CN109666693A - Application of the MG132 in base editing system editor's acceptor gene group - Google Patents
Application of the MG132 in base editing system editor's acceptor gene group Download PDFInfo
- Publication number
- CN109666693A CN109666693A CN201811634020.9A CN201811634020A CN109666693A CN 109666693 A CN109666693 A CN 109666693A CN 201811634020 A CN201811634020 A CN 201811634020A CN 109666693 A CN109666693 A CN 109666693A
- Authority
- CN
- China
- Prior art keywords
- receptor
- base
- editing system
- sgrna
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
Abstract
The invention discloses application of the MG132 in base editing system editor's acceptor gene group.It is demonstrated experimentally that MG132 can be improved base editing system editorial efficiency, increases base editing system base replacement purity and expand base editing system mutation window ranges, and then efficiently obtain the more mutant in mutational site.The present invention has important application value.
Description
Technical field
The invention belongs to field of biotechnology, and in particular to MG132 is in base editing system editor's acceptor gene group
Using.
Background technique
CRISPR-Cas9 technology has become strong genome edit, be widely applied to many tissues and
In cell.CRISPR/Cas9 protein-RNA compound is positioned on target spot by guide RNA (guide RNA), and cutting produces
The starting DNA repair mechanism of raw DNA double chain fracture (dsDNA break, DSB), then organism meeting instinct repairs DSB.It repairs
There are two types of mechanism is general, one is non-homologous end joining (non-homologous end joining, NHEJ), and another kind is
Homologous recombination (homology-directed repair, HDR).NHEJ is in the great majority under normal conditions, therefore repairs generation
Random indels (insertions or deletions) is more much higher than accurately repairing.Base is accurately replaced, because
HDR low efficiency and DNA profiling is needed, so being very restricted using the application that HDR realizes that base is accurately replaced.
2016, two laboratories David Liu and Akihiko Kondo independently report two it is different types of
Cytosine base editing machine (cytosine base editor, CBE), principle is directly realized by by using cytidine deaminase
Single cytimidine (Cytosine, C) base is edited, and is no longer repaired by generating DSB and starting HDR, is greatly improved
C replaces with the base editorial efficiency (i.e. C → T base replacement efficiency) of thymidine (Thymine, T).
PmCDA1(activation-induced cytidine deaminase(AID)ortholog from sea
It lamprey) is a kind of cytidine deaminase.In the PmCDA1 editing machine tested, SpCas9n (D10A) &PmCDA1&UGI alkali
Base editing system (it contains ura DNA saccharification enzyme inhibitor (uracil DNA glycosylase inhibitor, UGI))
Average mutation rate it is higher, reason has two: first is that UGI can inhibit ura DNA carbohydrase (uracil DNA
Glycosylase, UDG) it is catalyzed and removes uracil (Uracil, U) in DNA, second is that SpCas9n (D10A) is produced on non-editor's chain
Raw notch, inducible eukaryotic mismatch repair mechanism or long-patch BER (base-excision repair) repair mechanism, promote
Make the more Preference reparations of U:G mispairing at U:A.SpCas9n (D10A) is inconjunction with PmCDA1 and navigates to target spot by sgRNA,
C on the single stranded DNA of PmCDA1 catalysis non-matching occurs cytimidine deamination reaction and becomes U, by the reparation of DNA so that U and A
(adenine, Adenine) pairing matches T and A, to realize the conversion of C to T further through DNA replication dna.
In order to improve working efficiency, job costs are reduced, the raising that C → T base replaces efficiency is always Plant Genome
The research direction of base editing system.SpCas9n (D10A) &PmCDA1&UGI base editing system in practice, in addition to
C → T base replacement efficiency can be paid close attention to, can may also be concerned about indel rate, that is, purity.Although Indel mostly occurs in pairing
On chain, it can be separated by genetic development in offspring and obtain the mutant for being free of Indel containing only base mutation, but if in T0 generation
The mutant without indel is just obtained, T1 generation experiment is also just not required to carry out a large amount of Purity, greatlys save manpower and material resources wealth
Power greatly improves efficiency.Therefore, purity is improved to enable to SpCas9n (D10A) &PmCDA1&UGI base editing system exists
It is highly efficient in practical application.
It in addition, there will be result of study and show that (D10A) &PmCDA1&UGI base editing system is more biased towards in right SpCas9n
Target spot 5 ' holds the C in 2-6bp to be replaced, if can break this limitation, realizes that more C are replaced inside target spot,
Realize that expanding base replaces diversity, then can get the richer allelic variant form of a certain gene, to extend the gene
Functional study and application.
Proteasome inhibitor MG132 (carbobenzoxyl-leucinylleucinyl-leucinal-Hl) is extensive
For adjusting ubiquitin-proteasome pathway.
Summary of the invention
The purpose of the present invention is improve the editorial efficiency of base editing system and/or increase the replacement of base editing system base
Purity and/or expansion base editing system are mutated window ranges.
The present invention protects the method for improving base editing system editorial efficiency first.
The present invention method to be protected for improving base editing system editorial efficiency, concretely method A1, it may include such as
Lower step: making expression of receptor sgRNA, Cas9 albumen and cytosine deaminase, thus to the target gene in the acceptor gene group
Carry out base editor.
The present invention method to be protected for improving base editing system editorial efficiency, concretely method A2, it may include such as
Lower step: make expression of receptor sgRNA, Cas9 albumen, cytosine deaminase and ura DNA saccharification enzyme inhibitor, thus to institute
The target gene stated in acceptor gene group carries out base editor.
The present invention also protects the method for increasing base editing system base replacement purity.
The present invention method to be protected for increasing base editing system base replacement purity, concretely method B1, can wrap
It includes following steps: making expression of receptor sgRNA, Cas9 albumen and cytosine deaminase, thus to the target in the acceptor gene group
Gene carries out base editor.
The present invention method to be protected for increasing base editing system base replacement purity, concretely method B2, can wrap
It includes following steps: making expression of receptor sgRNA, Cas9 albumen, cytosine deaminase and ura DNA saccharification enzyme inhibitor, thus
Base editor is carried out to the target gene in the acceptor gene group.
The present invention also protects the method for expanding base editing system mutation window ranges.
The present invention method to be protected for expanding base editing system mutation window ranges, concretely method C1, can wrap
It includes following steps: making expression of receptor sgRNA, Cas9 albumen and cytosine deaminase, thus to the target in the acceptor gene group
Gene carries out base editor.
The present invention method to be protected for expanding base editing system mutation window ranges, concretely method C2, can wrap
It includes following steps: making expression of receptor sgRNA, Cas9 albumen, cytosine deaminase and ura DNA saccharification enzyme inhibitor, thus
Base editor is carried out to the target gene in the acceptor gene group.
In the method A1, the method B1 and the method C1, " make expression of receptor sgRNA, Cas9 albumen and cytimidine
Deaminase " can be by compiling the encoding gene of the sgRNA, the encoding gene of the Cas9 albumen and the cytosine deaminase
Code channel genes receptor is realized.Receptor is imported specifically, can be placed in a carrier, can also be placed in different carriers and divide
It Dao Ru not receptor.
In the method A2, the method B2 and the method C2, " make expression of receptor sgRNA, Cas9 albumen, cytimidine
Deaminase and ura DNA are saccharified enzyme inhibitor " it can be by by the coding of the encoding gene of the sgRNA, the Cas9 albumen
It is real that the encoding gene of gene, the cytosine deaminase encoding gene and ura DNA saccharification enzyme inhibitor imports receptor
It is existing.Receptor is imported specifically, can be placed in a carrier, can also be placed in different carriers and be directed respectively into receptor.
In any of the above-described method, it can also make expression of receptor hygromycin albumen (for screening).It is described " to make receptor
Express hygromycin albumen " it can be realized by the way that the encoding gene of the hygromycin albumen is imported receptor.Specifically, can be with
Said elements are placed in a carrier and import receptor, can also be placed in different carriers and be directed respectively into receptor.
In any of the above-described method, the receptor can be plant callus.
In any of the above-described method, " importing plant callus " can by infecting, co-culturing, screening step, obtain
To edited plant callus.Wherein co-culturing step MG132 processing plant callus.
In any of the above-described method, during the importing receptor, receptor can be handled with MG132.The MG132
The mode for handling receptor can are as follows: the receptor for co-culturing 22 ± 2h is placed in the liquid phase containing MG132,28 ± 2 DEG C of suspension cultures 20
±2h.The liquid phase can for containing 100-300mg/L (such as 100-200mg/L, 200-300mg/L, 100mg/L, 200mg/L or
300mg/L) the N6 fluid nutrient medium of Ticarcillin/Clavulanate Acid.
In any of the above-described method for improving base editing system editorial efficiency, the concentration of the MG132 can be 35-
45mg/L (such as 35-40mg/L, 40-45mg/L, 35mg/L, 40mg/L or 45mg/L).
Any of the above-described method or any of the above-described expansion base for increasing base editing system base replacement purity
Editing system is mutated in the method for window ranges, and the concentration of the MG132 can be 10-45mg/L (10-20mg/L, 20-35mg/
L, 35-40mg/L, 40-45mg/L, 10mg/L, 20mg/L, 35mg/L, 40mg/L or 45mg/L).
In any of the above-described method, the hygromycin albumen can be hygromix phosphotransferase.Hygromycin phosphoric acid
The amino acid sequence of transferase can by sequence 1 in sequence table from 5 ' ends nucleotide sequence shown in the 10786th to 11811
It translates.Encode the hygromix phosphotransferase gene can as in sequence table sequence 1 from 5 ' ends the 10786th to
Shown in 11811.
In any of the above-described method, the Cas9 albumen can be SpCas9n albumen.The amino acid of SpCas9n albumen
Sequence can nucleotide sequence shown in the 3010th to 7278 be translated from 5 ' ends by sequence 1 in sequence table.Coding institute
The gene for stating SpCas9n albumen can be as shown in sequence 1 the 3010th to 7278 from 5 ' ends in sequence table.
In any of the above-described method, the cytosine deaminase can be PmCDA1.The amino acid sequence of PmCDA1 can
By sequence 1 in sequence table, nucleotide sequence shown in the 7570th to 8193 is translated from 5 ' ends.Described in coding
The gene of PmCDA1 can be as shown in sequence 1 the 7570th to 8193 from 5 ' ends in sequence table.
In any of the above-described method, the amino acid sequence of the ura DNA saccharification enzyme inhibitor can be by sequence table
Middle sequence 1 nucleotide sequence shown in the 8215th to 8511 from 5 ' ends is translated.Encode the ura DNA saccharification
The gene of enzyme inhibitor can be as shown in sequence 1 the 8215th to 8511 from 5 ' ends in sequence table.
In any of the above-described method, the sgRNA can be according to the target for carrying out base editor expected in acceptor gene group
Gene design.
In any of the above-described method, the plant can be a1) or a2) or a3): a1) gramineae plant；A2) rice；
A3) rice varieties OryzasativaLcv.Nipponbare.
The present invention also protects X1) or X2) or X3) or X4).
X1) MG132 is improving the application in base editing system editorial efficiency.
X2) MG132 is increasing the application in base editing system base replacement purity.
X3) MG132 is expanding the application in base editing system mutation window ranges.
X4) application of the MG132 in base editing system editor's acceptor gene group.
Any of the above-described editor can replace for C → T base.
Any of the above-described editorial efficiency can replace efficiency for C → T base.
Any of the above-described mutation window can be mutated window for C → T.
In one embodiment of the invention, the present inventor constructs carrier S pCas9n&PmCDA1&UGI.It carries
SgRNA in body SpCas9n&PmCDA1&UGI is according to three shot designs of table 1.Carrier S pCas9n&PmCDA1&UGI (ring
Shape) nucleotide sequence as shown in sequence 1 in sequence table.In sequence 1, from 5 ' to 3 ', the 131st to 467 starts for OsU3
Son nucleotide sequence, the 474th to 550, the 647th to 723 and the 820th to 896 be pre-tRNA nucleotides sequence
Column, the 551st to 570 nucleotide sequence for CS650, the 571st to 646, the 744th to 819 and the 917th to 992
For the nucleotide sequence of sgRNA skeleton, the 724th to 743 nucleotide sequence for CS651, the 897th to 916 is CS652's
Nucleotide sequence, the 993rd to 1283 nucleotide sequence for OsU3 terminator, the 1290th to 3003 is OsUbq3 promoter
Nucleotide sequence, the 3010th to 7278 nucleotide sequence (do not contain terminator codon) for SpCas9n albumen, the 7570th
To 8193 nucleotide sequences (not containing terminator codon) for PmCDA1, the 8215th to 8511 nucleotides sequence for UGI
Column, the 8518th to 8712 nucleotide sequence for 35S terminator, the 8787th to 10779 nucleosides for ZmUbi1 promoter
Acid sequence, the 10786th to 11811 nucleotide sequence for hygromix phosphotransferase, the 11812nd to 12064 whole for Nos
Only sub nucleotide sequence.Carrier S pCas9n&PmCDA1&UGI is imported into Agrobacterium LBA4404, obtains recombinational agrobacterium, so
After prepare Agrobacterium infected liquid；The callus of rice varieties OryzasativaLcv.Nipponbare is placed in the Agrobacterium infected liquid containing acetosyringone and is soaked
Bubble, 21 DEG C dark culture 1 day, be subsequently placed in the N6 fluid nutrient medium of the Ticarcillin/Clavulanate Acid containing MG132 and 200mg/L, 28 DEG C of suspension are cultivated
20h is finally placed on recovery media (the N6 solid medium of such as Ticarcillin/Clavulanate Acid containing 100-300mg/L), 25-28 DEG C of dark culture 2
It；It finally screens, obtains kanamycin-resistant callus tissue；Count C → T base replacement efficiency, base replacement purity and the C in positive kanamycin-resistant callus tissue
→ T is mutated window.Compared with without MG132 processing, the N6 Liquid Culture of MG132 containing 35-45mg/L and 200mg/L Ticarcillin/Clavulanate Acid
Base dramatically increases C → T base replacement efficiency of three target spots；The N6 liquid of MG132 containing 10-45mg/L and 200mg/L Ticarcillin/Clavulanate Acid
Body culture medium dramatically increases the base replacement purity of CS651 and CS652 and (it is special wherein to contain only 20mg/L MG132 and 200mg/L
CS651 base replacement purity is constant after the N6 fluid nutrient medium processing in U.S. spit of fland)；The special beauty of MG132 containing 10-45mg/L and 200mg/L
The N6 fluid nutrient medium in spit of fland significantly expands C → T mutation window ranges of three target spots, i.e., more multipoint C is replaced
Change (the wherein unrealized C → T mutation window of the CS650 of the N6 fluid nutrient medium of MG132 containing 20mg/L and 200mg/L Ticarcillin/Clavulanate Acid processing
Mouth extension).
Above, expand the range of base editing system mutation window ranges concretely base editing system editor
Expand, i.e., more multipoint C is substituted for T.
It can be seen that MG132 can be improved base editing system editorial efficiency, increase base editing system base replacement it is pure
Degree and expansion base editing system are mutated window ranges, and then realize and efficiently obtain the more mutant in mutational site.The present invention
With important application value.
Detailed description of the invention
Fig. 1 is that various concentration MG132 handles SpCas9n (D10A) &PmCDA1&UGI base editing system after rice callus
C → T base replacement efficiency experimental result.
Fig. 2 is that various concentration MG132 handles SpCas9n (D10A) &PmCDA1&UGI base editing system after rice callus
Base replacement purity experimental result.
Specific embodiment
Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.
Experimental method in following embodiments is unless otherwise specified conventional method.
Test material as used in the following examples is unless otherwise specified to buy from routine biochemistry reagent shop
It arrives.
Three target spots shown in the 2nd column are tested in following embodiment selection tables 1, and target sequence is shown in Table the 3rd column in 1,
Corresponding target gene is shown in Table the 1st column in 1.
Table 1
| Target gene | Target spot title | Target sequence |
| OsALS | CS650 | cgcgtccatggagatccacc |
| OsCDC48 | CS651 | gaccagccagcgtctggcgc |
| OsNRT1.1B | CS652 | cggcgacggcgagcaagtgg |
Primer pair 650 is by primer CS650-F:5 '-taagaaccaccagcgacacc-3 ' and primer CS650-R:5 '-
Ggtaattgtgcttggtgatggag-3 ' composition, for expanding CS650.
Primer pair 651 is by primer CS651-F:5 '-acatcgagatggagaagcgg-3 ' and primer CS651-R:5 '-
Ccatgctccaatcgatgaatac-3 ' composition, for expanding CS651.
Primer pair 652 is by primer CS652-F:5 '-ttacgaactttataactttgtcgg-3 ' and primer CS652-R:
5 '-atggaggcgatgaggaagac-3 ' composition, for expanding CS652.
Embodiment 1, various concentration MG132 processing are to the SpCas9n (influence of D10A) &PmCDA1&UGI base editing system
One, the building of gene editing carrier
The present inventor constructs carrier S pCas9n&PmCDA1&UGI.
The nucleotide sequence of carrier S pCas9n&PmCDA1&UGI (annular) is as shown in sequence 1 in sequence table.In sequence 1,
From 5 ' to 3 ', the 131st to 467 be OsU3 promoter nucleotide sequence, the 474th to 550, the 647th to 723 and the
820 to 896 be pre-tRNA nucleotide sequence, the 551st to 570 be CS650 nucleotide sequence, the 571st to 646
Position, the 744th to 819 and the 917th to 992 be sgRNA skeleton nucleotide sequence, the 724th to 743 is CS651
Nucleotide sequence, the 897th to 916 nucleotide sequence for CS652, the 993rd to 1283 nucleotide for OsU3 terminator
Sequence, the 1290th to 3003 nucleotide sequence for OsUbq3 promoter, the 3010th to 7278 nucleotide for SpCas9n
Sequence (does not contain terminator codon), the 7570th to 8193 nucleotide sequence (not containing terminator codon) for PmCDA1,
8215th to 8511 nucleotide sequence for UGI, the 8518th to 8712 nucleotide sequence for 35S terminator, the 8787th
It is the nucleotide sequence of ZmUbi1 promoter, the 10786th to 11811 nucleosides for hygromix phosphotransferase to 10779
Acid sequence, the 11812nd to 12064 nucleotide sequence for Nos terminator.
Two, gene editing is carried out in callus
1, carrier S pCas9n&PmCDA1&UGI is imported into Agrobacterium LBA4404 (Shanghai Wei Di Bioisystech Co., Ltd
Product, CAT# AC1030), obtain recombinational agrobacterium.
2, recombinational agrobacterium is seeded to the YEP culture medium containing 50 μ g/ml kanamycins and 25 μ g/ml rifampins, 28 DEG C,
150rpm shake culture, obtains OD600nmFor the culture bacterium solution of 1.0-2.0；Take the culture bacterium solution, room temperature, 10000rpm centrifugation
1min collects thallus；The thallus is taken, is resuspended with infected liquid and is diluted to OD600nmIt is 0.2, obtains Agrobacterium infected liquid.
Infected liquid is that the sugar in N6 fluid nutrient medium is replaced with dextrose and saccharose to obtain；In infected liquid, glucose
Concentration be 10g/L, the concentration of sucrose is 20g/L.
3, rice varieties OryzasativaLcv.Nipponbare mature seed decladding threshing is placed in 100mL triangular flask, and 70% (v/v) ethyl alcohol is added
Aqueous solution soaking 30sec, then be placed in 25% (v/v) aqueous sodium hypochlorite solution, 120rpm concussion sterilizing 30min, sterile water punching
Wash 3 times, with filter paper suck dry moisture, then seed embryo be placed in downward on N6 solid medium, 28 DEG C dark culture 4-6 weeks, obtain
Callus.
4, after completing step 3, callus is placed in the Agrobacterium infected liquid containing 100 μM of acetosyringones and impregnates 10min, so
First be placed on the culture dish (including about 200mL infected liquid) for being covered with two layers of sterilizing filter paper afterwards, 21 DEG C dark culture 1 day.
5, the callus for taking step 4 to obtain is placed in the liquid suspension culture base (liquid suspension culture of the MG132 containing 10mg/L
Base, the liquid suspension culture base of the MG132 containing 20mg/L, the MG132 containing 35mg/L liquid suspension culture base, contain 40mg/L
The liquid suspension culture base of MG132, the liquid suspension culture base of the MG132 containing 45mg/L or control liquid suspension medium), 28
DEG C suspend culture 20h；Then it collects callus to be placed on recovery media (the N6 solid medium of the Ticarcillin/Clavulanate Acid containing 200mg/L), 25-
28 DEG C dark culture 2 days.
MG132 mother liquor: it is obtained with DMSO dissolution MG132, concentration 10mg/mL.
Basal liquid suspension medium: the N6 fluid nutrient medium of the Ticarcillin/Clavulanate Acid containing 200mg/L.
The liquid suspension culture base of the MG132 containing 10mg/L is that 1mL MG132 is added into 1L basal liquid suspension medium
Mother liquor obtains.Concentration of the MG132 in the liquid suspension culture base of the MG132 containing 10mg/L is 20 μM.
The liquid suspension culture base of the MG132 containing 20mg/L is that 2mL MG132 is added into 1L basal liquid suspension medium
Mother liquor obtains.Concentration of the MG132 in the liquid suspension culture base of the MG132 containing 20mg/L is 40 μM.
The liquid suspension culture base of the MG132 containing 35mg/L is that 3.5mL is added into 1L basal liquid suspension medium
MG132 mother liquor obtains.Concentration of the MG132 in the liquid suspension culture base of the MG132 containing 20mg/L is 70 μM.
The liquid suspension culture base of the MG132 containing 40mg/L is that 4mL MG132 is added into 1L basal liquid suspension medium
Mother liquor obtains.Concentration of the MG132 in the liquid suspension culture base of the MG132 containing 40mg/L is 80 μM.
The liquid suspension culture base of the MG132 containing 45mg/L is that 4.5mL is added into 1L basal liquid suspension medium
MG132 mother liquor obtains.Concentration of the MG132 in the liquid suspension culture base of the MG132 containing 20mg/L is 90 μM.
Control liquid suspension medium is that 2mL DMSO is added into 1L basal liquid suspension medium to obtain.
6, the callus for taking step 5 to obtain is placed in screening and culturing medium (the N6 solid medium of the hygromycin containing 50mg/L), 28 DEG C
Dark culture 2 weeks.
7, the callus for taking step 6 to obtain is again placed in screening and culturing medium (the N6 solid medium of the hygromycin containing 50mg/L),
28 DEG C dark culture 2 weeks, obtain kanamycin-resistant callus tissue.
8, respectively extract kanamycin-resistant callus tissue genomic DNA and using it as template, using primers F (5 '-
Attatgtagcttgtgcgtttcg-3 ') and primer R (5 '-gatgaagagcttatcgacgt-3 ') composition primer pair carry out
PCR amplification obtains pcr amplification product；The pcr amplification product is subjected to agarose gel electrophoresis, is then made the following judgment: such as
Contain the DNA fragmentation of about 1150bp in fruit pcr amplification product, then corresponding kanamycin-resistant callus tissue is positive kanamycin-resistant callus tissue；If PCR expands
Increase production the DNA fragmentation that about 1150bp is not contained in object, then corresponding kanamycin-resistant callus tissue is not positive kanamycin-resistant callus tissue.
9, the genomic DNA of the 15 pieces of positive kanamycin-resistant callus tissues obtained respectively using step 8 is as template, using primer pair 650,
Primer pair 651 or primer pair 652 carry out PCR amplification, obtain pcr amplification product.
10, the pcr amplification product for obtaining step 9 carries out Sanger sequencing, then analyzes.
C → T base of CS650, CS651 and CS652 replace efficiency after statistics various concentration MG132 processing respectively.C→T
Base replaces positive kanamycin-resistant callus tissue block number/15 × 100% of efficiency=generation C → T base replacement.Part statistical result is shown in Fig. 1
(MG132-0mg is control liquid suspension medium, and MG132-10mg is the liquid suspension culture base of the MG132 containing 10mg/L,
MG132-20mg is the liquid suspension culture base of the MG132 containing 20mg/L, and the liquid that MG132-40mg is the MG132 containing 40mg/L is outstanding
Floating culture medium).The result shows that C → T base of CS650, CS651 and CS652 without MG132 processing (control) replace efficiency
It is followed successively by 40%, 60% and 75%；Various concentration MG132 processing produces difference to C → T base replacement efficiency of different target spots
Influence, but the liquid suspension culture base of the only MG132 containing 35mg/L, the liquid suspension culture base of the MG132 containing 40mg/L and
The liquid suspension culture base of the MG132 containing 45mg/L shows as increase trend to C → T base replacement efficiency of three target spots.
When base replacement occurs, Indel phenomenon can be generated with target spot, so having two types: one is only
Base replacement occurs, Indel does not occur, another kind is that base replacement had not only occurred but also Indel occurs.Accordingly, it is pure to calculate base replacement
Degree.Base replaces purity=only positive kanamycin-resistant callus tissue block number/generation base replacement of the generation base replacement without Indel
Positive kanamycin-resistant callus tissue block number × 100%.The base replacement of CS651 and CS652 is pure after statistics various concentration MG132 processing respectively
Degree.Partial results are shown in that (MG132-0mg is control liquid suspension medium to Fig. 2, and MG132-10mg is the liquid of the MG132 containing 10mg/L
Body suspension medium, MG132-20mg are the liquid suspension culture base of the MG132 containing 20mg/L, and MG132-40mg is containing 40mg/L
The liquid suspension culture base of MG132).The result shows that CS651 and CS652 without MG132 processing had not only occurred base replacement but also had sent out
Raw Indel, it is respectively 75% and 46.7% that base, which replaces purity,；The liquid suspension culture base of the MG132 containing 10mg/L contains 20mg/
The liquid suspension culture base of L MG132, the liquid suspension culture base of the MG132 containing 35mg/L, the liquid of the MG132 containing 40mg/L are outstanding
After the liquid suspension culture base processing for floating culture medium, the MG132 containing 45mg/L, the base of CS651 and CS652 replace the equal table of purity
It is now a degree of increase, that is, the Indel ratio being effectively reduced in base replacement (wherein contains only the liquid of 20mg/L MG132
The base replacement purity of CS651 is constant after suspension medium processing).
C → T of statistics various concentration MG132 treated CS650, CS651 and CS652 is mutated window respectively.It ties part
Fruit is shown in Table 2.The result shows that C → T mutation window of CS650, CS651 and CS652 without MG132 processing are that target spot 5 ' is held
1-5bp；In addition to C → T mutation Window Scale is not implemented in the CS650 that the liquid suspension culture base of the MG132 containing 20mg/L is handled,
C → T mutation window ranges of remaining processing are expanded significantly, and more multipoint C is replaced, and by taking CS652 target spot as an example, are expanded
Open up the 1-14bp at the end of target spot 5 '.
Table 2
Note: MG132-0mg is control liquid suspension medium, and MG132-10mg is the liquid suspension of the MG132 containing 10mg/L
Culture medium, MG132-20mg are the liquid suspension culture base of the MG132 containing 20mg/L, and MG132-40mg is MG132 containing 40mg/L
Liquid suspension culture base, the corresponding position of each base of first row digital representation target spot, the corresponding unit point C of remaining digital representation
The positive kanamycin-resistant callus tissue block number that the replacement of C → T base occurs accounts for total positive kanamycin-resistant callus tissue block number that the replacement of C → T base occurs
Percentage.
<110>Beijing City Agriculture and Forestry Institute
<120>application of the MG132 in base editing system editor's acceptor gene group
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 18476
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 1
ggtggcagga tatattgtgg tgtaaacatg gcactagcct caccgtcttc gcagacgagg 60
ccgctaagtc gcagctacgc tctcaacggc actgactagg tagtttaaac gtgcacttaa 120
ttaaggtacc gaagcaactt aaagttatca ggcatgcatg gatcttggag gaatcagatg 180
tgcagtcagg gaccatagca caagacaggc gtcttctact ggtgctacca gcaaatgctg 240
gaagccggga acactgggta cgttggaaac cacgtgatgt gaagaagtaa gataaactgt 300
aggagaaaag catttcgtag tgggccatga agcctttcag gacatgtatt gcagtatggg 360
ccggcccatt acgcaattgg acgacaacaa agactagtat tagtaccacc tcggctatcc 420
acatagatca aagctgattt aaaagagttg tgcagatgat ccgtggcgga tccaacaaag 480
caccagtggt ctagtggtag aatagtaccc tgccacggta cagacccggg ttcgattccc 540
ggctggtgca cgcgtccatg gagatccacc gttttagagc tagaaatagc aagttaaaat 600
aaggctagtc cgttatcaac ttgaaaaagt ggcaccgagt cggtgcaaca aagcaccagt 660
ggtctagtgg tagaatagta ccctgccacg gtacagaccc gggttcgatt cccggctggt 720
gcagaccagc cagcgtctgg cgcgttttag agctagaaat agcaagttaa aataaggcta 780
gtccgttatc aacttgaaaa agtggcaccg agtcggtgca acaaagcacc agtggtctag 840
tggtagaata gtaccctgcc acggtacaga cccgggttcg attcccggct ggtgcacggc 900
gacggcgagc aagtgggttt tagagctaga aatagcaagt taaaataagg ctagtccgtt 960
atcaacttga aaaagtggca ccgagtcggt gctttttttt ttcgttttgc attgagtttt 1020
ctccgtcgca tgtttgcagt tttattttcc gttttgcatt gaaatttctc cgtctcatgt 1080
ttgcagcgtg ttcaaaaagt acgcagctgt atttcactta tttacggcgc cacattttca 1140
tgccgtttgt gccaactatc ccgagctagt gaatacagct tggcttcaca caacactggt 1200
gacccgctga cctgctcgta cctcgtaccg tcgtacggca cagcatttgg aattaaaggg 1260
tgtgatcgat actgcttgct gctaagctta caaattcggg tcaaggcgga agccagcgcg 1320
ccaccccacg tcagcaaata cggaggcgcg gggttgacgg cgtcacccgg tcctaacggc 1380
gaccaacaaa ccagccagaa gaaattacag taaaaaaaaa gtaaattgca ctttgatcca 1440
ccttttatta cctaagtctc aatttggatc acccttaaac ctatcttttc aatttgggcc 1500
gggttgtggt ttggactacc atgaacaact tttcgtcatg tctaacttcc ctttcagcaa 1560
acatatgaac catatataga ggagatcggc cgtatactag agctgatgtg tttaaggtcg 1620
ttgattgcac gagaaaaaaa aatccaaatc gcaacaatag caaatttatc tggttcaaag 1680
tgaaaagata tgtttaaagg tagtccaaag taaaacttat agataataaa atgtggtcca 1740
aagcgtaatt cactcaaaaa aaatcaacga gacgtgtacc aaacggagac aaacggcatc 1800
ttctcgaaat ttcccaaccg ctcgctcgcc cgcctcgtct tcccggaaac cgcggtggtt 1860
tcagcgtggc ggattctcca agcagacgga gacgtcacgg cacgggactc ctcccaccac 1920
ccaaccgcca taaataccag ccccctcatc tcctctcctc gcatcagctc cacccccgaa 1980
aaatttctcc ccaatctcgc gaggctctcg tcgtcgaatc gaatcctctc gcgtcctcaa 2040
ggtacgctgc ttctcctctc ctcgcttcgt ttcgattcga tttcggacgg gtgaggttgt 2100
tttgttgcta gatccgattg gtggttaggg ttgtcgatgt gattatcgtg agatgtttag 2160
gggttgtaga tctgatggtt gtgatttggg cacggttggt tcgataggtg gaatcgtggt 2220
taggttttgg gattggatgt tggttctgat gattgggggg aatttttacg gttagatgaa 2280
ttgttggatg attcgattgg ggaaatcggt gtagatctgt tggggaattg tggaactagt 2340
catgcctgag tgattggtgc gatttgtagc gtgttccatc ttgtaggcct tgttgcgagc 2400
atgttcagat ctactgttcc gctcttgatt gagttattgg tgccatgggt tggtgcaaac 2460
acaggcttta atatgttata tctgttttgt gtttgatgta gatctgtagg gtagttcttc 2520
ttagacatgg ttcaattatg tagcttgtgc gtttcgattt gatttcatat gttcacagat 2580
tagataatga tgaactcttt taattaattg tcaatggtaa ataggaagtc ttgtcgctat 2640
atctgtcata atgatctcat gttactatct gccagtaatt tatgctaaga actatattag 2700
aatatcatgt tacaatctgt agtaatatca tgttacaatc tgtagttcat ctatataatc 2760
tattgtggta atttcttttt actatctgtg tgaagattat tgccactagt tcattctact 2820
tatttctgaa gttcaggata cgtgtgctgt tactacctat ctgaatacat gtgtgatgtg 2880
cctgttacta tctttttgaa tacatgtatg ttctgttgga atatgtttgc tgtttgatcc 2940
gttgttgtgt ccttaatctt gtgctagttc ttaccctatc tgtttggtga ttatttcttg 3000
cagtacgtaa tggactacaa ggaccacgac ggggattaca aagaccacga catagactac 3060
aaggatgacg atgacaaaat ggcaccgaag aaaaaaagga aggtcggaat ccatggcgtt 3120
ccagctgccg ataagaaata ttccatcgga ctcgccattg gcacgaatag cgtcggatgg 3180
gctgttatta ctgatgagta caaagttccg tctaagaagt tcaaggtgct gggcaacaca 3240
gaccgccaca gcataaagaa aaatctcatc ggtgcactcc ttttcgatag tggggagact 3300
gcagaagcga caagattgaa aaggactgcg agaaggcgct atacacggcg taagaataga 3360
atctgctacc ttcaggagat tttctctaac gaaatggcta aggtcgatga cagtttcttt 3420
catagacttg aggaatcgtt cttggttgag gaggataaga aacatgagag gcacccgata 3480
tttggaaaca tcgtggatga ggtcgcatat catgaaaagt accccacaat ctaccacctg 3540
agaaagaaac tcgttgattc caccgacaaa gcggatttga gactcatcta cctcgctctt 3600
gcccatatga taaagttccg cggacacttt ctgatcgagg gcgacctcaa ccctgataat 3660
agcgacgtcg ataagctctt catccagttg gttcaaacct acaatcagct ctttgaggaa 3720
aacccaatta atgctagtgg agtggatgca aaagcgatac tgtcggccag actctccaag 3780
agcagaaggt tggagaacct gatcgctcaa cttcctggag aaaagaaaaa cggtcttttt 3840
gggaatttga ttgccttgtc tctgggcctc acaccaaact tcaagtcaaa ttttgacctc 3900
gctgaggatg ccaaacttca gttgtctaag gatacctatg atgacgatct tgacaatttg 3960
ctggcacaaa ttggcgacca gtacgcggat ctgttcctcg cagcgaagaa tctgagtgat 4020
gctattctcc tttcggacat actcagggtt aacactgaga tcacaaaagc acctttgagt 4080
gcgtcgatga ttaagcgcta tgatgaacat caccaagacc tcactttgct gaaggccctt 4140
gtgcggcagc aattgccaga gaagtacaaa gaaatcttct ttgaccaatc taagaacgga 4200
tacgctggct atattgatgg aggagcttct caggaggaat tctataagtt tatcaaacct 4260
atacttgaga agatggatgg tacagaggaa ctccttgtta aattgaacag agaagatttg 4320
ctgcgcaagc aacggacctt tgacaacgga tcaattccgc atcagataca cctcggcgag 4380
cttcatgcca tccttcgccg gcaggaagat ttctacccct ttttgaagga caaccgcgag 4440
aagatagaaa aaatccttac gttccggatt ccttactatg tgggtccatt ggcaaggggg 4500
aattcccgct ttgcgtggat gactcggaaa agcgaggaaa ctatcacacc gtggaacttc 4560
gaggaagttg tggacaaggg agcttctgcc caatcattca ttgagaggat gactaacttc 4620
gataagaacc tgccgaacga gaaagttctc cccaagcact ccctccttta cgagtatttc 4680
accgtgtata acgaacttac gaaggttaaa tacgtgactg agggtatgag gaagccagca 4740
ttcttgagcg gggaacaaaa gaaagcgatt gttgatttgc tgtttaaaac taatcgcaag 4800
gtgacagtca agcagctcaa agaggattat ttcaagaaaa ttgaatgttt cgactctgtg 4860
gagatatcag gagtcgaaga taggtttaac gcttcccttg gcacatacca tgacctcctt 4920
aagatcatta aggacaaaga tttcctggat aacgaggaaa atgaggacat cctcgaagat 4980
attgttctta ccttgacgct gtttgaggat cgcgaaatga tcgaggaacg gcttaagacg 5040
tatgctcact tgttcgacga taaggttatg aagcagctca agcgtagaag gtacactgga 5100
tggggccgtc tgtctagaaa gctcatcaac ggaatacgtg ataaacaaag tggcaagaca 5160
attttggatt ttctgaagtc ggacggattc gccaacagaa attttatgca gctgattcat 5220
gacgatagtc tcaccttcaa agaggacata cagaaggctc aagtgagtgg tcaaggggat 5280
tcgctgcatg aacacatcgc aaacctcgcg ggttcaccgg ccataaagaa aggaatcctt 5340
caaactgtta aggtcgttga tgagttggtt aaagtgatgg gtaggcacaa gcccgaaaac 5400
atagtgatcg agatggctcg cgaaaatcag actacacaaa aagggcagaa gaactctcgc 5460
gagcggatga aaaggattga ggaaggaatc aaggaactgg gctcacagat tctcaaagag 5520
catccagtcg aaaacacaca gctgcaaaat gagaagctct atctttacta tctccaaaat 5580
ggccgggaca tgtatgttga tcaggagctt gacatcaacc gtttgtccga ctatgatgtg 5640
gaccacattg tcccgcaatc tttccttaag gacgattcaa tcgataataa ggtgttgacc 5700
cggagcgata aaaaccgtgg aaagtctgac aatgtccctt cagaggaagt ggttaagaag 5760
atgaagaact actggagaca attgctgaat gcaaaactga tcacacagag aaagttcgac 5820
aacctcacca aagcagagag aggtgggctc agtgaacttg ataaagcggg cttcattaag 5880
cgtcagctcg ttgagactag acagatcacg aagcatgtcg cgcagatttt ggattcgcgg 5940
atgaacacga agtacgacga gaatgataaa ctgatacgtg aagtcaaggt tatcactctt 6000
aagtccaaat tggtgagcga tttcagaaag gacttccaat tctataaggt cagggagatc 6060
aacaattatc atcacgctca cgatgcctac cttaatgctg ttgtggggac cgcccttatt 6120
aagaaatacc ctaaattgga gtctgaattc gtttacgggg attataaggt ctacgacgtt 6180
aggaaaatga tagctaagag tgagcaggag atcggtaaag caactgcgaa gtatttcttt 6240
tactcgaaca tcatgaattt ctttaagacc gagataacgc tggcaaatgg cgaaattaga 6300
aagaggcctc tcatagagac taacggtgag acaggggaaa tcgtctggga taagggtagg 6360
gactttgcga cagtgcgcaa ggtcctctct atgccgcaag ttaatattgt gaagaaaacc 6420
gaggtgcaga cgggaggctt ctccaaggaa agcatacttc ccaaacggaa ctctgataag 6480
ttgatcgctc gtaagaaaga ttgggaccct aagaaatatg gtgggttcga ttccccaact 6540
gttgcttaca gcgtgctggt cgttgccaag gtcgagaagg gtaaatccaa gaaactcaaa 6600
agcgttaagg aactccttgg gattactatc atggagagat cttcattcga aaagaatcct 6660
atcgactttc ttgaggccaa aggatataag gaagttaaga aagatctgat aatcaaactc 6720
ccaaagtact cattgtttga gctggaaaac ggcaggaagc gcatgcttgc ttccgccgga 6780
gagttgcaga aagggaacga gttggctctg ccttctaagt atgttaactt cctctatctt 6840
gcctctcatt acgagaagct caaaggctca ccagaggaca acgaacagaa acaacttttt 6900
gtcgagcaac ataagcacta tttggatgag attatagaac agatcagtga attctcgaaa 6960
agggttatcc ttgcagatgc gaatcttgac aaggtgttgt ctgcatacaa caaacataga 7020
gataagccga tcagggagca agcggaaaat atcattcacc tcttcactct tacaaacttg 7080
ggtgctcccg ctgccttcaa gtattttgat accacgattg accggaaacg ttacacctca 7140
acgaaggagg tgctggatgc caccctcatc caccaatcta ttaccggact ctacgagact 7200
agaatcgatc tctcacagct cggcggggat aaaagaccag cagcgacgaa aaaggcagga 7260
caggctaaga agaagaaaga gctcggagga ggaggcacgg gaggaggagg ctccgccgag 7320
tatgtgcgcg cgctcttcga cttcaacggc aatgacgagg aggatctccc tttcaagaag 7380
ggcgacatcc tccgcatccg cgataagccg gaggagcagt ggtggaacgc agaggactcc 7440
gagggcaagc ggggcatgat cctggtgcca tacgtcgaga agtacagcgg cgattacaag 7500
gaccacgatg gcgactacaa ggatcatgac atcgattaca aggacgatga cgataagtcc 7560
ggcgtcgaca tgacggacgc ggagtatgtg cgcatccacg agaagctcga tatctacacc 7620
ttcaagaagc agttcttcaa caataagaag tcggtgtccc atcggtgcta cgtcctcttc 7680
gagctgaagc gcaggggaga gcgccgcgcc tgcttctggg gctacgcggt gaataagccg 7740
cagtcaggca cagagcgcgg catccacgcc gagatcttct cgatccggaa ggtcgaggag 7800
tacctccgcg acaacccagg ccagttcacg atcaattggt actccagctg gtccccttgc 7860
gcagattgcg cagagaagat cctcgagtgg tacaaccagg agctgagggg caatggccat 7920
accctcaaga tctgggcctg caagctgtac tacgagaaga acgcgaggaa tcagatcggc 7980
ctctggaacc tgcgggataa tggcgtgggc ctcaacgtga tggtgtccga gcactaccag 8040
tgctgccgca agatcttcat ccagtcctcc cacaatcagc tgaacgagaa taggtggctc 8100
gaaaagaccc tgaagcgcgc cgagaagtgg aggagcgagc tgtctatcat gatccaggtc 8160
aagatcctgc acaccacaaa gtcaccggcg gtgggcggcg gcggcagcga attctccggc 8220
ggcagcacga acctcagcga catcatcgag aaggagacag gcaagcagct cgtgatccag 8280
gagtctatcc tcatgctgcc tgaggaggtg gaggaggtca tcggcaacaa gccggagtcc 8340
gatatcctcg tgcacaccgc ctacgacgag tcgacagatg agaatgtcat gctcctgacc 8400
tccgacgcac cagagtacaa gccatgggcg ctcgtgatcc aggattccaa cggcgagaat 8460
aagatcaaga tgctgtctgg cggctccccg aagaagaagc gcaaggtcta gactagtctg 8520
aaatcaccag tctctctcta caaatctatc tctctctata ataatgtgtg agtagttccc 8580
agataaggga attagggttc ttatagggtt tcgctcatgt gttgagcata taagaaaccc 8640
ttagtatgta tttgtatttg taaaatactt ctatcaataa aatttctaat tcctaaaacc 8700
aaaatccagt ggggcgcccg acctgtactc gcgaaggtta acttacagag agtgtccggg 8760
cgcgcctggt ggatcgtccg cctaggctgc agtgcagcgt gacccggtcg tgcccctctc 8820
tagagataat gagcattgca tgtctaagtt ataaaaaatt accacatatt ttttttgtca 8880
cacttgtttg aagtgcagtt tatctatctt tatacatata tttaaacttt actctacgaa 8940
taatataatc tatagtacta caataatatc agtgttttag agaatcatat aaatgaacag 9000
ttagacatgg tctaaaggac aattgagtat tttgacaaca ggactctaca gttttatctt 9060
tttagtgtgc atgtgttctc cttttttttt gcaaatagct tcacctatat aatacttcat 9120
ccattttatt agtacatcca tttagggttt agggttaatg gtttttatag actaattttt 9180
ttagtacatc tattttattc tattttagcc tctaaattaa gaaaactaaa actctatttt 9240
agttttttta tttaataatt tagatataaa atagaataaa ataaagtgac taaaaattaa 9300
acaaataccc tttaagaaat taaaaaaact aaggaaacat ttttcttgtt tcgagtagat 9360
aatgccagcc tgttaaacgc cgtcgacgag tctaacggac accaaccagc gaaccagcag 9420
cgtcgcgtcg ggccaagcga agcagacggc acggcatctc tgtcgctgcc tctggacccc 9480
tctcgagagt tccgctccac cgttggactt gctccgctgt cggcatccag aaattgcgtg 9540
gcggagcggc agacgtgagc cggcacggca ggcggcctcc tcctcctctc acggcaccgg 9600
cagctacggg ggattccttt cccaccgctc cttcgctttc ccttcctcgc ccgccgtaat 9660
aaatagacac cccctccaca ccctctttcc ccaacctcgt gttgttcgga gcgcacacac 9720
acacaaccag atctccccca aatccacccg tcggcacctc cgcttcaagg tacgccgctc 9780
gtcctccccc cccccccctc tctaccttct ctagatcggc gttccggtcc atggttaggg 9840
cccggtagtt ctacttctgt tcatgtttgt gttagatccg tgtttgtgtt agatccgtgc 9900
tgctagcgtt cgtacacgga tgcgacctgt acgtcagaca cgttctgatt gctaacttgc 9960
cagtgtttct ctttggggaa tcctgggatg gctctagccg ttccgcagac gggatcgatt 10020
tcatgatttt ttttgtttcg ttgcataggg tttggtttgc ccttttcctt tatttcaata 10080
tatgccgtgc acttgtttgt cgggtcatct tttcatgctt ttttttgtct tggttgtgat 10140
gatgtggtct ggttgggcgg tcgttctaga tcggagtaga attctgtttc aaactacctg 10200
gtggatttat taattttgga tctgtatgtg tgtgccatac atattcatag ttacgaattg 10260
aagatgatgg atggaaatat cgatctagga taggtataca tgttgatgcg ggttttactg 10320
atgcatatac agagatgctt tttgttcgct tggttgtgat gatgtggtgt ggttgggcgg 10380
tcgttcattc gttctagatc ggagtagaat actgtttcaa actacctggt gtatttatta 10440
attttggaac tgtatgtgtg tgtcatacat cttcatagtt acgagtttaa gatggatgga 10500
aatatcgatc taggataggt atacatgttg atgtgggttt tactgatgca tatacatgat 10560
ggcatatgca gcatctattc atatgctcta accttgagta cctatctatt ataataaaca 10620
agtatgtttt ataattattt tgatcttgat atacttggat gatggcatat gcagcagcta 10680
tatgtggatt tttttagccc tgccttcata cgctatttat ttgcttggta ctgtttcttt 10740
tgtcgatgct caccctgttg tttggtgtta cttctgcagg agctcatgaa aaagcctgaa 10800
ctcaccgcga cgtctgtcga gaagtttctg atcgaaaagt tcgacagcgt ctccgacctg 10860
atgcagctct cggagggcga agaatctcgt gctttcagct tcgatgtagg agggcgtgga 10920
tatgtcctgc gggtaaatag ctgcgccgat ggtttctaca aagatcgtta tgtttatcgg 10980
cactttgcat cggccgcgct cccgattccg gaagtgcttg acattgggga gtttagcgag 11040
agcctgacct attgcatctc ccgccgttca cagggtgtca cgttgcaaga cctgcctgaa 11100
accgaactgc ccgctgttct acaaccggtc gcggaggcta tggatgcgat cgctgcggcc 11160
gatcttagcc agacgagcgg gttcggccca ttcggaccgc aaggaatcgg tcaatacact 11220
acatggcgtg atttcatatg cgcgattgct gatccccatg tgtatcactg gcaaactgtg 11280
atggacgaca ccgtcagtgc gtccgtcgcg caggctctcg atgagctgat gctttgggcc 11340
gaggactgcc ccgaagtccg gcacctcgtg cacgcggatt tcggctccaa caatgtcctg 11400
acggacaatg gccgcataac agcggtcatt gactggagcg aggcgatgtt cggggattcc 11460
caatacgagg tcgccaacat cttcttctgg aggccgtggt tggcttgtat ggagcagcag 11520
acgcgctact tcgagcggag gcatccggag cttgcaggat cgccacgact ccgggcgtat 11580
atgctccgca ttggtcttga ccaactctat cagagcttgg ttgacggcaa tttcgatgat 11640
gcagcttggg cgcagggtcg atgcgacgca atcgtccgat ccggagccgg gactgtcggg 11700
cgtacacaaa tcgcccgcag aagcgcggcc gtctggaccg atggctgtgt agaagtactc 11760
gccgatagtg gaaaccgacg ccccagcact cgtccgaggg caaagaaata ggatcgttca 11820
aacatttggc aataaagttt cttaagattg aatcctgttg ccggtcttgc gatgattatc 11880
atataatttc tgttgaatta cgttaagcat gtaataatta acatgtaatg catgacgtta 11940
tttatgagat gggtttttat gattagagtc ccgcaattat acatttaata cgcgatagaa 12000
aacaaaatat agcgcgcaaa ctaggataaa ttatcgcgcg cggtgtcatc tatgttacta 12060
gatctgtagc cctgcaggac gcgtttaatt aagtgcacgc ggccgcctac ttagtcaaga 12120
gcctcgcacg cgactgtcac gcggccagga tcgcctcgtg agcctcgcaa tctgtaccta 12180
gtgtttaaac tatcagtgtt tgacaggata tattggcggg taaacctaag agaaaagagc 12240
gtttattaga ataacggata tttaaaaggg cgtgaaaagg tttatccgtt cgtccatttg 12300
tatgtgcatg ccaaccacag ggttcccctc gggatcaaag tactttgatc caacccctcc 12360
gctgctatag tgcagtcggc ttctgacgtt cagtgcagcc gtcttctgaa aacgacatgt 12420
cgcacaagtc ctaagttacg cgacaggctg ccgccctgcc cttttcctgg cgttttcttg 12480
tcgcgtgttt tagtcgcata aagtagaata cttgcgacta gaaccggaga cattacgcca 12540
tgaacaagag cgccgccgct ggcctgctgg gctatgcccg cgtcagcacc gacgaccagg 12600
acttgaccaa ccaacgggcc gaactgcacg cggccggctg caccaagctg ttttccgaga 12660
agatcaccgg caccaggcgc gaccgcccgg agctggccag gatgcttgac cacctacgcc 12720
ctggcgacgt tgtgacagtg accaggctag accgcctggc ccgcagcacc cgcgacctac 12780
tggacattgc cgagcgcatc caggaggccg gcgcgggcct gcgtagcctg gcagagccgt 12840
gggccgacac caccacgccg gccggccgca tggtgttgac cgtgttcgcc ggcattgccg 12900
agttcgagcg ttccctaatc atcgaccgca cccggagcgg gcgcgaggcc gccaaggccc 12960
gaggcgtgaa gtttggcccc cgccctaccc tcaccccggc acagatcgcg cacgcccgcg 13020
agctgatcga ccaggaaggc cgcaccgtga aagaggcggc tgcactgctt ggcgtgcatc 13080
gctcgaccct gtaccgcgca cttgagcgca gcgaggaagt gacgcccacc gaggccaggc 13140
ggcgcggtgc cttccgtgag gacgcattga ccgaggccga cgccctggcg gccgccgaga 13200
atgaacgcca agaggaacaa gcatgaaacc gcaccaggac ggccaggacg aaccgttttt 13260
cattaccgaa gagatcgagg cggagatgat cgcggccggg tacgtgttcg agccgcccgc 13320
gcacgtctca accgtgcggc tgcatgaaat cctggccggt ttgtctgatg ccaagctggc 13380
ggcctggccg gccagcttgg ccgctgaaga aaccgagcgc cgccgtctaa aaaggtgatg 13440
tgtatttgag taaaacagct tgcgtcatgc ggtcgctgcg tatatgatgc gatgagtaaa 13500
taaacaaata cgcaagggga acgcatgaag gttatcgctg tacttaacca gaaaggcggg 13560
tcaggcaaga cgaccatcgc aacccatcta gcccgcgccc tgcaactcgc cggggccgat 13620
gttctgttag tcgattccga tccccagggc agtgcccgcg attgggcggc cgtgcgggaa 13680
gatcaaccgc taaccgttgt cggcatcgac cgcccgacga ttgaccgcga cgtgaaggcc 13740
atcggccggc gcgacttcgt agtgatcgac ggagcgcccc aggcggcgga cttggctgtg 13800
tccgcgatca aggcagccga cttcgtgctg attccggtgc agccaagccc ttacgacata 13860
tgggccaccg ccgacctggt ggagctggtt aagcagcgca ttgaggtcac ggatggaagg 13920
ctacaagcgg cctttgtcgt gtcgcgggcg atcaaaggca cgcgcatcgg cggtgaggtt 13980
gccgaggcgc tggccgggta cgagctgccc attcttgagt cccgtatcac gcagcgcgtg 14040
agctacccag gcactgccgc cgccggcaca accgttcttg aatcagaacc cgagggcgac 14100
gctgcccgcg aggtccaggc gctggccgct gaaattaaat caaaactcat ttgagttaat 14160
gaggtaaaga gaaaatgagc aaaagcacaa acacgctaag tgccggccgt ccgagcgcac 14220
gcagcagcaa ggctgcaacg ttggccagcc tggcagacac gccagccatg aagcgggtca 14280
actttcagtt gccggcggag gatcacacca agctgaagat gtacgcggta cgccaaggca 14340
agaccattac cgagctgcta tctgaataca tcgcgcagct accagagtaa atgagcaaat 14400
gaataaatga gtagatgaat tttagcggct aaaggaggcg gcatggaaaa tcaagaacaa 14460
ccaggcaccg acgccgtgga atgccccatg tgtggaggaa cgggcggttg gccaggcgta 14520
agcggctggg ttgtctgccg gccctgcaat ggcactggaa cccccaagcc cgaggaatcg 14580
gcgtgacggt cgcaaaccat ccggcccggt acaaatcggc gcggcgctgg gtgatgacct 14640
ggtggagaag ttgaaggccg cgcaggccgc ccagcggcaa cgcatcgagg cagaagcacg 14700
ccccggtgaa tcgtggcaag cggccgctga tcgaatccgc aaagaatccc ggcaaccgcc 14760
ggcagccggt gcgccgtcga ttaggaagcc gcccaagggc gacgagcaac cagatttttt 14820
cgttccgatg ctctatgacg tgggcacccg cgatagtcgc agcatcatgg acgtggccgt 14880
tttccgtctg tcgaagcgtg accgacgagc tggcgaggtg atccgctacg agcttccaga 14940
cgggcacgta gaggtttccg cagggccggc cggcatggcc agtgtgtggg attacgacct 15000
ggtactgatg gcggtttccc atctaaccga atccatgaac cgataccggg aagggaaggg 15060
agacaagccc ggccgcgtgt tccgtccaca cgttgcggac gtactcaagt tctgccggcg 15120
agccgatggc ggaaagcaga aagacgacct ggtagaaacc tgcattcggt taaacaccac 15180
gcacgttgcc atgcagcgta cgaagaaggc caagaacggc cgcctggtga cggtatccga 15240
gggtgaagcc ttgattagcc gctacaagat cgtaaagagc gaaaccgggc ggccggagta 15300
catcgagatc gagctagctg attggatgta ccgcgagatc acagaaggca agaacccgga 15360
cgtgctgacg gttcaccccg attacttttt gatcgatccc ggcatcggcc gttttctcta 15420
ccgcctggca cgccgcgccg caggcaaggc agaagccaga tggttgttca agacgatcta 15480
cgaacgcagt ggcagcgccg gagagttcaa gaagttctgt ttcaccgtgc gcaagctgat 15540
cgggtcaaat gacctgccgg agtacgattt gaaggaggag gcggggcagg ctggcccgat 15600
cctagtcatg cgctaccgca acctgatcga gggcgaagca tccgccggtt cctaatgtac 15660
ggagcagatg ctagggcaaa ttgccctagc aggggaaaaa ggtcgaaaag gtctctttcc 15720
tgtggatagc acgtacattg ggaacccaaa gccgtacatt gggaaccgga acccgtacat 15780
tgggaaccca aagccgtaca ttgggaaccg gtcacacatg taagtgactg atataaaaga 15840
gaaaaaaggc gatttttccg cctaaaactc tttaaaactt attaaaactc ttaaaacccg 15900
cctggcctgt gcataactgt ctggccagcg cacagccgaa gagctgcaaa aagcgcctac 15960
ccttcggtcg ctgcgctccc tacgccccgc cgcttcgcgt cggcctatcg cggccgctgg 16020
ccgctcaaaa atggctggcc tacggccagg caatctacca gggcgcggac aagccgcgcc 16080
gtcgccactc gaccgccggc gcccacatca aggcaccctg cctcgcgcgt ttcggtgatg 16140
acggtgaaaa cctctgacac atgcagctcc cggagacggt cacagcttgt ctgtaagcgg 16200
atgccgggag cagacaagcc cgtcagggcg cgtcagcggg tgttggcggg tgtcggggcg 16260
cagccatgac ccagtcacgt agcgatagcg gagtgtatac tggcttaact atgcggcatc 16320
agagcagatt gtactgagag tgcaccatat gcggtgtgaa ataccgcaca gatgcgtaag 16380
gagaaaatac cgcatcaggc gctcttccgc ttcctcgctc actgactcgc tgcgctcggt 16440
cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga 16500
atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg 16560
taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg agcatcacaa 16620
aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt 16680
tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta ccggatacct 16740
gtccgccttt ctcccttcgg gaagcgtggc gctttctcat agctcacgct gtaggtatct 16800
cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc 16860
cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa gacacgactt 16920
atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc 16980
tacagagttc ttgaagtggt ggcctaacta cggctacact agaaggacag tatttggtat 17040
ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa 17100
acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa 17160
aaaaggatct caagaagatc ctttgatctt ttctacgggg tctgacgctc agtggaacga 17220
aaactcacgt taagggattt tggtcatgca ttctaggtac taaaacaatt catccagtaa 17280
aatataatat tttattttct cccaatcagg cttgatcccc agtaagtcaa aaaatagctc 17340
gacatactgt tcttccccga tatcctccct gatcgaccgg acgcagaagg caatgtcata 17400
ccacttgtcc gccctgccgc ttctcccaag atcaataaag ccacttactt tgccatcttt 17460
cacaaagatg ttgctgtctc ccaggtcgcc gtgggaaaag acaagttcct cttcgggctt 17520
ttccgtcttt aaaaaatcat acagctcgcg cggatcttta aatggagtgt cttcttccca 17580
gttttcgcaa tccacatcgg ccagatcgtt attcagtaag taatccaatt cggctaagcg 17640
gctgtctaag ctattcgtat agggacaatc cgatatgtcg atggagtgaa agagcctgat 17700
gcactccgca tacagctcga taatcttttc agggctttgt tcatcttcat actcttccga 17760
gcaaaggacg ccatcggcct cactcatgag cagattgctc cagccatcat gccgttcaaa 17820
gtgcaggacc tttggaacag gcagctttcc ttccagccat agcatcatgt ccttttcccg 17880
ttccacatca taggtggtcc ctttataccg gctgtccgtc atttttaaat ataggttttc 17940
attttctccc accagcttat ataccttagc aggagacatt ccttccgtat cttttacgca 18000
gcggtatttt tcgatcagtt ttttcaattc cggtgatatt ctcattttag ccatttatta 18060
tttccttcct cttttctaca gtatttaaag ataccccaag aagctaatta taacaagacg 18120
aactccaatt cactgttcct tgcattctaa aaccttaaat accagaaaac agctttttca 18180
aagttgtttt caaagttggc gtataacata gtatcgacgg agccgatttt gaaaccgcgg 18240
tgatcacagg cagcaacgct ctgtcatcgt tacaatcaac atgctaccct ccgcgagatc 18300
atccgtgttt caaacccggc agcttagttg ccgttcttcc gaatagcatc ggtaacatga 18360
gcaaagtctg ccgccttaca acggctctcc cgctgacgcc gtcccggact gatgggctgc 18420
ctgtatcgag tggtgatttt gtgccgagct gccggtcggg gagctgttgg ctggct 18476
Claims (10)
1. the method for improving base editing system editorial efficiency is method A1 or method A2:
The method A1 includes the following steps: to make expression of receptor sgRNA, Cas9 albumen and cytosine deaminase, thus to described
Target gene in acceptor gene group carries out base editor；
The method A2 includes the following steps: to make expression of receptor sgRNA, Cas9 albumen, cytosine deaminase and ura DNA sugar
Change enzyme inhibitor, to carry out base editor to the target gene in the acceptor gene group.
It is method B1 or method B2 2. increasing the method for base editing system base replacement purity:
The method B1 includes the following steps: to make expression of receptor sgRNA, Cas9 albumen and cytosine deaminase, thus to described
Target gene in acceptor gene group carries out base editor；
The method B2 includes the following steps: to make expression of receptor sgRNA, Cas9 albumen, cytosine deaminase and ura DNA sugar
Change enzyme inhibitor, to carry out base editor to the target gene in the acceptor gene group.
It is method C1 or method C2 3. expanding the method for base editing system mutation window ranges:
The method C1 includes the following steps: to make expression of receptor sgRNA, Cas9 albumen and cytosine deaminase, thus to described
Target gene in acceptor gene group carries out base editor；
The method C2 includes the following steps: to make expression of receptor sgRNA, Cas9 albumen, cytosine deaminase and ura DNA sugar
Change enzyme inhibitor, to carry out base editor to the target gene in the acceptor gene group.
4. the method as described in claims 1 to 3 is any, it is characterised in that:
In the method A1, the method B1 and the method C1, " make expression of receptor sgRNA, Cas9 albumen and cytimidine deamination
Enzyme " is by by the encoding gene and the cytosine deaminase encoding gene of the encoding gene of the sgRNA, the Cas9 albumen
Receptor is imported to realize；
In the method A2, the method B2 and the method C2, " make expression of receptor sgRNA, Cas9 albumen, cytimidine deamination
Enzyme and ura DNA are saccharified enzyme inhibitor " by by the encoding gene of the sgRNA, the encoding gene of the Cas9 albumen, institute
The encoding gene for stating cytosine deaminase encoding gene and ura DNA saccharification enzyme inhibitor imports receptor realization.
5. the method as described in Claims 1-4 is any, it is characterised in that: the receptor is plant callus.
6. method as claimed in claim 1 to 5, it is characterised in that: during the importing receptor, at MG132
Manage receptor.
7. method as claimed in claim 6, it is characterised in that: the mode of MG132 processing receptor are as follows: it will co-culture 22 ±
The receptor of 2h is placed in the liquid phase containing MG132, and 20 ± 2h is cultivated in 28 ± 2 DEG C of suspensions.
8. the method as described in claim 1,4,5,6 or 7, it is characterised in that: the concentration of the MG132 is 35-45mg/L.
9. the method as described in claim 2,3,4,5,6 or 7, it is characterised in that: the concentration of the MG132 is 10-45mg/L.
10.X1) or X2) X3) or X4):
X1) MG132 is improving the application in base editing system editorial efficiency；
X2) MG132 is increasing the application in base editing system base replacement purity；
X3) MG132 is expanding the application in base editing system mutation window ranges；
X4) application of the MG132 in base editing system editor's acceptor gene group.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811634020.9A CN109666693B (en) | 2018-12-29 | 2018-12-29 | Application of MG132 in editing receptor genome by base editing system |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811634020.9A CN109666693B (en) | 2018-12-29 | 2018-12-29 | Application of MG132 in editing receptor genome by base editing system |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109666693A true CN109666693A (en) | 2019-04-23 |
| CN109666693B CN109666693B (en) | 2022-08-16 |
Family
ID=66146639
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811634020.9A Active CN109666693B (en) | 2018-12-29 | 2018-12-29 | Application of MG132 in editing receptor genome by base editing system |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109666693B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110628794A (en) * | 2019-09-30 | 2019-12-31 | 北京市农林科学院 | Cell enrichment technology of C.T base substitution by taking inactivated screening agent resistance gene as report system and application thereof |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20150074847A1 (en) * | 2012-04-13 | 2015-03-12 | The Rockefeller University | Enhancing protein stability in transgenic plants |
| CN106916852A (en) * | 2017-04-13 | 2017-07-04 | 上海科技大学 | A kind of base editing system and its structure and methods for using them |
| CN107043779A (en) * | 2016-12-01 | 2017-08-15 | 中国农业科学院作物科学研究所 | A kind of fixed point base of CRISPR/nCas9 mediations replaces the application in plant |
| JP2018000129A (en) * | 2016-07-05 | 2018-01-11 | 国立研究開発法人理化学研究所 | Plant mutation rate improver and mutation rate improvement method |
| CN108795972A (en) * | 2017-05-05 | 2018-11-13 | 中国科学院遗传与发育生物学研究所 | Without using the cellifugal method of transgenosis flag sequence point |
| CN111315885A (en) * | 2017-09-11 | 2020-06-19 | 因赛德奥特生物公司 | Methods and compositions for enhancing tumor immunogenicity |
| CN114317590A (en) * | 2020-09-30 | 2022-04-12 | 北京市农林科学院 | Method for mutating base C in plant genome into base T |
| CN114630910A (en) * | 2019-06-25 | 2022-06-14 | 伊纳瑞农业技术有限公司 | Improved homology-dependent repair genome editing |
-
2018
- 2018-12-29 CN CN201811634020.9A patent/CN109666693B/en active Active
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20150074847A1 (en) * | 2012-04-13 | 2015-03-12 | The Rockefeller University | Enhancing protein stability in transgenic plants |
| JP2018000129A (en) * | 2016-07-05 | 2018-01-11 | 国立研究開発法人理化学研究所 | Plant mutation rate improver and mutation rate improvement method |
| CN107043779A (en) * | 2016-12-01 | 2017-08-15 | 中国农业科学院作物科学研究所 | A kind of fixed point base of CRISPR/nCas9 mediations replaces the application in plant |
| CN106916852A (en) * | 2017-04-13 | 2017-07-04 | 上海科技大学 | A kind of base editing system and its structure and methods for using them |
| CN108795972A (en) * | 2017-05-05 | 2018-11-13 | 中国科学院遗传与发育生物学研究所 | Without using the cellifugal method of transgenosis flag sequence point |
| CN111315885A (en) * | 2017-09-11 | 2020-06-19 | 因赛德奥特生物公司 | Methods and compositions for enhancing tumor immunogenicity |
| CN114630910A (en) * | 2019-06-25 | 2022-06-14 | 伊纳瑞农业技术有限公司 | Improved homology-dependent repair genome editing |
| CN114317590A (en) * | 2020-09-30 | 2022-04-12 | 北京市农林科学院 | Method for mutating base C in plant genome into base T |
Non-Patent Citations (5)
| Title |
|---|
| LI Q等，: ""CRISPR–Cas9-mediated base-editing screening in mice identifies DND1 amino acids that are critical for primordial germ cell development"", 《NATURE CELL BIOLOGY》 * |
| R SURESH等，: ""Stability of Zinc Finger Nuclease Protein Is Enhanced by the Proteasome Inhibitor MG132"", 《PLOS ONE》 * |
| 任斌等，: ""植物基因组单碱基替换技术在水稻上的开发及应用"", 《2018全国植物生物学大会论文集》 * |
| 任斌等，: ""水稻靶标基因单碱基定向替换技术的建立"", 《中国科学》 * |
| 单奇伟等: ""植物基因组编辑及衍生技术最新研究进展"", 《遗传》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110628794A (en) * | 2019-09-30 | 2019-12-31 | 北京市农林科学院 | Cell enrichment technology of C.T base substitution by taking inactivated screening agent resistance gene as report system and application thereof |
| CN110628794B (en) * | 2019-09-30 | 2021-07-16 | 北京市农林科学院 | Cell enrichment technology of C.T base substitution by taking inactivated screening agent resistance gene as report system and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109666693B (en) | 2022-08-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106939316B (en) | Method for site-directed knockout of rice OsPDCD5 gene second exon by CRISPR/Cas9 system | |
| CN109722439B (en) | Application of MLO2, MLO6 and MLO12 genes of tobacco in preparation of powdery mildew resistant tobacco variety and method thereof | |
| US20030175783A1 (en) | Methods and means for monitoring and modulating gene silencing | |
| CN110577965B (en) | Application of xCas9n-epBE base editing system in gene editing | |
| CN110724685A (en) | Transgenic salt-tolerant herbicide-tolerant corn SR801 exogenous insertion flanking sequence and application thereof | |
| CN109355306B (en) | Upland cotton transformation event ICR24-397 and specificity identification method thereof | |
| CN112725256B (en) | Recombinant escherichia coli and method for biosynthesizing diosmetin by using recombinant escherichia coli | |
| CN109679989A (en) | A method of improving base editing system editorial efficiency | |
| CN110878322A (en) | Double-plasmid system for Klebsiella pneumoniae gene editing | |
| CN109266686A (en) | A kind of method of genome nucleotide fixed point replacement | |
| CN109666693B (en) | Application of MG132 in editing receptor genome by base editing system | |
| CN109666694B (en) | Application of SCR7 in editing receptor genome by base editing system | |
| CN111607545B (en) | Recombinant bacterium for high-yield farnesene as well as construction method and application thereof | |
| CN109265562B (en) | Nicking enzyme and application thereof in genome base replacement | |
| CN108728389B (en) | Escherichia coli engineering bacterium for producing 2,3,5, 6-tetramethylpyrazine and application thereof | |
| CN111560373B (en) | Plant constitutive promoter OsUbipro and application thereof | |
| CN112680474A (en) | Fluorescent-labeled CRISPR/SpCas9 system-mediated gene replacement system and application thereof in plants | |
| CN112941098B (en) | Arabidopsis thaliana anther tapetum promoter expression vector and construction method and application thereof | |
| CN114369560A (en) | Method for improving biological indigo yield | |
| CN110229823B (en) | Upland cotton transformation event 19C006-59-11 and specificity identification method thereof | |
| CN110106198B (en) | Upland cotton transformation event C006-10-13 and specificity identification method thereof | |
| CN113881670A (en) | Method for constructing transgenic plant resisting soybean mosaic virus | |
| CN114686454B (en) | PE-P3 guided editing system and application thereof in genome base editing | |
| CN111593057A (en) | Gene for increasing diameter of carnation flower and application | |
| CN114763556B (en) | Guide base editing system with improved gene editing efficiency and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |