagtt 13020

ttttcaattc cggtgatatt ctcattttag ccatttatta tttccttcct cttttctaca 13080

gtatttaaag ataccccaag aagctaatta taacaagacg aactccaatt cactgttcct 13140

tgcattctaa aaccttaaat accagaaaac agctttttca aagttgtttt caaagttggc 13200

gtataacata gtatcgacgg agccgatttt gaaaccgcgg tgatcacagg cagcaacgct 13260

ctgtcatcgt tacaatcaac atgctaccct ccgcgagatc atccgtgttt caaacccggc 13320

agcttagttg ccgttcttcc gaatagcatc ggtaacatga gcaaagtctg ccgccttaca 13380

acggctctcc cgctgacgcc gt 13402

<210>5

<211>32

<212>DNA

<213> Artificial sequence

<400>5

cagtggtctc aggcacccag agttggaagc ta 32

<210>6

<211>32

<212>DNA

<213> Artificial sequence

<400>6

cagtggtctc aaaacgatag cttccaactc tg 32

<210>7

<211>24

<212>DNA

<213> Artificial sequence

<400>7

tggagggagt acatgtttta ggtg 24

<210>8

<211>24

<212>DNA

<213> Artificial sequence

<400>8

ataaacatgg ttgacaaata gagc 24

<210>9

<211>20

<212>DNA

<213> Rice

<400>9

acccagagtt ggaagctatc 20

<210>10

<211>49

<212>DNA

<213> Artificial sequence

<400>10

cagtggtctc aggcacccag agttggaagc tatcgttttg agaccagtg 49

<210>11

<211>20

<212>DNA

<213> Artificial sequence

<400>11

ggcgtcttct actggtgcta 20

<210>12

<211>20

<212>DNA

<213> Artificial sequence

<400>12

gtctttacgg cgagttctgt 20

<210>13

<211>21

<212>DNA

<213> Artificial sequence

<400>13

agatgttggc gacctcgtat t 21

<210>14

<211>24

<212>DNA

<213> Artificial sequence

<400>14

aagatcgtta tgtttatcgg cact 24

Claims (8)

1. A method for knocking out a second exon of a rice OsPDCD5 gene at a fixed point by using a CRISPR/Cas9 system is characterized by comprising the following steps: selecting a 23bp sequence shown as SEQ ID NO.2 in a second exon of the OsPDCD5 gene as a target sequence, amplifying a target fragment, and connecting the target fragment to a pBWA (V) H-cas9 vector in an enzyme digestion connection manner to obtain a fusion vector; the fusion vector is transformed into rice in an agrobacterium-mediated mode, positive plants are identified in transgenic T1 progeny through PCR, strains homozygous for mutation sites are searched in T2 generations and T3 generations, and the nucleotide sequence of the fusion vector is shown in SEQ ID No. 4.

2. The method for site-directed knockout of the second exon in the OsPDCD5 gene of rice by using the CRISPR/Cas9 system according to claim 1, wherein the method comprises the following steps: the nucleotide sequence of the specific primer used for amplifying the target fragment is as follows:

yjstgt forward primer: cagtGGTCTCaggcacccagagttggaagcta, respectively;

yjstgt reverse primer: cagtGGTCTCaaaacgatagcttccaactctg are provided.

3. The method for site-directed knockout of the second exon in the OsPDCD5 gene of rice by using the CRISPR/Cas9 system according to claim 1, wherein the method comprises the following steps: the method for searching the strain homozygous for the mutation site in the T2 and T3 generations comprises the following steps: primers MPCD6-F were used: TGGAGGGAGTACATGTTTTAGGTG and MPCD 6-R: ATAAACATGGTTGACAAATAGAGC, detecting the sequence of the second exon of the OsPDCD5 gene in the plant, and judging whether the second exon of the OsPDCD5 gene is successfully knocked out according to the detection result.

4. A recombinant expression vector for improving rice traits, comprising: is obtained by connecting a nucleotide fragment shown in SEQ ID NO.9 with a pBWA (V) H-cas9 vector, and the nucleotide sequence of the recombinant expression vector is shown in SEQ ID NO. 4.

5. Use of the recombinant expression vector of claim 4 for modifying a rice trait selected from the group consisting of: increase the effective spike number, branch number and spike grain number of rice plants, increase the plant height, leaf length, internode height and spike length of the rice plants, and increase the thousand grain weight and yield of the rice.

6. The application of the second exon of the rice OsPDCD5 gene in improving rice traits is characterized in that: in specific application, the method of claim 1 is applied to knock out a second exon of the OsPDCD5 gene in rice seeds at a fixed point; the modified rice trait is selected from the group consisting of: increase the effective spike number, branch number and spike grain number of rice plants, increase the plant height, leaf length, internode height and spike length of the rice plants, and increase the thousand grain weight and yield of the rice.

7. Use according to claim 5 or 6, characterized in that: the rice variety is indica rice stalk 1B.

8. Use according to claim 5, characterized in that: when the recombinant expression vector is specifically applied, the recombinant expression vector is transformed into rice to knock out a second exon of an OsPDCD5 gene in rice seeds at a fixed point.

Images