CN109679989A - A method of improving base editing system editorial efficiency - Google Patents
A method of improving base editing system editorial efficiency Download PDFInfo
- Publication number
- CN109679989A CN109679989A CN201811634032.1A CN201811634032A CN109679989A CN 109679989 A CN109679989 A CN 109679989A CN 201811634032 A CN201811634032 A CN 201811634032A CN 109679989 A CN109679989 A CN 109679989A
- Authority
- CN
- China
- Prior art keywords
- hygromycin
- base
- receptor
- editing system
- albumen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Cell Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a kind of methods for improving base editing system editorial efficiency.This method comprises the following steps: making expression of receptor sgRNA, hygromycin albumen, Cas9 albumen, cytosine deaminase and ura DNA saccharification enzyme inhibitor, to carry out base editor to the target gene in the acceptor gene group;Receptor is plant callus;During importing plant callus, hygromycin is used to screen resistant calli as selective agent;The concentration of hygromycin is 35-80mg/L.Experiments have shown that, improve the concentration of selective agent hygromycin, SpCas9n can be improved, and (C → T base of D10A) &PmCDA1&UGI base editing system and rAPOBEC1&SpCas9n&UGI base editing system replaces efficiency, and then obtains and efficiently obtain mutant.The present invention has important application value.
Description
Technical field
The invention belongs to field of biotechnology, and in particular to a method of improve base editing system editorial efficiency.
Background technique
CRISPR-Cas9 technology has become strong genome edit, be widely applied to many tissues and
In cell.CRISPR/Cas9protein-RNA compound is positioned on target spot by guide RNA (guide RNA), and cutting produces
The starting DNA repair mechanism of raw DNA double chain fracture (dsDNA break, DSB), then organism meeting instinct repairs DSB.It repairs
There are two types of mechanism is general, one is non-homologous end joining (non-homologous end joining, NHEJ), and another kind is
Homologous recombination (homology-directed repair, HDR).NHEJ is in the great majority under normal conditions, therefore repairs generation
Random indels (insertions or deletions) is more much higher than accurately repairing.Base is accurately replaced, because
HDR low efficiency and DNA profiling is needed, so being very restricted using the application that HDR realizes that base is accurately replaced.
2016, two laboratories David Liu and Akihiko Kondo independently report two it is different types of
Cytosine base editing machine (cytosine base editor, CBE), principle is directly realized by by using cytidine deaminase
Single cytimidine (Cytosine, C) base is edited, and is no longer repaired by generating DSB and starting HDR, is greatly improved
C replaces with the base editorial efficiency (i.e. C → T base replacement efficiency) of thymidine (Thymine, T).
PmCDA1(activation-induced cytidine deaminase(AID)ortholog from sea
It lamprey) is a kind of cytidine deaminase.In the PmCDA1 editing machine tested, SpCas9n (D10A) &PmCDA1&UGI alkali
Base editing system (it contains ura DNA saccharification enzyme inhibitor (uracil DNA glycosylase inhibitor, UGI))
Average mutation rate it is higher, reason has two: first is that UGI can inhibit ura DNA carbohydrase (uracil DNA
Glycosylase, UDG) it is catalyzed and removes uracil (Uracil, U) in DNA, second is that SpCas9n (D10A) is produced on non-editor's chain
Raw notch, inducible eukaryotic mismatch repair mechanism or long-patch BER (base-excision repair) repair mechanism, promote
Make the more Preference reparations of U:G mispairing at U:A.SpCas9n (D10A) is inconjunction with PmCDA1 and navigates to target spot by sgRNA,
C on the single stranded DNA of PmCDA1 catalysis non-matching occurs cytimidine deamination reaction and becomes U, by the reparation of DNA so that U and A
(adenine, Adenine) pairing matches T and A, to realize the conversion of C to T further through DNA replication dna.
In order to improve working efficiency, job costs are reduced, the raising that C → T base replaces efficiency is always Plant Genome
The research direction of base editing system.
Summary of the invention
The purpose of the present invention is improve the editorial efficiency of base editing system.
The present invention protects the method for improving base editing system editorial efficiency first.
The present invention method to be protected for improving base editing system editorial efficiency, concretely method one, it may include such as
Lower step: making expression of receptor sgRNA, hygromycin albumen, Cas9 albumen and cytosine deaminase, thus to the acceptor gene
Target gene in group carries out base editor.
It is described " to make expression of receptor sgRNA, hygromycin albumen, Cas9 albumen and cytimidine deamination in the above method one
Enzyme " can be by by the coding of the encoding gene of the encoding gene of the sgRNA, the hygromycin albumen, the Cas9 albumen
Gene and the cytosine deaminase encoding gene import receptor and realize.Receptor is imported specifically, can be placed in a carrier,
It can also be placed in different carriers and be directed respectively into receptor.
The present invention method to be protected for improving base editing system editorial efficiency, concretely method two, it may include such as
Lower step: make expression of receptor sgRNA, hygromycin albumen, Cas9 albumen, cytosine deaminase and the suppression of ura DNA carbohydrase
Preparation, to carry out base editor to the target gene in the acceptor gene group.
It is described " to make expression of receptor sgRNA, hygromycin albumen, Cas9 albumen, cytosine deaminase in the above method two
It is saccharified enzyme inhibitor with ura DNA " it can be by by the coding base of the encoding gene of the sgRNA, the hygromycin albumen
Cause, the encoding gene of the Cas9 albumen, the cytosine deaminase encoding gene and ura DNA saccharification enzyme inhibitor
Encoding gene import receptor realize.Receptor is imported specifically, can be placed in a carrier, different carriers can also be placed on
In be directed respectively into receptor.
In any of the above-described method, the receptor can be plant callus.
In any of the above-described method, " importing plant callus " can by infecting, co-culturing, screening step, obtain
To edited plant callus.Wherein hygromycin is used to handle plant callus as selective agent in screening step.
In any of the above-described method, during the importing receptor, hygromycin can be used to screen as selective agent
Resistant calli.The concentration of the hygromycin is 35-80mg/L (such as 35-50mg/L, 50-80mg/L, 35mg/L, 50mg/L
Or 80mg/L).Before the editorial efficiency of base editing system is not up to saturated (i.e. in base editing system editor also
C is not converted into T), the concentration of the hygromycin as selective agent is higher, then the editorial efficiency of base editing system is higher.
In any of the above-described method, the hygromycin albumen can be hygromix phosphotransferase.Hygromycin phosphoric acid
The amino acid sequence of transferase can by sequence 1 in sequence table from 5 ' ends nucleotide sequence shown in the 10786th to 11811
It translates.Encode the hygromix phosphotransferase gene can as in sequence table sequence 1 from 5 ' ends the 10786th to
Shown in 11811.
In any of the above-described method, the Cas9 albumen can be SpCas9n albumen.The amino acid of SpCas9n albumen
Sequence can nucleotide sequence shown in the 3010th to 7278 be translated from 5 ' ends by sequence 1 in sequence table.Coding institute
The gene for stating SpCas9n albumen can be as shown in sequence 1 the 3010th to 7278 from 5 ' ends in sequence table.
In any of the above-described method, the cytosine deaminase can be PmCDA1 or rAPOBEC1.The ammonia of PmCDA1
Base acid sequence can nucleotide sequence shown in the 7570th to 8193 be translated from 5 ' ends by sequence 1 in sequence table.
The amino acid sequence of rAPOBEC1 can by sequence 2 in sequence table from 5 ' ends nucleotide sequence shown in the 3010th to 3696
It translates.The gene for encoding the PmCDA1 can be as shown in sequence 1 the 7570th to 8193 from 5 ' ends in sequence table.It compiles
The gene of the code rAPOBEC1 can be as shown in sequence 2 the 3010th to 3696 from 5 ' ends in sequence table.
In any of the above-described method, the amino acid sequence of the ura DNA saccharification enzyme inhibitor can be by sequence table
Middle sequence 1 nucleotide sequence shown in the 8215th to 8511 from 5 ' ends is translated.Encode the ura DNA saccharification
The gene of enzyme inhibitor can be as shown in sequence 1 the 8215th to 8511 from 5 ' ends in sequence table.
In any of the above-described method, the sgRNA can be according to the target for carrying out base editor expected in acceptor gene group
Gene design.
In any of the above-described method, the plant can be a1) or a2) or a3): a1) gramineae plant;A2) rice;
A3) rice varieties OryzasativaLcv.Nipponbare.
Any of the above-described the method can be such that the editorial efficiency of base editing system significantly improves.In the volume of base editing system
Before collecting efficiency not up to saturation, the concentration of the hygromycin as selective agent is higher, then the editorial efficiency of base editing system is got over
It is high.
The present invention also protects X1) or X2).
X1) hygromycin is improving the application in base editing system editorial efficiency.
X2) application of the hygromycin in base editing system editor's acceptor gene group.
Any of the above-described editor can replace for C → T base.
Any of the above-described editorial efficiency can replace efficiency for C → T base.
In one embodiment of the invention, the present inventor constructs carrier S pCas9n&PmCDA1&UGI.It carries
SgRNA in body SpCas9n&PmCDA1&UGI is according to three shot designs of table 1.Carrier S pCas9n&PmCDA1&UGI (ring
Shape) nucleotide sequence as shown in sequence 1 in sequence table.In sequence 1, from 5 ' to 3 ', the 131st to 467 starts for OsU3
Son nucleotide sequence, the 474th to 550, the 647th to 723 and the 820th to 896 be pre-tRNA nucleotides sequence
Column, the 551st to 570 nucleotide sequence for CS650, the 571st to 646, the 744th to 819 and the 917th to 992
For the nucleotide sequence of sgRNA skeleton, the 724th to 743 nucleotide sequence for CS651, the 897th to 916 is CS652's
Nucleotide sequence, the 993rd to 1283 nucleotide sequence for OsU3 terminator, the 1290th to 3003 is OsUbq3 promoter
Nucleotide sequence, the 3010th to 7278 nucleotide sequence (do not contain terminator codon) for SpCas9n albumen, the 7570th
To 8193 nucleotide sequences (not containing terminator codon) for PmCDA1, the 8215th to 8511 nucleotides sequence for UGI
Column, the 8518th to 8712 nucleotide sequence for 35S terminator, the 8787th to 10779 nucleosides for ZmUbi1 promoter
Acid sequence, the 10786th to 11811 nucleotide sequence for hygromix phosphotransferase, the 11812nd to 12064 whole for Nos
Only sub nucleotide sequence.By carrier S pCas9n&PmCDA1&UGI Introduced into Rice kind OryzasativaLcv.Nipponbare (i.e. receptor), with hygromycin
As selective agent (hygromycin concentration is 35mg/L, 50mg/L or 80mg/L), kanamycin-resistant callus tissue is obtained;It counts in positive kanamycin-resistant callus tissue
C → T base replace efficiency.The result shows that SpCas9n (C of the D10A) &PmCDA1&UGI base editing system to three target spots
It is higher that → T base replaces efficiency;With the increase of hygromycin concentration when screening, C → T base of target spot replaces efficiency also therewith
Increase, and when the concentration of hygromycin reaches 50mg/L, C → T base replacement efficiency of target spot basically reaches saturation.Also, it sieves
With the increase of hygromycin concentration when selecting, kanamycin-resistant callus tissue positive rate is substantially unaffected, holding higher level.
In another embodiment of the present invention, the present inventor constructs carrier rAPOBEC1&SpCas9n&
UGI.SgRNA in carrier rAPOBEC1&SpCas9n&UGI is according to the CS650 and CS652 design in table 1.Carrier
The nucleotide sequence of rAPOBEC1&SpCas9n&UGI (annular) is as shown in sequence 2 in sequence table.In sequence 2, from 5 ' to 3 ',
131st to 467 nucleotide sequence for OsU3 promoter, the 474th to 550 and the 820th to 896 is pre-tRNA's
Nucleotide sequence, the 551st to 570 nucleotide sequence for CS650, the 571st to 646 and the 917th to 992 is
The nucleotide sequence of sgRNA skeleton, the 897th to 916 nucleotide sequence for CS652, the 993rd to 1283 terminates for OsU3
The nucleotide sequence of son, the 1290th to 3003 nucleotide sequence for OsUbq3 promoter, the 3010th to 3696 is
The nucleotide sequence (not containing terminator codon) of rAPOBEC1, the 3745th to 8013 nucleotide sequence for SpCas9n is (no
Contain terminator codon), the 8020th to 8316 nucleotide sequence for UGI, the 8323rd to 8517 core for 35S terminator
Nucleotide sequence, the 8592nd to 10584 nucleotide sequence for ZmUbi1 promoter, the 10591st to 11616 is hygromycin phosphorus
The nucleotide sequence of sour transferase, the 11643rd to 11858 nucleotide sequence for CaMV35S polyA.By rAPOBEC1&
SpCas9n&UGI base editing system Introduced into Rice kind OryzasativaLcv.Nipponbare, using hygromycin as selective agent, (hygromycin concentration is
35mg/L, 50mg/L or 80mg/L), obtain kanamycin-resistant callus tissue;C → T the base counted in positive kanamycin-resistant callus tissue replaces efficiency.As a result
Show with SpCas9n (compared with D10A) &PmCDA1&UGI base editing system, rAPOBEC1&SpCas9n&UGI base editor
System is lower to C → T base replacement efficiency of CS650 and CS652;But with the increasing of hygromycin concentration in screening and culturing medium
Add, C → T base replacement efficiency of target spot is consequently increased;For target spot CS652, when the concentration of hygromycin in screening and culturing medium
When reaching 50mg/L, C → T base replacement efficiency of target spot basically reaches saturation.Also, with the increasing of hygromycin concentration when screening
Add, kanamycin-resistant callus tissue positive rate keeps higher level.
It is demonstrated experimentally that improving the concentration of the hygromycin as selective agent, SpCas9n (D10A) &PmCDA1& can be improved
Editorial efficiency (i.e. C → T base replacement effect of UGI base editing system and rAPOBEC1&SpCas9n&UGI base editing system
Rate).It can be seen that improve as selective agent hygromycin concentration, can in the case where not influencing kanamycin-resistant callus tissue positive rate,
C → T the base for improving base editing system editor acceptor gene group replaces efficiency, and then efficiently obtains mutant.Present invention tool
There is important application value.
Detailed description of the invention
Fig. 1 is that (C → T base of D10A) &PmCDA1&UGI base editing system replaces the experiment knot of efficiency to SpCas9n
Fruit.
Fig. 2 is that C → T base of rAPOBEC1&SpCas9n&UGI base editing system replaces the experimental result of efficiency.
Specific embodiment
Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.
Experimental method in following embodiments is unless otherwise specified conventional method.
Test material as used in the following examples is unless otherwise specified to buy from routine biochemistry reagent shop
It arrives.
Three target spots shown in the 2nd column are tested in following 1 selection tables 1 of embodiment, and embodiment 2 selects the 2nd column in table 1
Shown in two target spots tested, target sequence is shown in Table in 1 the 3rd column, and corresponding target gene is shown in Table the 1st column in 1.
Table 1
Target gene | Target spot title | Target sequence |
OsALS | CS650 | cgcgtccatggagatccacc |
OsCDC48 | CS651 | gaccagccagcgtctggcgc |
OsNRT1.1B | CS652 | cggcgacggcgagcaagtgg |
Primer pair 650 is by primer CS650-F:5 '-taagaaccaccagcgacacc-3 ' and primer CS650-R:5 '-
Ggtaattgtgcttggtgatggag-3 ' composition, for expanding CS650.
Primer pair 651 is by primer CS651-F:5 '-acatcgagatggagaagcgg-3 ' and primer CS651-R:5 '-
Ccatgctccaatcgatgaatac-3 ' composition, for expanding CS651.
Primer pair 652 is by primer CS652-F:5 '-ttacgaactttataactttgtcgg-3 ' and primer CS652-R:
5 '-atggaggcgatgaggaagac-3 ' composition, for expanding CS652.
C → T base replaces efficiency=generation C → T base replacement rice positive kanamycin-resistant callus tissue block number/20 × 100%.
Embodiment 1, high concentration hygromycin selection improve SpCas9n, and (D10A) &PmCDA1&UGI base editing system is to target
C → T base of point replaces efficiency
One, the building of gene editing carrier
The present inventor constructs carrier S pCas9n&PmCDA1&UGI.
The nucleotide sequence of carrier S pCas9n&PmCDA1&UGI (annular) is as shown in sequence 1 in sequence table.In sequence 1,
From 5 ' to 3 ', the 131st to 467 be OsU3 promoter nucleotide sequence, the 474th to 550, the 647th to 723 and the
820 to 896 be pre-tRNA nucleotide sequence, the 551st to 570 be CS650 nucleotide sequence, the 571st to 646
Position, the 744th to 819 and the 917th to 992 be sgRNA skeleton nucleotide sequence, the 724th to 743 is CS651
Nucleotide sequence, the 897th to 916 nucleotide sequence for CS652, the 993rd to 1283 nucleotide for OsU3 terminator
Sequence, the 1290th to 3003 nucleotide sequence for OsUbq3 promoter, the 3010th to 7278 nucleotide for SpCas9n
Sequence (does not contain terminator codon), the 7570th to 8193 nucleotide sequence (not containing terminator codon) for PmCDA1,
8215th to 8511 nucleotide sequence for UGI, the 8518th to 8712 nucleotide sequence for 35S terminator, the 8787th
It is the nucleotide sequence of ZmUbi1 promoter, the 10786th to 11811 nucleosides for hygromix phosphotransferase to 10779
Acid sequence, the 11812nd to 12064 nucleotide sequence for Nos terminator.
Two, gene editing is carried out in callus
1, carrier S pCas9n&PmCDA1&UGI is imported into Agrobacterium LBA4404 (Shanghai Wei Di Bioisystech Co., Ltd
Product, CAT# AC1030), obtain recombinational agrobacterium.
2, recombinational agrobacterium is seeded to the YEP culture medium containing 50 μ g/ml kanamycins and 25 μ g/ml rifampins, 28 DEG C,
150rpm shake culture obtains the culture bacterium solution that OD600nm is 1.0-2.0;Take the culture bacterium solution, room temperature, 10000rpm from
Heart 1min collects thallus;The thallus is taken, being resuspended with infected liquid and being diluted to OD600nm is 0.2, obtains Agrobacterium infected liquid.
Infected liquid is that the sugar in N6 fluid nutrient medium is replaced with dextrose and saccharose to obtain;In infected liquid, glucose
Concentration be 10g/L, the concentration of sucrose is 20g/L.
3, rice varieties OryzasativaLcv.Nipponbare mature seed decladding threshing is placed in 100mL triangular flask, and 70% (v/v) ethyl alcohol is added
Aqueous solution soaking 30sec, then be placed in 25% (v/v) aqueous sodium hypochlorite solution, 120rpm concussion sterilizing 30min, sterile water punching
Wash 3 times, with filter paper suck dry moisture, then seed embryo be placed in downward on N6 solid medium, 28 DEG C dark culture 4-6 weeks, obtain
Callus.
4, after completing step 3, callus is placed in the Agrobacterium infected liquid containing 100 μM of acetosyringones and impregnates 10min, so
First be placed on the culture dish (including about 200mL infected liquid) for being covered with two layers of sterilizing filter paper afterwards, 21 DEG C dark culture 1 day;It then will be more
Wound be placed on recovery media (the N6 solid medium containing 200mg/L Ticarcillin/Clavulanate Acid), 25-28 DEG C dark culture 3 days.
5, the callus for taking step 4 to obtain, being placed in screening and culturing medium, (the N6 solid medium of the hygromycin containing 35mg/L contains
The N6 solid medium of 50mg/L hygromycin or the N6 solid medium of the hygromycin containing 80mg/L), 28 DEG C dark culture 2 weeks.
6, the callus for taking step 5 to obtain, is again placed in screening and culturing medium, 28 DEG C dark culture 2 weeks, obtain kanamycin-resistant callus tissue.
7, respectively extract 48 pieces of kanamycin-resistant callus tissues genomic DNA and using it as template, using primers F (5 '-
Attatgtagcttgtgcgtttcg-3 ') and primer R (5 '-gatgaagagcttatcgacgt-3 ') composition primer pair carry out
PCR amplification obtains pcr amplification product;The pcr amplification product is subjected to agarose gel electrophoresis, is then made the following judgment: such as
Contain the DNA fragmentation of about 1150bp in fruit pcr amplification product, then corresponding kanamycin-resistant callus tissue is positive kanamycin-resistant callus tissue;If PCR expands
Increase production the DNA fragmentation that about 1150bp is not contained in object, then corresponding kanamycin-resistant callus tissue is not positive kanamycin-resistant callus tissue.
Count kanamycin-resistant callus tissue positive rate.Kanamycin-resistant callus tissue positive rate is ratio shared by positive kanamycin-resistant callus tissue in 48 pieces of kanamycin-resistant callus tissues
Example.
Kanamycin-resistant callus tissue positive rate statistical result is shown in Table the 2nd column in 2.The result shows that SpCas9n (D10A) &PmCDA1&UGI
In base editing system, when hygromycin concentration in screening and culturing medium is between 35-80mg/L, kanamycin-resistant callus tissue positive rate compared with
Height reaches 70% or more.
Table 2
Hygromycin concentration in screening and culturing medium | Kanamycin-resistant callus tissue positive rate |
35mg/L | 72.1% |
50mg/L | 87.1% |
80mg/L | 70.7% |
8, the genomic DNA of the 20 pieces of positive kanamycin-resistant callus tissues obtained respectively using step 7 is as template, using primer pair 650,
Primer pair 651 or primer pair 652 carry out PCR amplification, obtain pcr amplification product.
9, the pcr amplification product for obtaining step 8 is sequenced.
Sequencing result is as follows: for CS650, the site that the replacement of C → T base occurs is corresponded to
cgTgtccatggagatccacc;For CS651, the site that the replacement of C → T base occurs is corresponded to
gaTTagccagcgtctggcgc;For CS652, the site that the replacement of C → T base occurs is corresponded to
CggTgacggcgagcaagtgg, Tggcgacggcgagcaagtgg or TggTgacggcgagcaagtgg.
C → T the base for counting CS650, CS651 and CS652 respectively replaces efficiency.Statistical result see Fig. 1 (Hpt-35 be containing
The N6 solid medium of 35mg/L hygromycin, Hpt-50 be the hygromycin containing 50mg/L N6 solid medium, Hpt-80 be containing
The N6 solid medium of 80mg/L hygromycin).The result shows that (D10A) &PmCDA1&UGI base editing system is to three by SpCas9n
C → T base replacement efficiency of a target spot is higher;With the increase of hygromycin concentration in screening and culturing medium, C → T alkali of target spot
Base replacement efficiency is consequently increased, and when the concentration of hygromycin in screening and culturing medium reaches 50mg/L, C → T base of target spot
Replacement efficiency basically reaches saturation.
Embodiment 2, high concentration hygromycin selection improve rAPOBEC1&SpCas9n&UGI base editing system to the C of target spot
→ T base replaces efficiency
One, the building of gene editing carrier
The present inventor constructs carrier rAPOBEC1&SpCas9n&UGI.
The nucleotide sequence of carrier rAPOBEC1&SpCas9n&UGI (annular) is as shown in sequence 2 in sequence table.Sequence 2
In, from 5 ' to 3 ', the 131st to 467 nucleotide sequence for OsU3 promoter, the 474th to 550 and the 820th to 896
Be the nucleotide sequence of pre-tRNA, the 551st to 570 be CS650 nucleotide sequence, the 571st to 646 and the 917th
Be the nucleotide sequence of sgRNA skeleton to 992, the 897th to 916 be CS652 nucleotide sequence, the 993rd to 1283
Position be OsU3 terminator nucleotide sequence, the 1290th to 3003 be OsUbq3 promoter nucleotide sequence, the 3010th to
3696 nucleotide sequences (not containing terminator codon) for rAPOBEC1, the 3745th to 8013 nucleosides for SpCas9n
Acid sequence (does not contain terminator codon), the 8020th to 8316 nucleotide sequence for UGI, and the 8323rd to 8517 is 35S
The nucleotide sequence of terminator, the 8592nd to 10584 nucleotide sequence for ZmUbi1 promoter, the 10591st to 11616
For the nucleotide sequence of hygromix phosphotransferase, the 11643rd to 11858 nucleotide sequence for CaMV35S polyA.
Two, gene editing is carried out in rice callus
1, according to the step of 1-7, carrier S pCas9n&PmCDA1&UGI is replaced with carrier in embodiment 1 two
RAPOBEC1&SpCas9n&UGI, other steps are constant, obtain positive kanamycin-resistant callus tissue.
Count kanamycin-resistant callus tissue positive rate.Kanamycin-resistant callus tissue positive rate is ratio shared by positive kanamycin-resistant callus tissue in 48 pieces of kanamycin-resistant callus tissues
Example.
Kanamycin-resistant callus tissue positive rate statistical result is shown in Table the 2nd column in 3.The result shows that rAPOBEC1&SpCas9n&UGI base
In editing system, when hygromycin concentration in screening and culturing medium is between 35-80mg/L, kanamycin-resistant callus tissue positive rate is higher, reaches
To 60% or more.
Table 3
Hygromycin concentration in screening and culturing medium | Kanamycin-resistant callus tissue positive rate |
35mg/L | 62.8% |
50mg/L | 68.9% |
80mg/L | 75.4% |
2, the genomic DNA of the 20 pieces of positive kanamycin-resistant callus tissues obtained respectively using step 1 is as template, using primer pair 650
Or primer pair 652 carries out PCR amplification, obtains pcr amplification product.
3, the pcr amplification product for obtaining step 2 is sequenced.
Sequencing result is as follows: for CS650, the site that the replacement of C → T base occurs is corresponded to
cgTgtccatggagatccacc;For CS652, the site that the replacement of C → T base occurs is corresponded to
CggTgacggcgagcaagtgg, Tggcgacggcgagcaagtgg or TggTgacggcgagcaagtgg.
C → T the base for counting CS650 and CS652 respectively replaces efficiency.Statistical result is shown in that (Hpt-35 is containing 35mg/L to Fig. 2
The N6 solid medium of hygromycin, Hpt-50 are the N6 solid medium of the hygromycin containing 50mg/L, and Hpt-80 is containing 80mg/L tide
The N6 solid medium of mycin).The result shows that with SpCas9n (compared with D10A) &PmCDA1&UGI base editing system,
RAPOBEC1&SpCas9n&UGI base editing system is lower to C → T base replacement efficiency of CS650 and CS652;But with
C → T base replacement efficiency of the increase of hygromycin concentration in screening and culturing medium, target spot is consequently increased;For target spot CS652,
When the concentration of hygromycin in screening and culturing medium reaches 50mg/L, C → T base replacement efficiency of target spot basically reaches saturation.
The above results show the increase with hygromycin concentration in screening and culturing medium, and C → T base of target spot replaces efficiency
It is consequently increased.
<110>Beijing City Agriculture and Forestry Institute
<120>a kind of method for improving base editing system editorial efficiency
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 18476
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 1
ggtggcagga tatattgtgg tgtaaacatg gcactagcct caccgtcttc gcagacgagg 60
ccgctaagtc gcagctacgc tctcaacggc actgactagg tagtttaaac gtgcacttaa 120
ttaaggtacc gaagcaactt aaagttatca ggcatgcatg gatcttggag gaatcagatg 180
tgcagtcagg gaccatagca caagacaggc gtcttctact ggtgctacca gcaaatgctg 240
gaagccggga acactgggta cgttggaaac cacgtgatgt gaagaagtaa gataaactgt 300
aggagaaaag catttcgtag tgggccatga agcctttcag gacatgtatt gcagtatggg 360
ccggcccatt acgcaattgg acgacaacaa agactagtat tagtaccacc tcggctatcc 420
acatagatca aagctgattt aaaagagttg tgcagatgat ccgtggcgga tccaacaaag 480
caccagtggt ctagtggtag aatagtaccc tgccacggta cagacccggg ttcgattccc 540
ggctggtgca cgcgtccatg gagatccacc gttttagagc tagaaatagc aagttaaaat 600
aaggctagtc cgttatcaac ttgaaaaagt ggcaccgagt cggtgcaaca aagcaccagt 660
ggtctagtgg tagaatagta ccctgccacg gtacagaccc gggttcgatt cccggctggt 720
gcagaccagc cagcgtctgg cgcgttttag agctagaaat agcaagttaa aataaggcta 780
gtccgttatc aacttgaaaa agtggcaccg agtcggtgca acaaagcacc agtggtctag 840
tggtagaata gtaccctgcc acggtacaga cccgggttcg attcccggct ggtgcacggc 900
gacggcgagc aagtgggttt tagagctaga aatagcaagt taaaataagg ctagtccgtt 960
atcaacttga aaaagtggca ccgagtcggt gctttttttt ttcgttttgc attgagtttt 1020
ctccgtcgca tgtttgcagt tttattttcc gttttgcatt gaaatttctc cgtctcatgt 1080
ttgcagcgtg ttcaaaaagt acgcagctgt atttcactta tttacggcgc cacattttca 1140
tgccgtttgt gccaactatc ccgagctagt gaatacagct tggcttcaca caacactggt 1200
gacccgctga cctgctcgta cctcgtaccg tcgtacggca cagcatttgg aattaaaggg 1260
tgtgatcgat actgcttgct gctaagctta caaattcggg tcaaggcgga agccagcgcg 1320
ccaccccacg tcagcaaata cggaggcgcg gggttgacgg cgtcacccgg tcctaacggc 1380
gaccaacaaa ccagccagaa gaaattacag taaaaaaaaa gtaaattgca ctttgatcca 1440
ccttttatta cctaagtctc aatttggatc acccttaaac ctatcttttc aatttgggcc 1500
gggttgtggt ttggactacc atgaacaact tttcgtcatg tctaacttcc ctttcagcaa 1560
acatatgaac catatataga ggagatcggc cgtatactag agctgatgtg tttaaggtcg 1620
ttgattgcac gagaaaaaaa aatccaaatc gcaacaatag caaatttatc tggttcaaag 1680
tgaaaagata tgtttaaagg tagtccaaag taaaacttat agataataaa atgtggtcca 1740
aagcgtaatt cactcaaaaa aaatcaacga gacgtgtacc aaacggagac aaacggcatc 1800
ttctcgaaat ttcccaaccg ctcgctcgcc cgcctcgtct tcccggaaac cgcggtggtt 1860
tcagcgtggc ggattctcca agcagacgga gacgtcacgg cacgggactc ctcccaccac 1920
ccaaccgcca taaataccag ccccctcatc tcctctcctc gcatcagctc cacccccgaa 1980
aaatttctcc ccaatctcgc gaggctctcg tcgtcgaatc gaatcctctc gcgtcctcaa 2040
ggtacgctgc ttctcctctc ctcgcttcgt ttcgattcga tttcggacgg gtgaggttgt 2100
tttgttgcta gatccgattg gtggttaggg ttgtcgatgt gattatcgtg agatgtttag 2160
gggttgtaga tctgatggtt gtgatttggg cacggttggt tcgataggtg gaatcgtggt 2220
taggttttgg gattggatgt tggttctgat gattgggggg aatttttacg gttagatgaa 2280
ttgttggatg attcgattgg ggaaatcggt gtagatctgt tggggaattg tggaactagt 2340
catgcctgag tgattggtgc gatttgtagc gtgttccatc ttgtaggcct tgttgcgagc 2400
atgttcagat ctactgttcc gctcttgatt gagttattgg tgccatgggt tggtgcaaac 2460
acaggcttta atatgttata tctgttttgt gtttgatgta gatctgtagg gtagttcttc 2520
ttagacatgg ttcaattatg tagcttgtgc gtttcgattt gatttcatat gttcacagat 2580
tagataatga tgaactcttt taattaattg tcaatggtaa ataggaagtc ttgtcgctat 2640
atctgtcata atgatctcat gttactatct gccagtaatt tatgctaaga actatattag 2700
aatatcatgt tacaatctgt agtaatatca tgttacaatc tgtagttcat ctatataatc 2760
tattgtggta atttcttttt actatctgtg tgaagattat tgccactagt tcattctact 2820
tatttctgaa gttcaggata cgtgtgctgt tactacctat ctgaatacat gtgtgatgtg 2880
cctgttacta tctttttgaa tacatgtatg ttctgttgga atatgtttgc tgtttgatcc 2940
gttgttgtgt ccttaatctt gtgctagttc ttaccctatc tgtttggtga ttatttcttg 3000
cagtacgtaa tggactacaa ggaccacgac ggggattaca aagaccacga catagactac 3060
aaggatgacg atgacaaaat ggcaccgaag aaaaaaagga aggtcggaat ccatggcgtt 3120
ccagctgccg ataagaaata ttccatcgga ctcgccattg gcacgaatag cgtcggatgg 3180
gctgttatta ctgatgagta caaagttccg tctaagaagt tcaaggtgct gggcaacaca 3240
gaccgccaca gcataaagaa aaatctcatc ggtgcactcc ttttcgatag tggggagact 3300
gcagaagcga caagattgaa aaggactgcg agaaggcgct atacacggcg taagaataga 3360
atctgctacc ttcaggagat tttctctaac gaaatggcta aggtcgatga cagtttcttt 3420
catagacttg aggaatcgtt cttggttgag gaggataaga aacatgagag gcacccgata 3480
tttggaaaca tcgtggatga ggtcgcatat catgaaaagt accccacaat ctaccacctg 3540
agaaagaaac tcgttgattc caccgacaaa gcggatttga gactcatcta cctcgctctt 3600
gcccatatga taaagttccg cggacacttt ctgatcgagg gcgacctcaa ccctgataat 3660
agcgacgtcg ataagctctt catccagttg gttcaaacct acaatcagct ctttgaggaa 3720
aacccaatta atgctagtgg agtggatgca aaagcgatac tgtcggccag actctccaag 3780
agcagaaggt tggagaacct gatcgctcaa cttcctggag aaaagaaaaa cggtcttttt 3840
gggaatttga ttgccttgtc tctgggcctc acaccaaact tcaagtcaaa ttttgacctc 3900
gctgaggatg ccaaacttca gttgtctaag gatacctatg atgacgatct tgacaatttg 3960
ctggcacaaa ttggcgacca gtacgcggat ctgttcctcg cagcgaagaa tctgagtgat 4020
gctattctcc tttcggacat actcagggtt aacactgaga tcacaaaagc acctttgagt 4080
gcgtcgatga ttaagcgcta tgatgaacat caccaagacc tcactttgct gaaggccctt 4140
gtgcggcagc aattgccaga gaagtacaaa gaaatcttct ttgaccaatc taagaacgga 4200
tacgctggct atattgatgg aggagcttct caggaggaat tctataagtt tatcaaacct 4260
atacttgaga agatggatgg tacagaggaa ctccttgtta aattgaacag agaagatttg 4320
ctgcgcaagc aacggacctt tgacaacgga tcaattccgc atcagataca cctcggcgag 4380
cttcatgcca tccttcgccg gcaggaagat ttctacccct ttttgaagga caaccgcgag 4440
aagatagaaa aaatccttac gttccggatt ccttactatg tgggtccatt ggcaaggggg 4500
aattcccgct ttgcgtggat gactcggaaa agcgaggaaa ctatcacacc gtggaacttc 4560
gaggaagttg tggacaaggg agcttctgcc caatcattca ttgagaggat gactaacttc 4620
gataagaacc tgccgaacga gaaagttctc cccaagcact ccctccttta cgagtatttc 4680
accgtgtata acgaacttac gaaggttaaa tacgtgactg agggtatgag gaagccagca 4740
ttcttgagcg gggaacaaaa gaaagcgatt gttgatttgc tgtttaaaac taatcgcaag 4800
gtgacagtca agcagctcaa agaggattat ttcaagaaaa ttgaatgttt cgactctgtg 4860
gagatatcag gagtcgaaga taggtttaac gcttcccttg gcacatacca tgacctcctt 4920
aagatcatta aggacaaaga tttcctggat aacgaggaaa atgaggacat cctcgaagat 4980
attgttctta ccttgacgct gtttgaggat cgcgaaatga tcgaggaacg gcttaagacg 5040
tatgctcact tgttcgacga taaggttatg aagcagctca agcgtagaag gtacactgga 5100
tggggccgtc tgtctagaaa gctcatcaac ggaatacgtg ataaacaaag tggcaagaca 5160
attttggatt ttctgaagtc ggacggattc gccaacagaa attttatgca gctgattcat 5220
gacgatagtc tcaccttcaa agaggacata cagaaggctc aagtgagtgg tcaaggggat 5280
tcgctgcatg aacacatcgc aaacctcgcg ggttcaccgg ccataaagaa aggaatcctt 5340
caaactgtta aggtcgttga tgagttggtt aaagtgatgg gtaggcacaa gcccgaaaac 5400
atagtgatcg agatggctcg cgaaaatcag actacacaaa aagggcagaa gaactctcgc 5460
gagcggatga aaaggattga ggaaggaatc aaggaactgg gctcacagat tctcaaagag 5520
catccagtcg aaaacacaca gctgcaaaat gagaagctct atctttacta tctccaaaat 5580
ggccgggaca tgtatgttga tcaggagctt gacatcaacc gtttgtccga ctatgatgtg 5640
gaccacattg tcccgcaatc tttccttaag gacgattcaa tcgataataa ggtgttgacc 5700
cggagcgata aaaaccgtgg aaagtctgac aatgtccctt cagaggaagt ggttaagaag 5760
atgaagaact actggagaca attgctgaat gcaaaactga tcacacagag aaagttcgac 5820
aacctcacca aagcagagag aggtgggctc agtgaacttg ataaagcggg cttcattaag 5880
cgtcagctcg ttgagactag acagatcacg aagcatgtcg cgcagatttt ggattcgcgg 5940
atgaacacga agtacgacga gaatgataaa ctgatacgtg aagtcaaggt tatcactctt 6000
aagtccaaat tggtgagcga tttcagaaag gacttccaat tctataaggt cagggagatc 6060
aacaattatc atcacgctca cgatgcctac cttaatgctg ttgtggggac cgcccttatt 6120
aagaaatacc ctaaattgga gtctgaattc gtttacgggg attataaggt ctacgacgtt 6180
aggaaaatga tagctaagag tgagcaggag atcggtaaag caactgcgaa gtatttcttt 6240
tactcgaaca tcatgaattt ctttaagacc gagataacgc tggcaaatgg cgaaattaga 6300
aagaggcctc tcatagagac taacggtgag acaggggaaa tcgtctggga taagggtagg 6360
gactttgcga cagtgcgcaa ggtcctctct atgccgcaag ttaatattgt gaagaaaacc 6420
gaggtgcaga cgggaggctt ctccaaggaa agcatacttc ccaaacggaa ctctgataag 6480
ttgatcgctc gtaagaaaga ttgggaccct aagaaatatg gtgggttcga ttccccaact 6540
gttgcttaca gcgtgctggt cgttgccaag gtcgagaagg gtaaatccaa gaaactcaaa 6600
agcgttaagg aactccttgg gattactatc atggagagat cttcattcga aaagaatcct 6660
atcgactttc ttgaggccaa aggatataag gaagttaaga aagatctgat aatcaaactc 6720
ccaaagtact cattgtttga gctggaaaac ggcaggaagc gcatgcttgc ttccgccgga 6780
gagttgcaga aagggaacga gttggctctg ccttctaagt atgttaactt cctctatctt 6840
gcctctcatt acgagaagct caaaggctca ccagaggaca acgaacagaa acaacttttt 6900
gtcgagcaac ataagcacta tttggatgag attatagaac agatcagtga attctcgaaa 6960
agggttatcc ttgcagatgc gaatcttgac aaggtgttgt ctgcatacaa caaacataga 7020
gataagccga tcagggagca agcggaaaat atcattcacc tcttcactct tacaaacttg 7080
ggtgctcccg ctgccttcaa gtattttgat accacgattg accggaaacg ttacacctca 7140
acgaaggagg tgctggatgc caccctcatc caccaatcta ttaccggact ctacgagact 7200
agaatcgatc tctcacagct cggcggggat aaaagaccag cagcgacgaa aaaggcagga 7260
caggctaaga agaagaaaga gctcggagga ggaggcacgg gaggaggagg ctccgccgag 7320
tatgtgcgcg cgctcttcga cttcaacggc aatgacgagg aggatctccc tttcaagaag 7380
ggcgacatcc tccgcatccg cgataagccg gaggagcagt ggtggaacgc agaggactcc 7440
gagggcaagc ggggcatgat cctggtgcca tacgtcgaga agtacagcgg cgattacaag 7500
gaccacgatg gcgactacaa ggatcatgac atcgattaca aggacgatga cgataagtcc 7560
ggcgtcgaca tgacggacgc ggagtatgtg cgcatccacg agaagctcga tatctacacc 7620
ttcaagaagc agttcttcaa caataagaag tcggtgtccc atcggtgcta cgtcctcttc 7680
gagctgaagc gcaggggaga gcgccgcgcc tgcttctggg gctacgcggt gaataagccg 7740
cagtcaggca cagagcgcgg catccacgcc gagatcttct cgatccggaa ggtcgaggag 7800
tacctccgcg acaacccagg ccagttcacg atcaattggt actccagctg gtccccttgc 7860
gcagattgcg cagagaagat cctcgagtgg tacaaccagg agctgagggg caatggccat 7920
accctcaaga tctgggcctg caagctgtac tacgagaaga acgcgaggaa tcagatcggc 7980
ctctggaacc tgcgggataa tggcgtgggc ctcaacgtga tggtgtccga gcactaccag 8040
tgctgccgca agatcttcat ccagtcctcc cacaatcagc tgaacgagaa taggtggctc 8100
gaaaagaccc tgaagcgcgc cgagaagtgg aggagcgagc tgtctatcat gatccaggtc 8160
aagatcctgc acaccacaaa gtcaccggcg gtgggcggcg gcggcagcga attctccggc 8220
ggcagcacga acctcagcga catcatcgag aaggagacag gcaagcagct cgtgatccag 8280
gagtctatcc tcatgctgcc tgaggaggtg gaggaggtca tcggcaacaa gccggagtcc 8340
gatatcctcg tgcacaccgc ctacgacgag tcgacagatg agaatgtcat gctcctgacc 8400
tccgacgcac cagagtacaa gccatgggcg ctcgtgatcc aggattccaa cggcgagaat 8460
aagatcaaga tgctgtctgg cggctccccg aagaagaagc gcaaggtcta gactagtctg 8520
aaatcaccag tctctctcta caaatctatc tctctctata ataatgtgtg agtagttccc 8580
agataaggga attagggttc ttatagggtt tcgctcatgt gttgagcata taagaaaccc 8640
ttagtatgta tttgtatttg taaaatactt ctatcaataa aatttctaat tcctaaaacc 8700
aaaatccagt ggggcgcccg acctgtactc gcgaaggtta acttacagag agtgtccggg 8760
cgcgcctggt ggatcgtccg cctaggctgc agtgcagcgt gacccggtcg tgcccctctc 8820
tagagataat gagcattgca tgtctaagtt ataaaaaatt accacatatt ttttttgtca 8880
cacttgtttg aagtgcagtt tatctatctt tatacatata tttaaacttt actctacgaa 8940
taatataatc tatagtacta caataatatc agtgttttag agaatcatat aaatgaacag 9000
ttagacatgg tctaaaggac aattgagtat tttgacaaca ggactctaca gttttatctt 9060
tttagtgtgc atgtgttctc cttttttttt gcaaatagct tcacctatat aatacttcat 9120
ccattttatt agtacatcca tttagggttt agggttaatg gtttttatag actaattttt 9180
ttagtacatc tattttattc tattttagcc tctaaattaa gaaaactaaa actctatttt 9240
agttttttta tttaataatt tagatataaa atagaataaa ataaagtgac taaaaattaa 9300
acaaataccc tttaagaaat taaaaaaact aaggaaacat ttttcttgtt tcgagtagat 9360
aatgccagcc tgttaaacgc cgtcgacgag tctaacggac accaaccagc gaaccagcag 9420
cgtcgcgtcg ggccaagcga agcagacggc acggcatctc tgtcgctgcc tctggacccc 9480
tctcgagagt tccgctccac cgttggactt gctccgctgt cggcatccag aaattgcgtg 9540
gcggagcggc agacgtgagc cggcacggca ggcggcctcc tcctcctctc acggcaccgg 9600
cagctacggg ggattccttt cccaccgctc cttcgctttc ccttcctcgc ccgccgtaat 9660
aaatagacac cccctccaca ccctctttcc ccaacctcgt gttgttcgga gcgcacacac 9720
acacaaccag atctccccca aatccacccg tcggcacctc cgcttcaagg tacgccgctc 9780
gtcctccccc cccccccctc tctaccttct ctagatcggc gttccggtcc atggttaggg 9840
cccggtagtt ctacttctgt tcatgtttgt gttagatccg tgtttgtgtt agatccgtgc 9900
tgctagcgtt cgtacacgga tgcgacctgt acgtcagaca cgttctgatt gctaacttgc 9960
cagtgtttct ctttggggaa tcctgggatg gctctagccg ttccgcagac gggatcgatt 10020
tcatgatttt ttttgtttcg ttgcataggg tttggtttgc ccttttcctt tatttcaata 10080
tatgccgtgc acttgtttgt cgggtcatct tttcatgctt ttttttgtct tggttgtgat 10140
gatgtggtct ggttgggcgg tcgttctaga tcggagtaga attctgtttc aaactacctg 10200
gtggatttat taattttgga tctgtatgtg tgtgccatac atattcatag ttacgaattg 10260
aagatgatgg atggaaatat cgatctagga taggtataca tgttgatgcg ggttttactg 10320
atgcatatac agagatgctt tttgttcgct tggttgtgat gatgtggtgt ggttgggcgg 10380
tcgttcattc gttctagatc ggagtagaat actgtttcaa actacctggt gtatttatta 10440
attttggaac tgtatgtgtg tgtcatacat cttcatagtt acgagtttaa gatggatgga 10500
aatatcgatc taggataggt atacatgttg atgtgggttt tactgatgca tatacatgat 10560
ggcatatgca gcatctattc atatgctcta accttgagta cctatctatt ataataaaca 10620
agtatgtttt ataattattt tgatcttgat atacttggat gatggcatat gcagcagcta 10680
tatgtggatt tttttagccc tgccttcata cgctatttat ttgcttggta ctgtttcttt 10740
tgtcgatgct caccctgttg tttggtgtta cttctgcagg agctcatgaa aaagcctgaa 10800
ctcaccgcga cgtctgtcga gaagtttctg atcgaaaagt tcgacagcgt ctccgacctg 10860
atgcagctct cggagggcga agaatctcgt gctttcagct tcgatgtagg agggcgtgga 10920
tatgtcctgc gggtaaatag ctgcgccgat ggtttctaca aagatcgtta tgtttatcgg 10980
cactttgcat cggccgcgct cccgattccg gaagtgcttg acattgggga gtttagcgag 11040
agcctgacct attgcatctc ccgccgttca cagggtgtca cgttgcaaga cctgcctgaa 11100
accgaactgc ccgctgttct acaaccggtc gcggaggcta tggatgcgat cgctgcggcc 11160
gatcttagcc agacgagcgg gttcggccca ttcggaccgc aaggaatcgg tcaatacact 11220
acatggcgtg atttcatatg cgcgattgct gatccccatg tgtatcactg gcaaactgtg 11280
atggacgaca ccgtcagtgc gtccgtcgcg caggctctcg atgagctgat gctttgggcc 11340
gaggactgcc ccgaagtccg gcacctcgtg cacgcggatt tcggctccaa caatgtcctg 11400
acggacaatg gccgcataac agcggtcatt gactggagcg aggcgatgtt cggggattcc 11460
caatacgagg tcgccaacat cttcttctgg aggccgtggt tggcttgtat ggagcagcag 11520
acgcgctact tcgagcggag gcatccggag cttgcaggat cgccacgact ccgggcgtat 11580
atgctccgca ttggtcttga ccaactctat cagagcttgg ttgacggcaa tttcgatgat 11640
gcagcttggg cgcagggtcg atgcgacgca atcgtccgat ccggagccgg gactgtcggg 11700
cgtacacaaa tcgcccgcag aagcgcggcc gtctggaccg atggctgtgt agaagtactc 11760
gccgatagtg gaaaccgacg ccccagcact cgtccgaggg caaagaaata ggatcgttca 11820
aacatttggc aataaagttt cttaagattg aatcctgttg ccggtcttgc gatgattatc 11880
atataatttc tgttgaatta cgttaagcat gtaataatta acatgtaatg catgacgtta 11940
tttatgagat gggtttttat gattagagtc ccgcaattat acatttaata cgcgatagaa 12000
aacaaaatat agcgcgcaaa ctaggataaa ttatcgcgcg cggtgtcatc tatgttacta 12060
gatctgtagc cctgcaggac gcgtttaatt aagtgcacgc ggccgcctac ttagtcaaga 12120
gcctcgcacg cgactgtcac gcggccagga tcgcctcgtg agcctcgcaa tctgtaccta 12180
gtgtttaaac tatcagtgtt tgacaggata tattggcggg taaacctaag agaaaagagc 12240
gtttattaga ataacggata tttaaaaggg cgtgaaaagg tttatccgtt cgtccatttg 12300
tatgtgcatg ccaaccacag ggttcccctc gggatcaaag tactttgatc caacccctcc 12360
gctgctatag tgcagtcggc ttctgacgtt cagtgcagcc gtcttctgaa aacgacatgt 12420
cgcacaagtc ctaagttacg cgacaggctg ccgccctgcc cttttcctgg cgttttcttg 12480
tcgcgtgttt tagtcgcata aagtagaata cttgcgacta gaaccggaga cattacgcca 12540
tgaacaagag cgccgccgct ggcctgctgg gctatgcccg cgtcagcacc gacgaccagg 12600
acttgaccaa ccaacgggcc gaactgcacg cggccggctg caccaagctg ttttccgaga 12660
agatcaccgg caccaggcgc gaccgcccgg agctggccag gatgcttgac cacctacgcc 12720
ctggcgacgt tgtgacagtg accaggctag accgcctggc ccgcagcacc cgcgacctac 12780
tggacattgc cgagcgcatc caggaggccg gcgcgggcct gcgtagcctg gcagagccgt 12840
gggccgacac caccacgccg gccggccgca tggtgttgac cgtgttcgcc ggcattgccg 12900
agttcgagcg ttccctaatc atcgaccgca cccggagcgg gcgcgaggcc gccaaggccc 12960
gaggcgtgaa gtttggcccc cgccctaccc tcaccccggc acagatcgcg cacgcccgcg 13020
agctgatcga ccaggaaggc cgcaccgtga aagaggcggc tgcactgctt ggcgtgcatc 13080
gctcgaccct gtaccgcgca cttgagcgca gcgaggaagt gacgcccacc gaggccaggc 13140
ggcgcggtgc cttccgtgag gacgcattga ccgaggccga cgccctggcg gccgccgaga 13200
atgaacgcca agaggaacaa gcatgaaacc gcaccaggac ggccaggacg aaccgttttt 13260
cattaccgaa gagatcgagg cggagatgat cgcggccggg tacgtgttcg agccgcccgc 13320
gcacgtctca accgtgcggc tgcatgaaat cctggccggt ttgtctgatg ccaagctggc 13380
ggcctggccg gccagcttgg ccgctgaaga aaccgagcgc cgccgtctaa aaaggtgatg 13440
tgtatttgag taaaacagct tgcgtcatgc ggtcgctgcg tatatgatgc gatgagtaaa 13500
taaacaaata cgcaagggga acgcatgaag gttatcgctg tacttaacca gaaaggcggg 13560
tcaggcaaga cgaccatcgc aacccatcta gcccgcgccc tgcaactcgc cggggccgat 13620
gttctgttag tcgattccga tccccagggc agtgcccgcg attgggcggc cgtgcgggaa 13680
gatcaaccgc taaccgttgt cggcatcgac cgcccgacga ttgaccgcga cgtgaaggcc 13740
atcggccggc gcgacttcgt agtgatcgac ggagcgcccc aggcggcgga cttggctgtg 13800
tccgcgatca aggcagccga cttcgtgctg attccggtgc agccaagccc ttacgacata 13860
tgggccaccg ccgacctggt ggagctggtt aagcagcgca ttgaggtcac ggatggaagg 13920
ctacaagcgg cctttgtcgt gtcgcgggcg atcaaaggca cgcgcatcgg cggtgaggtt 13980
gccgaggcgc tggccgggta cgagctgccc attcttgagt cccgtatcac gcagcgcgtg 14040
agctacccag gcactgccgc cgccggcaca accgttcttg aatcagaacc cgagggcgac 14100
gctgcccgcg aggtccaggc gctggccgct gaaattaaat caaaactcat ttgagttaat 14160
gaggtaaaga gaaaatgagc aaaagcacaa acacgctaag tgccggccgt ccgagcgcac 14220
gcagcagcaa ggctgcaacg ttggccagcc tggcagacac gccagccatg aagcgggtca 14280
actttcagtt gccggcggag gatcacacca agctgaagat gtacgcggta cgccaaggca 14340
agaccattac cgagctgcta tctgaataca tcgcgcagct accagagtaa atgagcaaat 14400
gaataaatga gtagatgaat tttagcggct aaaggaggcg gcatggaaaa tcaagaacaa 14460
ccaggcaccg acgccgtgga atgccccatg tgtggaggaa cgggcggttg gccaggcgta 14520
agcggctggg ttgtctgccg gccctgcaat ggcactggaa cccccaagcc cgaggaatcg 14580
gcgtgacggt cgcaaaccat ccggcccggt acaaatcggc gcggcgctgg gtgatgacct 14640
ggtggagaag ttgaaggccg cgcaggccgc ccagcggcaa cgcatcgagg cagaagcacg 14700
ccccggtgaa tcgtggcaag cggccgctga tcgaatccgc aaagaatccc ggcaaccgcc 14760
ggcagccggt gcgccgtcga ttaggaagcc gcccaagggc gacgagcaac cagatttttt 14820
cgttccgatg ctctatgacg tgggcacccg cgatagtcgc agcatcatgg acgtggccgt 14880
tttccgtctg tcgaagcgtg accgacgagc tggcgaggtg atccgctacg agcttccaga 14940
cgggcacgta gaggtttccg cagggccggc cggcatggcc agtgtgtggg attacgacct 15000
ggtactgatg gcggtttccc atctaaccga atccatgaac cgataccggg aagggaaggg 15060
agacaagccc ggccgcgtgt tccgtccaca cgttgcggac gtactcaagt tctgccggcg 15120
agccgatggc ggaaagcaga aagacgacct ggtagaaacc tgcattcggt taaacaccac 15180
gcacgttgcc atgcagcgta cgaagaaggc caagaacggc cgcctggtga cggtatccga 15240
gggtgaagcc ttgattagcc gctacaagat cgtaaagagc gaaaccgggc ggccggagta 15300
catcgagatc gagctagctg attggatgta ccgcgagatc acagaaggca agaacccgga 15360
cgtgctgacg gttcaccccg attacttttt gatcgatccc ggcatcggcc gttttctcta 15420
ccgcctggca cgccgcgccg caggcaaggc agaagccaga tggttgttca agacgatcta 15480
cgaacgcagt ggcagcgccg gagagttcaa gaagttctgt ttcaccgtgc gcaagctgat 15540
cgggtcaaat gacctgccgg agtacgattt gaaggaggag gcggggcagg ctggcccgat 15600
cctagtcatg cgctaccgca acctgatcga gggcgaagca tccgccggtt cctaatgtac 15660
ggagcagatg ctagggcaaa ttgccctagc aggggaaaaa ggtcgaaaag gtctctttcc 15720
tgtggatagc acgtacattg ggaacccaaa gccgtacatt gggaaccgga acccgtacat 15780
tgggaaccca aagccgtaca ttgggaaccg gtcacacatg taagtgactg atataaaaga 15840
gaaaaaaggc gatttttccg cctaaaactc tttaaaactt attaaaactc ttaaaacccg 15900
cctggcctgt gcataactgt ctggccagcg cacagccgaa gagctgcaaa aagcgcctac 15960
ccttcggtcg ctgcgctccc tacgccccgc cgcttcgcgt cggcctatcg cggccgctgg 16020
ccgctcaaaa atggctggcc tacggccagg caatctacca gggcgcggac aagccgcgcc 16080
gtcgccactc gaccgccggc gcccacatca aggcaccctg cctcgcgcgt ttcggtgatg 16140
acggtgaaaa cctctgacac atgcagctcc cggagacggt cacagcttgt ctgtaagcgg 16200
atgccgggag cagacaagcc cgtcagggcg cgtcagcggg tgttggcggg tgtcggggcg 16260
cagccatgac ccagtcacgt agcgatagcg gagtgtatac tggcttaact atgcggcatc 16320
agagcagatt gtactgagag tgcaccatat gcggtgtgaa ataccgcaca gatgcgtaag 16380
gagaaaatac cgcatcaggc gctcttccgc ttcctcgctc actgactcgc tgcgctcggt 16440
cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga 16500
atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg 16560
taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg agcatcacaa 16620
aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt 16680
tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta ccggatacct 16740
gtccgccttt ctcccttcgg gaagcgtggc gctttctcat agctcacgct gtaggtatct 16800
cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc 16860
cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa gacacgactt 16920
atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc 16980
tacagagttc ttgaagtggt ggcctaacta cggctacact agaaggacag tatttggtat 17040
ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa 17100
acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa 17160
aaaaggatct caagaagatc ctttgatctt ttctacgggg tctgacgctc agtggaacga 17220
aaactcacgt taagggattt tggtcatgca ttctaggtac taaaacaatt catccagtaa 17280
aatataatat tttattttct cccaatcagg cttgatcccc agtaagtcaa aaaatagctc 17340
gacatactgt tcttccccga tatcctccct gatcgaccgg acgcagaagg caatgtcata 17400
ccacttgtcc gccctgccgc ttctcccaag atcaataaag ccacttactt tgccatcttt 17460
cacaaagatg ttgctgtctc ccaggtcgcc gtgggaaaag acaagttcct cttcgggctt 17520
ttccgtcttt aaaaaatcat acagctcgcg cggatcttta aatggagtgt cttcttccca 17580
gttttcgcaa tccacatcgg ccagatcgtt attcagtaag taatccaatt cggctaagcg 17640
gctgtctaag ctattcgtat agggacaatc cgatatgtcg atggagtgaa agagcctgat 17700
gcactccgca tacagctcga taatcttttc agggctttgt tcatcttcat actcttccga 17760
gcaaaggacg ccatcggcct cactcatgag cagattgctc cagccatcat gccgttcaaa 17820
gtgcaggacc tttggaacag gcagctttcc ttccagccat agcatcatgt ccttttcccg 17880
ttccacatca taggtggtcc ctttataccg gctgtccgtc atttttaaat ataggttttc 17940
attttctccc accagcttat ataccttagc aggagacatt ccttccgtat cttttacgca 18000
gcggtatttt tcgatcagtt ttttcaattc cggtgatatt ctcattttag ccatttatta 18060
tttccttcct cttttctaca gtatttaaag ataccccaag aagctaatta taacaagacg 18120
aactccaatt cactgttcct tgcattctaa aaccttaaat accagaaaac agctttttca 18180
aagttgtttt caaagttggc gtataacata gtatcgacgg agccgatttt gaaaccgcgg 18240
tgatcacagg cagcaacgct ctgtcatcgt tacaatcaac atgctaccct ccgcgagatc 18300
atccgtgttt caaacccggc agcttagttg ccgttcttcc gaatagcatc ggtaacatga 18360
gcaaagtctg ccgccttaca acggctctcc cgctgacgcc gtcccggact gatgggctgc 18420
ctgtatcgag tggtgatttt gtgccgagct gccggtcggg gagctgttgg ctggct 18476
<210> 2
<211> 18264
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 2
ggtggcagga tatattgtgg tgtaaacatg gcactagcct caccgtcttc gcagacgagg 60
ccgctaagtc gcagctacgc tctcaacggc actgactagg tagtttaaac gtgcacttaa 120
ttaaggtacc gaagcaactt aaagttatca ggcatgcatg gatcttggag gaatcagatg 180
tgcagtcagg gaccatagca caagacaggc gtcttctact ggtgctacca gcaaatgctg 240
gaagccggga acactgggta cgttggaaac cacgtgatgt gaagaagtaa gataaactgt 300
aggagaaaag catttcgtag tgggccatga agcctttcag gacatgtatt gcagtatggg 360
ccggcccatt acgcaattgg acgacaacaa agactagtat tagtaccacc tcggctatcc 420
acatagatca aagctgattt aaaagagttg tgcagatgat ccgtggcgga tccaacaaag 480
caccagtggt ctagtggtag aatagtaccc tgccacggta cagacccggg ttcgattccc 540
ggctggtgca cgcgtccatg gagatccacc gttttagagc tagaaatagc aagttaaaat 600
aaggctagtc cgttatcaac ttgaaaaagt ggcaccgagt cggtgcaaca aagcaccagt 660
ggtctagtgg tagaatagta ccctgccacg gtacagaccc gggttcgatt cccggctggt 720
gcagaccagc cagcgtctgg cgcgttttag agctagaaat agcaagttaa aataaggcta 780
gtccgttatc aacttgaaaa agtggcaccg agtcggtgca acaaagcacc agtggtctag 840
tggtagaata gtaccctgcc acggtacaga cccgggttcg attcccggct ggtgcacggc 900
gacggcgagc aagtgggttt tagagctaga aatagcaagt taaaataagg ctagtccgtt 960
atcaacttga aaaagtggca ccgagtcggt gctttttttt ttcgttttgc attgagtttt 1020
ctccgtcgca tgtttgcagt tttattttcc gttttgcatt gaaatttctc cgtctcatgt 1080
ttgcagcgtg ttcaaaaagt acgcagctgt atttcactta tttacggcgc cacattttca 1140
tgccgtttgt gccaactatc ccgagctagt gaatacagct tggcttcaca caacactggt 1200
gacccgctga cctgctcgta cctcgtaccg tcgtacggca cagcatttgg aattaaaggg 1260
tgtgatcgat actgcttgct gctaagctta caaattcggg tcaaggcgga agccagcgcg 1320
ccaccccacg tcagcaaata cggaggcgcg gggttgacgg cgtcacccgg tcctaacggc 1380
gaccaacaaa ccagccagaa gaaattacag taaaaaaaaa gtaaattgca ctttgatcca 1440
ccttttatta cctaagtctc aatttggatc acccttaaac ctatcttttc aatttgggcc 1500
gggttgtggt ttggactacc atgaacaact tttcgtcatg tctaacttcc ctttcagcaa 1560
acatatgaac catatataga ggagatcggc cgtatactag agctgatgtg tttaaggtcg 1620
ttgattgcac gagaaaaaaa aatccaaatc gcaacaatag caaatttatc tggttcaaag 1680
tgaaaagata tgtttaaagg tagtccaaag taaaacttat agataataaa atgtggtcca 1740
aagcgtaatt cactcaaaaa aaatcaacga gacgtgtacc aaacggagac aaacggcatc 1800
ttctcgaaat ttcccaaccg ctcgctcgcc cgcctcgtct tcccggaaac cgcggtggtt 1860
tcagcgtggc ggattctcca agcagacgga gacgtcacgg cacgggactc ctcccaccac 1920
ccaaccgcca taaataccag ccccctcatc tcctctcctc gcatcagctc cacccccgaa 1980
aaatttctcc ccaatctcgc gaggctctcg tcgtcgaatc gaatcctctc gcgtcctcaa 2040
ggtacgctgc ttctcctctc ctcgcttcgt ttcgattcga tttcggacgg gtgaggttgt 2100
tttgttgcta gatccgattg gtggttaggg ttgtcgatgt gattatcgtg agatgtttag 2160
gggttgtaga tctgatggtt gtgatttggg cacggttggt tcgataggtg gaatcgtggt 2220
taggttttgg gattggatgt tggttctgat gattgggggg aatttttacg gttagatgaa 2280
ttgttggatg attcgattgg ggaaatcggt gtagatctgt tggggaattg tggaactagt 2340
catgcctgag tgattggtgc gatttgtagc gtgttccatc ttgtaggcct tgttgcgagc 2400
atgttcagat ctactgttcc gctcttgatt gagttattgg tgccatgggt tggtgcaaac 2460
acaggcttta atatgttata tctgttttgt gtttgatgta gatctgtagg gtagttcttc 2520
ttagacatgg ttcaattatg tagcttgtgc gtttcgattt gatttcatat gttcacagat 2580
tagataatga tgaactcttt taattaattg tcaatggtaa ataggaagtc ttgtcgctat 2640
atctgtcata atgatctcat gttactatct gccagtaatt tatgctaaga actatattag 2700
aatatcatgt tacaatctgt agtaatatca tgttacaatc tgtagttcat ctatataatc 2760
tattgtggta atttcttttt actatctgtg tgaagattat tgccactagt tcattctact 2820
tatttctgaa gttcaggata cgtgtgctgt tactacctat ctgaatacat gtgtgatgtg 2880
cctgttacta tctttttgaa tacatgtatg ttctgttgga atatgtttgc tgtttgatcc 2940
gttgttgtgt ccttaatctt gtgctagttc ttaccctatc tgtttggtga ttatttcttg 3000
cagtacgtaa tgtccagcga gacaggacca gtggcagtcg acccaacact gcgcaggcgg 3060
atcgagccac acgagttcga ggtgttcttc gatccgaggg agctccggaa ggagacatgc 3120
ctcctgtacg agatcaactg gggcggccgc cactctatct ggaggcatac ctcacagaac 3180
acaaataagc atgtggaggt caacttcatc gagaagttca ccacagagcg gtacttctgc 3240
ccgaatacgc gctgctccat cacctggttc ctgtcgtggt ccccatgcgg agagtgctcg 3300
agggcaatca cggagttcct ctcccgctac ccgcacgtca ccctgttcat ctacatcgca 3360
cggctctacc accatgcgga cccgcggaat aggcagggcc tccgcgatct gatctcttca 3420
ggcgtgacaa tccagatcat gacggagcag gagtcaggct actgctggag gaacttcgtc 3480
aattacagcc catctaacga ggcacactgg ccgcgctacc cgcatctctg ggtgcgcctc 3540
tacgtgctcg agctgtactg catcatcctc ggcctgccgc catgcctcaa tatcctgcgc 3600
aggaagcagc cgcagctgac gttcttcacc atcgccctcc agagctgcca ctaccagcgg 3660
ctccctccgc atatcctgtg ggcgacaggc ctcaagtcag gctcggagac acctggcacg 3720
tccgagagcg ccaccccgga gtctatggac tacaaggacc acgacgggga ttacaaagac 3780
cacgacatag actacaagga tgacgatgac aaaatggcac cgaagaaaaa aaggaaggtc 3840
ggaatccatg gcgttccagc tgccgataag aaatattcca tcggactcgc cattggcacg 3900
aatagcgtcg gatgggctgt tattactgat gagtacaaag ttccgtctaa gaagttcaag 3960
gtgctgggca acacagaccg ccacagcata aagaaaaatc tcatcggtgc actccttttc 4020
gatagtgggg agactgcaga agcgacaaga ttgaaaagga ctgcgagaag gcgctataca 4080
cggcgtaaga atagaatctg ctaccttcag gagattttct ctaacgaaat ggctaaggtc 4140
gatgacagtt tctttcatag acttgaggaa tcgttcttgg ttgaggagga taagaaacat 4200
gagaggcacc cgatatttgg aaacatcgtg gatgaggtcg catatcatga aaagtacccc 4260
acaatctacc acctgagaaa gaaactcgtt gattccaccg acaaagcgga tttgagactc 4320
atctacctcg ctcttgccca tatgataaag ttccgcggac actttctgat cgagggcgac 4380
ctcaaccctg ataatagcga cgtcgataag ctcttcatcc agttggttca aacctacaat 4440
cagctctttg aggaaaaccc aattaatgct agtggagtgg atgcaaaagc gatactgtcg 4500
gccagactct ccaagagcag aaggttggag aacctgatcg ctcaacttcc tggagaaaag 4560
aaaaacggtc tttttgggaa tttgattgcc ttgtctctgg gcctcacacc aaacttcaag 4620
tcaaattttg acctcgctga ggatgccaaa cttcagttgt ctaaggatac ctatgatgac 4680
gatcttgaca atttgctggc acaaattggc gaccagtacg cggatctgtt cctcgcagcg 4740
aagaatctga gtgatgctat tctcctttcg gacatactca gggttaacac tgagatcaca 4800
aaagcacctt tgagtgcgtc gatgattaag cgctatgatg aacatcacca agacctcact 4860
ttgctgaagg cccttgtgcg gcagcaattg ccagagaagt acaaagaaat cttctttgac 4920
caatctaaga acggatacgc tggctatatt gatggaggag cttctcagga ggaattctat 4980
aagtttatca aacctatact tgagaagatg gatggtacag aggaactcct tgttaaattg 5040
aacagagaag atttgctgcg caagcaacgg acctttgaca acggatcaat tccgcatcag 5100
atacacctcg gcgagcttca tgccatcctt cgccggcagg aagatttcta cccctttttg 5160
aaggacaacc gcgagaagat agaaaaaatc cttacgttcc ggattcctta ctatgtgggt 5220
ccattggcaa gggggaattc ccgctttgcg tggatgactc ggaaaagcga ggaaactatc 5280
acaccgtgga acttcgagga agttgtggac aagggagctt ctgcccaatc attcattgag 5340
aggatgacta acttcgataa gaacctgccg aacgagaaag ttctccccaa gcactccctc 5400
ctttacgagt atttcaccgt gtataacgaa cttacgaagg ttaaatacgt gactgagggt 5460
atgaggaagc cagcattctt gagcggggaa caaaagaaag cgattgttga tttgctgttt 5520
aaaactaatc gcaaggtgac agtcaagcag ctcaaagagg attatttcaa gaaaattgaa 5580
tgtttcgact ctgtggagat atcaggagtc gaagataggt ttaacgcttc ccttggcaca 5640
taccatgacc tccttaagat cattaaggac aaagatttcc tggataacga ggaaaatgag 5700
gacatcctcg aagatattgt tcttaccttg acgctgtttg aggatcgcga aatgatcgag 5760
gaacggctta agacgtatgc tcacttgttc gacgataagg ttatgaagca gctcaagcgt 5820
agaaggtaca ctggatgggg ccgtctgtct agaaagctca tcaacggaat acgtgataaa 5880
caaagtggca agacaatttt ggattttctg aagtcggacg gattcgccaa cagaaatttt 5940
atgcagctga ttcatgacga tagtctcacc ttcaaagagg acatacagaa ggctcaagtg 6000
agtggtcaag gggattcgct gcatgaacac atcgcaaacc tcgcgggttc accggccata 6060
aagaaaggaa tccttcaaac tgttaaggtc gttgatgagt tggttaaagt gatgggtagg 6120
cacaagcccg aaaacatagt gatcgagatg gctcgcgaaa atcagactac acaaaaaggg 6180
cagaagaact ctcgcgagcg gatgaaaagg attgaggaag gaatcaagga actgggctca 6240
cagattctca aagagcatcc agtcgaaaac acacagctgc aaaatgagaa gctctatctt 6300
tactatctcc aaaatggccg ggacatgtat gttgatcagg agcttgacat caaccgtttg 6360
tccgactatg atgtggacca cattgtcccg caatctttcc ttaaggacga ttcaatcgat 6420
aataaggtgt tgacccggag cgataaaaac cgtggaaagt ctgacaatgt cccttcagag 6480
gaagtggtta agaagatgaa gaactactgg agacaattgc tgaatgcaaa actgatcaca 6540
cagagaaagt tcgacaacct caccaaagca gagagaggtg ggctcagtga acttgataaa 6600
gcgggcttca ttaagcgtca gctcgttgag actagacaga tcacgaagca tgtcgcgcag 6660
attttggatt cgcggatgaa cacgaagtac gacgagaatg ataaactgat acgtgaagtc 6720
aaggttatca ctcttaagtc caaattggtg agcgatttca gaaaggactt ccaattctat 6780
aaggtcaggg agatcaacaa ttatcatcac gctcacgatg cctaccttaa tgctgttgtg 6840
gggaccgccc ttattaagaa ataccctaaa ttggagtctg aattcgttta cggggattat 6900
aaggtctacg acgttaggaa aatgatagct aagagtgagc aggagatcgg taaagcaact 6960
gcgaagtatt tcttttactc gaacatcatg aatttcttta agaccgagat aacgctggca 7020
aatggcgaaa ttagaaagag gcctctcata gagactaacg gtgagacagg ggaaatcgtc 7080
tgggataagg gtagggactt tgcgacagtg cgcaaggtcc tctctatgcc gcaagttaat 7140
attgtgaaga aaaccgaggt gcagacggga ggcttctcca aggaaagcat acttcccaaa 7200
cggaactctg ataagttgat cgctcgtaag aaagattggg accctaagaa atatggtggg 7260
ttcgattccc caactgttgc ttacagcgtg ctggtcgttg ccaaggtcga gaagggtaaa 7320
tccaagaaac tcaaaagcgt taaggaactc cttgggatta ctatcatgga gagatcttca 7380
ttcgaaaaga atcctatcga ctttcttgag gccaaaggat ataaggaagt taagaaagat 7440
ctgataatca aactcccaaa gtactcattg tttgagctgg aaaacggcag gaagcgcatg 7500
cttgcttccg ccggagagtt gcagaaaggg aacgagttgg ctctgccttc taagtatgtt 7560
aacttcctct atcttgcctc tcattacgag aagctcaaag gctcaccaga ggacaacgaa 7620
cagaaacaac tttttgtcga gcaacataag cactatttgg atgagattat agaacagatc 7680
agtgaattct cgaaaagggt tatccttgca gatgcgaatc ttgacaaggt gttgtctgca 7740
tacaacaaac atagagataa gccgatcagg gagcaagcgg aaaatatcat tcacctcttc 7800
actcttacaa acttgggtgc tcccgctgcc ttcaagtatt ttgataccac gattgaccgg 7860
aaacgttaca cctcaacgaa ggaggtgctg gatgccaccc tcatccacca atctattacc 7920
ggactctacg agactagaat cgatctctca cagctcggcg gggataaaag accagcagcg 7980
acgaaaaagg caggacaggc taagaagaag aaagagctct ccggcggcag cacgaacctc 8040
agcgacatca tcgagaagga gacaggcaag cagctcgtga tccaggagtc tatcctcatg 8100
ctgcctgagg aggtggagga ggtcatcggc aacaagccgg agtccgatat cctcgtgcac 8160
accgcctacg acgagtcgac agatgagaat gtcatgctcc tgacctccga cgcaccagag 8220
tacaagccat gggcgctcgt gatccaggat tccaacggcg agaataagat caagatgctg 8280
tctggcggct ccccgaagaa gaagcgcaag gtctagacta gtctgaaatc accagtctct 8340
ctctacaaat ctatctctct ctataataat gtgtgagtag ttcccagata agggaattag 8400
ggttcttata gggtttcgct catgtgttga gcatataaga aacccttagt atgtatttgt 8460
atttgtaaaa tacttctatc aataaaattt ctaattccta aaaccaaaat ccagtggggc 8520
gcccgacctg tactcgcgaa ggttaactta cagagagtgt ccgggcgcgc ctggtggatc 8580
gtccgcctag gctgcagtgc agcgtgaccc ggtcgtgccc ctctctagag ataatgagca 8640
ttgcatgtct aagttataaa aaattaccac atattttttt tgtcacactt gtttgaagtg 8700
cagtttatct atctttatac atatatttaa actttactct acgaataata taatctatag 8760
tactacaata atatcagtgt tttagagaat catataaatg aacagttaga catggtctaa 8820
aggacaattg agtattttga caacaggact ctacagtttt atctttttag tgtgcatgtg 8880
ttctcctttt tttttgcaaa tagcttcacc tatataatac ttcatccatt ttattagtac 8940
atccatttag ggtttagggt taatggtttt tatagactaa tttttttagt acatctattt 9000
tattctattt tagcctctaa attaagaaaa ctaaaactct attttagttt ttttatttaa 9060
taatttagat ataaaataga ataaaataaa gtgactaaaa attaaacaaa taccctttaa 9120
gaaattaaaa aaactaagga aacatttttc ttgtttcgag tagataatgc cagcctgtta 9180
aacgccgtcg acgagtctaa cggacaccaa ccagcgaacc agcagcgtcg cgtcgggcca 9240
agcgaagcag acggcacggc atctctgtcg ctgcctctgg acccctctcg agagttccgc 9300
tccaccgttg gacttgctcc gctgtcggca tccagaaatt gcgtggcgga gcggcagacg 9360
tgagccggca cggcaggcgg cctcctcctc ctctcacggc accggcagct acgggggatt 9420
cctttcccac cgctccttcg ctttcccttc ctcgcccgcc gtaataaata gacaccccct 9480
ccacaccctc tttccccaac ctcgtgttgt tcggagcgca cacacacaca accagatctc 9540
ccccaaatcc acccgtcggc acctccgctt caaggtacgc cgctcgtcct cccccccccc 9600
ccctctctac cttctctaga tcggcgttcc ggtccatggt tagggcccgg tagttctact 9660
tctgttcatg tttgtgttag atccgtgttt gtgttagatc cgtgctgcta gcgttcgtac 9720
acggatgcga cctgtacgtc agacacgttc tgattgctaa cttgccagtg tttctctttg 9780
gggaatcctg ggatggctct agccgttccg cagacgggat cgatttcatg attttttttg 9840
tttcgttgca tagggtttgg tttgcccttt tcctttattt caatatatgc cgtgcacttg 9900
tttgtcgggt catcttttca tgcttttttt tgtcttggtt gtgatgatgt ggtctggttg 9960
ggcggtcgtt ctagatcgga gtagaattct gtttcaaact acctggtgga tttattaatt 10020
ttggatctgt atgtgtgtgc catacatatt catagttacg aattgaagat gatggatgga 10080
aatatcgatc taggataggt atacatgttg atgcgggttt tactgatgca tatacagaga 10140
tgctttttgt tcgcttggtt gtgatgatgt ggtgtggttg ggcggtcgtt cattcgttct 10200
agatcggagt agaatactgt ttcaaactac ctggtgtatt tattaatttt ggaactgtat 10260
gtgtgtgtca tacatcttca tagttacgag tttaagatgg atggaaatat cgatctagga 10320
taggtataca tgttgatgtg ggttttactg atgcatatac atgatggcat atgcagcatc 10380
tattcatatg ctctaacctt gagtacctat ctattataat aaacaagtat gttttataat 10440
tattttgatc ttgatatact tggatgatgg catatgcagc agctatatgt ggattttttt 10500
agccctgcct tcatacgcta tttatttgct tggtactgtt tcttttgtcg atgctcaccc 10560
tgttgtttgg tgttacttct gcaggagctc atgaaaaagc ctgaactcac cgcgacgtct 10620
gtcgagaagt ttctgatcga aaagttcgac agcgtctccg acctgatgca gctctcggag 10680
ggcgaagaat ctcgtgcttt cagcttcgat gtaggagggc gtggatatgt cctgcgggta 10740
aatagctgcg ccgatggttt ctacaaagat cgttatgttt atcggcactt tgcatcggcc 10800
gcgctcccga ttccggaagt gcttgacatt ggggagttta gcgagagcct gacctattgc 10860
atctcccgcc gttcacaggg tgtcacgttg caagacctgc ctgaaaccga actgcccgct 10920
gttctacaac cggtcgcgga ggctatggat gcgatcgctg cggccgatct tagccagacg 10980
agcgggttcg gcccattcgg accgcaagga atcggtcaat acactacatg gcgtgatttc 11040
atatgcgcga ttgctgatcc ccatgtgtat cactggcaaa ctgtgatgga cgacaccgtc 11100
agtgcgtccg tcgcgcaggc tctcgatgag ctgatgcttt gggccgagga ctgccccgaa 11160
gtccggcacc tcgtgcacgc ggatttcggc tccaacaatg tcctgacgga caatggccgc 11220
ataacagcgg tcattgactg gagcgaggcg atgttcgggg attcccaata cgaggtcgcc 11280
aacatcttct tctggaggcc gtggttggct tgtatggagc agcagacgcg ctacttcgag 11340
cggaggcatc cggagcttgc aggatcgcca cgactccggg cgtatatgct ccgcattggt 11400
cttgaccaac tctatcagag cttggttgac ggcaatttcg atgatgcagc ttgggcgcag 11460
ggtcgatgcg acgcaatcgt ccgatccgga gccgggactg tcgggcgtac acaaatcgcc 11520
cgcagaagcg cggccgtctg gaccgatggc tgtgtagaag tactcgccga tagtggaaac 11580
cgacgcccca gcactcgtcc gagggcaaag aaatagagta gatgccgacc gggatctgtc 11640
gatcgacaag ctcgagtttc tccataataa tgtgtgagta gttcccagat aagggaatta 11700
gggttcctat agggtttcgc tcatgtgttg agcatataag aaacccttag tatgtatttg 11760
tatttgtaaa atacttctat caataaaatt tctaattcct aaaaccaaaa tccagtacta 11820
aaatccagat cccccgaatt aattcggcgt taattcagcc tgcaggacgc gtttaattaa 11880
gtgcacgcgg ccgcctactt agtcaagagc ctcgcacgcg actgtcacgc ggccaggatc 11940
gcctcgtgag cctcgcaatc tgtacctagt gtttaaacta tcagtgtttg acaggatata 12000
ttggcgggta aacctaagag aaaagagcgt ttattagaat aacggatatt taaaagggcg 12060
tgaaaaggtt tatccgttcg tccatttgta tgtgcatgcc aaccacaggg ttcccctcgg 12120
gatcaaagta ctttgatcca acccctccgc tgctatagtg cagtcggctt ctgacgttca 12180
gtgcagccgt cttctgaaaa cgacatgtcg cacaagtcct aagttacgcg acaggctgcc 12240
gccctgccct tttcctggcg ttttcttgtc gcgtgtttta gtcgcataaa gtagaatact 12300
tgcgactaga accggagaca ttacgccatg aacaagagcg ccgccgctgg cctgctgggc 12360
tatgcccgcg tcagcaccga cgaccaggac ttgaccaacc aacgggccga actgcacgcg 12420
gccggctgca ccaagctgtt ttccgagaag atcaccggca ccaggcgcga ccgcccggag 12480
ctggccagga tgcttgacca cctacgccct ggcgacgttg tgacagtgac caggctagac 12540
cgcctggccc gcagcacccg cgacctactg gacattgccg agcgcatcca ggaggccggc 12600
gcgggcctgc gtagcctggc agagccgtgg gccgacacca ccacgccggc cggccgcatg 12660
gtgttgaccg tgttcgccgg cattgccgag ttcgagcgtt ccctaatcat cgaccgcacc 12720
cggagcgggc gcgaggccgc caaggcccga ggcgtgaagt ttggcccccg ccctaccctc 12780
accccggcac agatcgcgca cgcccgcgag ctgatcgacc aggaaggccg caccgtgaaa 12840
gaggcggctg cactgcttgg cgtgcatcgc tcgaccctgt accgcgcact tgagcgcagc 12900
gaggaagtga cgcccaccga ggccaggcgg cgcggtgcct tccgtgagga cgcattgacc 12960
gaggccgacg ccctggcggc cgccgagaat gaacgccaag aggaacaagc atgaaaccgc 13020
accaggacgg ccaggacgaa ccgtttttca ttaccgaaga gatcgaggcg gagatgatcg 13080
cggccgggta cgtgttcgag ccgcccgcgc acgtctcaac cgtgcggctg catgaaatcc 13140
tggccggttt gtctgatgcc aagctggcgg cctggccggc cagcttggcc gctgaagaaa 13200
ccgagcgccg ccgtctaaaa aggtgatgtg tatttgagta aaacagcttg cgtcatgcgg 13260
tcgctgcgta tatgatgcga tgagtaaata aacaaatacg caaggggaac gcatgaaggt 13320
tatcgctgta cttaaccaga aaggcgggtc aggcaagacg accatcgcaa cccatctagc 13380
ccgcgccctg caactcgccg gggccgatgt tctgttagtc gattccgatc cccagggcag 13440
tgcccgcgat tgggcggccg tgcgggaaga tcaaccgcta accgttgtcg gcatcgaccg 13500
cccgacgatt gaccgcgacg tgaaggccat cggccggcgc gacttcgtag tgatcgacgg 13560
agcgccccag gcggcggact tggctgtgtc cgcgatcaag gcagccgact tcgtgctgat 13620
tccggtgcag ccaagccctt acgacatatg ggccaccgcc gacctggtgg agctggttaa 13680
gcagcgcatt gaggtcacgg atggaaggct acaagcggcc tttgtcgtgt cgcgggcgat 13740
caaaggcacg cgcatcggcg gtgaggttgc cgaggcgctg gccgggtacg agctgcccat 13800
tcttgagtcc cgtatcacgc agcgcgtgag ctacccaggc actgccgccg ccggcacaac 13860
cgttcttgaa tcagaacccg agggcgacgc tgcccgcgag gtccaggcgc tggccgctga 13920
aattaaatca aaactcattt gagttaatga ggtaaagaga aaatgagcaa aagcacaaac 13980
acgctaagtg ccggccgtcc gagcgcacgc agcagcaagg ctgcaacgtt ggccagcctg 14040
gcagacacgc cagccatgaa gcgggtcaac tttcagttgc cggcggagga tcacaccaag 14100
ctgaagatgt acgcggtacg ccaaggcaag accattaccg agctgctatc tgaatacatc 14160
gcgcagctac cagagtaaat gagcaaatga ataaatgagt agatgaattt tagcggctaa 14220
aggaggcggc atggaaaatc aagaacaacc aggcaccgac gccgtggaat gccccatgtg 14280
tggaggaacg ggcggttggc caggcgtaag cggctgggtt gtctgccggc cctgcaatgg 14340
cactggaacc cccaagcccg aggaatcggc gtgacggtcg caaaccatcc ggcccggtac 14400
aaatcggcgc ggcgctgggt gatgacctgg tggagaagtt gaaggccgcg caggccgccc 14460
agcggcaacg catcgaggca gaagcacgcc ccggtgaatc gtggcaagcg gccgctgatc 14520
gaatccgcaa agaatcccgg caaccgccgg cagccggtgc gccgtcgatt aggaagccgc 14580
ccaagggcga cgagcaacca gattttttcg ttccgatgct ctatgacgtg ggcacccgcg 14640
atagtcgcag catcatggac gtggccgttt tccgtctgtc gaagcgtgac cgacgagctg 14700
gcgaggtgat ccgctacgag cttccagacg ggcacgtaga ggtttccgca gggccggccg 14760
gcatggccag tgtgtgggat tacgacctgg tactgatggc ggtttcccat ctaaccgaat 14820
ccatgaaccg ataccgggaa gggaagggag acaagcccgg ccgcgtgttc cgtccacacg 14880
ttgcggacgt actcaagttc tgccggcgag ccgatggcgg aaagcagaaa gacgacctgg 14940
tagaaacctg cattcggtta aacaccacgc acgttgccat gcagcgtacg aagaaggcca 15000
agaacggccg cctggtgacg gtatccgagg gtgaagcctt gattagccgc tacaagatcg 15060
taaagagcga aaccgggcgg ccggagtaca tcgagatcga gctagctgat tggatgtacc 15120
gcgagatcac agaaggcaag aacccggacg tgctgacggt tcaccccgat tactttttga 15180
tcgatcccgg catcggccgt tttctctacc gcctggcacg ccgcgccgca ggcaaggcag 15240
aagccagatg gttgttcaag acgatctacg aacgcagtgg cagcgccgga gagttcaaga 15300
agttctgttt caccgtgcgc aagctgatcg ggtcaaatga cctgccggag tacgatttga 15360
aggaggaggc ggggcaggct ggcccgatcc tagtcatgcg ctaccgcaac ctgatcgagg 15420
gcgaagcatc cgccggttcc taatgtacgg agcagatgct agggcaaatt gccctagcag 15480
gggaaaaagg tcgaaaaggt ctctttcctg tggatagcac gtacattggg aacccaaagc 15540
cgtacattgg gaaccggaac ccgtacattg ggaacccaaa gccgtacatt gggaaccggt 15600
cacacatgta agtgactgat ataaaagaga aaaaaggcga tttttccgcc taaaactctt 15660
taaaacttat taaaactctt aaaacccgcc tggcctgtgc ataactgtct ggccagcgca 15720
cagccgaaga gctgcaaaaa gcgcctaccc ttcggtcgct gcgctcccta cgccccgccg 15780
cttcgcgtcg gcctatcgcg gccgctggcc gctcaaaaat ggctggccta cggccaggca 15840
atctaccagg gcgcggacaa gccgcgccgt cgccactcga ccgccggcgc ccacatcaag 15900
gcaccctgcc tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg 15960
gagacggtca cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg 16020
tcagcgggtg ttggcgggtg tcggggcgca gccatgaccc agtcacgtag cgatagcgga 16080
gtgtatactg gcttaactat gcggcatcag agcagattgt actgagagtg caccatatgc 16140
ggtgtgaaat accgcacaga tgcgtaagga gaaaataccg catcaggcgc tcttccgctt 16200
cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta tcagctcact 16260
caaaggcggt aatacggtta tccacagaat caggggataa cgcaggaaag aacatgtgag 16320
caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg tttttccata 16380
ggctccgccc ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc 16440
cgacaggact ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg 16500
ttccgaccct gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc 16560
tttctcatag ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg 16620
gctgtgtgca cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc 16680
ttgagtccaa cccggtaaga cacgacttat cgccactggc agcagccact ggtaacagga 16740
ttagcagagc gaggtatgta ggcggtgcta cagagttctt gaagtggtgg cctaactacg 16800
gctacactag aaggacagta tttggtatct gcgctctgct gaagccagtt accttcggaa 16860
aaagagttgg tagctcttga tccggcaaac aaaccaccgc tggtagcggt ggtttttttg 16920
tttgcaagca gcagattacg cgcagaaaaa aaggatctca agaagatcct ttgatctttt 16980
ctacggggtc tgacgctcag tggaacgaaa actcacgtta agggattttg gtcatgcatt 17040
ctaggtacta aaacaattca tccagtaaaa tataatattt tattttctcc caatcaggct 17100
tgatccccag taagtcaaaa aatagctcga catactgttc ttccccgata tcctccctga 17160
tcgaccggac gcagaaggca atgtcatacc acttgtccgc cctgccgctt ctcccaagat 17220
caataaagcc acttactttg ccatctttca caaagatgtt gctgtctccc aggtcgccgt 17280
gggaaaagac aagttcctct tcgggctttt ccgtctttaa aaaatcatac agctcgcgcg 17340
gatctttaaa tggagtgtct tcttcccagt tttcgcaatc cacatcggcc agatcgttat 17400
tcagtaagta atccaattcg gctaagcggc tgtctaagct attcgtatag ggacaatccg 17460
atatgtcgat ggagtgaaag agcctgatgc actccgcata cagctcgata atcttttcag 17520
ggctttgttc atcttcatac tcttccgagc aaaggacgcc atcggcctca ctcatgagca 17580
gattgctcca gccatcatgc cgttcaaagt gcaggacctt tggaacaggc agctttcctt 17640
ccagccatag catcatgtcc ttttcccgtt ccacatcata ggtggtccct ttataccggc 17700
tgtccgtcat ttttaaatat aggttttcat tttctcccac cagcttatat accttagcag 17760
gagacattcc ttccgtatct tttacgcagc ggtatttttc gatcagtttt ttcaattccg 17820
gtgatattct cattttagcc atttattatt tccttcctct tttctacagt atttaaagat 17880
accccaagaa gctaattata acaagacgaa ctccaattca ctgttccttg cattctaaaa 17940
ccttaaatac cagaaaacag ctttttcaaa gttgttttca aagttggcgt ataacatagt 18000
atcgacggag ccgattttga aaccgcggtg atcacaggca gcaacgctct gtcatcgtta 18060
caatcaacat gctaccctcc gcgagatcat ccgtgtttca aacccggcag cttagttgcc 18120
gttcttccga atagcatcgg taacatgagc aaagtctgcc gccttacaac ggctctcccg 18180
ctgacgccgt cccggactga tgggctgcct gtatcgagtg gtgattttgt gccgagctgc 18240
cggtcgggga gctgttggct ggct 18264
Claims (10)
1. a kind of method for improving base editing system editorial efficiency, includes the following steps: to keep expression of receptor sgRNA, moisture resistance mould
Fibroin, Cas9 albumen and cytosine deaminase, to carry out base editor to the target gene in the acceptor gene group.
2. the method as described in claim 1, it is characterised in that: described " to make expression of receptor sgRNA, hygromycin albumen, Cas9
Albumen and cytosine deaminase " is by by the encoding gene of the encoding gene of the sgRNA, the hygromycin albumen, described
The encoding gene of Cas9 albumen and the cytosine deaminase encoding gene import receptor and realize.
3. a kind of method for improving base editing system editorial efficiency, includes the following steps: to keep expression of receptor sgRNA, moisture resistance mould
Fibroin, Cas9 albumen, cytosine deaminase and ura DNA saccharification enzyme inhibitor, thus in the acceptor gene group
Target gene carries out base editor.
4. method as claimed in claim 3, it is characterised in that: described " to make expression of receptor sgRNA, hygromycin albumen, Cas9
Albumen, cytosine deaminase and ura DNA saccharification enzyme inhibitor " is by mould by the encoding gene of the sgRNA, the moisture resistance
The encoding gene of fibroin, the encoding gene of the Cas9 albumen, the cytosine deaminase encoding gene and the uracil
The encoding gene of DNA saccharification enzyme inhibitor imports receptor and realizes.
5. the method as described in Claims 1-4 is any, it is characterised in that: the receptor is plant callus.
6. method as claimed in claim 1 to 5, it is characterised in that: during the importing receptor, use hygromycin
Resistant calli is screened as selective agent.
7. method as claimed in claim 6, it is characterised in that: the concentration of the hygromycin is 35-80mg/L.
8. the method as described in claim 5 to 7 is any, it is characterised in that: the plant be a1) a2) or a3): a1) grass
Section plant;A2) rice;A3) rice varieties OryzasativaLcv.Nipponbare.
9.X1) or X2):
X1) hygromycin is improving the application in base editing system editorial efficiency;
X2) application of the hygromycin in base editing system editor's acceptor gene group.
10. method as described in any of the claims 1 to 8 or application as claimed in claim 9, it is characterised in that: the editor
Efficiency is that C → T base replaces efficiency.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201811634032.1A CN109679989A (en) | 2018-12-29 | 2018-12-29 | A method of improving base editing system editorial efficiency |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201811634032.1A CN109679989A (en) | 2018-12-29 | 2018-12-29 | A method of improving base editing system editorial efficiency |
Publications (1)
Publication Number | Publication Date |
---|---|
CN109679989A true CN109679989A (en) | 2019-04-26 |
Family
ID=66190226
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201811634032.1A Pending CN109679989A (en) | 2018-12-29 | 2018-12-29 | A method of improving base editing system editorial efficiency |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN109679989A (en) |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110423736A (en) * | 2019-08-16 | 2019-11-08 | 中国人民解放军陆军军医大学第一附属医院 | Base edit tool and its application and the wide window of progress and the method without sequence Preference base editor in eukaryocyte |
CN110564752A (en) * | 2019-09-30 | 2019-12-13 | 北京市农林科学院 | Application of differential agent technology in enrichment of C.T base substitution cells |
CN110669794A (en) * | 2019-09-30 | 2020-01-10 | 北京市农林科学院 | Cell enrichment technology of C.T base substitution by using mutant screening agent resistance gene as report system and application thereof |
CN110951743A (en) * | 2019-12-31 | 2020-04-03 | 北京市农林科学院 | Method for improving plant gene replacement efficiency |
CN111378051A (en) * | 2020-03-25 | 2020-07-07 | 北京市农林科学院 | PE-P2 guided editing system and application thereof in genome base editing |
CN112725348A (en) * | 2019-10-28 | 2021-04-30 | 安徽省农业科学院水稻研究所 | Gene and method for improving single-base editing efficiency of rice and application of gene |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104450785A (en) * | 2014-12-08 | 2015-03-25 | 复旦大学 | Genome editing method using attachment carrier for encoding targeted endonuclease and kit |
WO2017070632A2 (en) * | 2015-10-23 | 2017-04-27 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
US20180237787A1 (en) * | 2016-12-23 | 2018-08-23 | President And Fellows Of Harvard College | Gene editing of pcsk9 |
-
2018
- 2018-12-29 CN CN201811634032.1A patent/CN109679989A/en active Pending
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104450785A (en) * | 2014-12-08 | 2015-03-25 | 复旦大学 | Genome editing method using attachment carrier for encoding targeted endonuclease and kit |
WO2017070632A2 (en) * | 2015-10-23 | 2017-04-27 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
US20180237787A1 (en) * | 2016-12-23 | 2018-08-23 | President And Fellows Of Harvard College | Gene editing of pcsk9 |
Non-Patent Citations (1)
Title |
---|
任斌等: "水稻靶标基因单碱基定向替换技术的建立", 《中国科学》 * |
Cited By (11)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110423736A (en) * | 2019-08-16 | 2019-11-08 | 中国人民解放军陆军军医大学第一附属医院 | Base edit tool and its application and the wide window of progress and the method without sequence Preference base editor in eukaryocyte |
CN110564752A (en) * | 2019-09-30 | 2019-12-13 | 北京市农林科学院 | Application of differential agent technology in enrichment of C.T base substitution cells |
CN110669794A (en) * | 2019-09-30 | 2020-01-10 | 北京市农林科学院 | Cell enrichment technology of C.T base substitution by using mutant screening agent resistance gene as report system and application thereof |
CN110669794B (en) * | 2019-09-30 | 2021-07-16 | 北京市农林科学院 | Cell enrichment technology of C.T base substitution by using mutant screening agent resistance gene as report system and application thereof |
CN110564752B (en) * | 2019-09-30 | 2021-07-16 | 北京市农林科学院 | Application of differential agent technology in enrichment of C.T base substitution cells |
CN112725348A (en) * | 2019-10-28 | 2021-04-30 | 安徽省农业科学院水稻研究所 | Gene and method for improving single-base editing efficiency of rice and application of gene |
CN112725348B (en) * | 2019-10-28 | 2022-04-01 | 安徽省农业科学院水稻研究所 | Gene and method for improving single-base editing efficiency of rice and application of gene |
CN110951743A (en) * | 2019-12-31 | 2020-04-03 | 北京市农林科学院 | Method for improving plant gene replacement efficiency |
CN110951743B (en) * | 2019-12-31 | 2021-08-10 | 北京市农林科学院 | Method for improving plant gene replacement efficiency |
CN111378051A (en) * | 2020-03-25 | 2020-07-07 | 北京市农林科学院 | PE-P2 guided editing system and application thereof in genome base editing |
CN111378051B (en) * | 2020-03-25 | 2022-03-01 | 北京市农林科学院 | PE-P2 guided editing system and application thereof in genome base editing |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN109679989A (en) | A method of improving base editing system editorial efficiency | |
AU2019283944B2 (en) | Methods for Nucleic Acid Assembly and High Throughput Sequencing | |
CN108531439B (en) | Escherichia coli genetic engineering bacterium and construction method and application thereof | |
CN110577965B (en) | Application of xCas9n-epBE base editing system in gene editing | |
CN111378679B (en) | Gene expression assembly, cloning vector constructed by same and application of cloning vector | |
KR20100085930A (en) | System for capturing and modifying large pieces of genomic dna and constructing organisms with synthetic chloroplasts | |
CN110951736B (en) | Nuclear localization signal F4NLS and application thereof in improving base editing efficiency and expanding editable base range | |
CN113430225A (en) | Vector for analyzing expression specificity of plant promoter, preparation method and application thereof | |
CN110982818B (en) | Application of nuclear localization signal F4NLS in efficient creation of rice herbicide resistant material | |
CN110951773B (en) | Application of FNLS-sABE system in creating rice herbicide resistant material | |
CN112280799B (en) | Method for site-directed mutagenesis of hevea brasiliensis or dandelion gene by using CRISPR/Cas9 system | |
CN110964742B (en) | Preparation method of herbicide-resistant rice | |
CN112375781B (en) | Application of pC1300-MAS-Cas9 gene editing system in 84K poplar gene editing | |
CN113462697B (en) | Degradable glyphosate-resistant gene, plant expression vector, cultivation method of degradable glyphosate-resistant transgenic rice and application | |
CN111621513A (en) | RNAi plant expression vector for inhibiting cytochrome P450 by using rice endogenous sequence and application thereof | |
CN101892259B (en) | SiRNA plant gene expression vector and construction method and application thereof | |
CN109666693B (en) | Application of MG132 in editing receptor genome by base editing system | |
CN109666694B (en) | Application of SCR7 in editing receptor genome by base editing system | |
CN109266673A (en) | A kind of coli expression carrier pBMcopA and its application | |
CN110268064A (en) | Targeting recombination between homologue and application thereof | |
CN109265562B (en) | Nicking enzyme and application thereof in genome base replacement | |
CN111961126B (en) | Application of TaVQ25 gene in regulation and control of resistance of wheat to powdery mildew and banded sclerotial blight | |
CN107988226A (en) | A kind of identification and application of the special High-expression promoter of Rice Callus | |
CN103173488B (en) | Method for quickly screening paddy transgenes by novel fusion tag | |
CN112538477A (en) | Application of xCas9 gene editing system in genome editing |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190426 |