CN112725348B - Gene and method for improving single-base editing efficiency of rice and application of gene - Google Patents

Abstract

The invention provides a gene and a method for improving the base editing efficiency of rice and application thereof. The invention synthesizes a co-transcription unit ABEHPT of a coding gene HPT containing a hygromycin-resistant protein, a coding gene SpCas9n containing a SpCas9 protein and an adenine deaminase coding gene ABE, and also provides an expression vector containing the ABEHPT and application of the expression vector in single-base editing of rice genes. After the expression vector is introduced into a plant body, the ABE base editor and the hygromycin gene can be transcribed and translated simultaneously, and the expression quantity of the ABE base editor in plant cells is improved through hygromycin screening, so that the ABE base editing efficiency in the plant cells is improved. Experiments prove that the ABEHPT gene designed by the invention is used for constructing a plant expression vector and further constructing a rice targeting vector, the fixed-point replacement efficiency of mutation of A: T to G: C on DNA of a rice specific gene locus is greatly improved after the ABEHPT gene is introduced into a rice cell, and the ABEHPT gene has important application value in the aspect of efficiently obtaining single base replaced plants.

Description

Gene and method for improving single-base editing efficiency of rice and application of gene

Technical Field

The present invention relates to biotechnology and plant genetic engineering technology. Specifically, the invention relates to a gene for improving single base editing efficiency of rice, a method and application thereof.

Background

Gene editing technology is one of the subversive technologies that have made breakthrough progress in recent years. The CRISPR/Cas9 gene editing system is simple, convenient and efficient, and is widely applied to gene function research and utilization. Although CRISPR/Cas9 can target a gene of interest with high efficiency, its site-directed modification relies on an inefficient homologous recombination mechanism, and thus the ability to accurately edit a gene is to be improved. The single base editing technique (base editor, BE) forms a fusion protein by Cas9 nickase (Cas9 nikase, Cas9n) or nuclease-free Cas9 (nuclear de Cas9, dCas9) and cytosine deaminase, and targets the fusion protein to a target site by sgRNA (single-stranded guide RNA), and performs precise editing of cytosine C → thymine T or guanine G → adenine a on a single base of the target gene site without cutting double-stranded DNA. Existing editors can be classified into Cytosine Base Editors (CBEs) mediating the site-directed replacement of C: G into T: A, and Adenine Base Editors (ABEs) mediating the site-directed replacement of A: T into G: C. The most common CBE and ABE systems at present are the BE3 and ABE7.10 systems, respectively.

A number of plant Genome Wide Association (GWAS) analysis studies have shown that many important agronomic traits are closely related to single base variation. Therefore, the single-base editing technology has carried out high-efficiency gene site-directed mutagenesis in plant, animal and human cells, and has wide application prospect in agriculture, biomedical research and even gene therapy. At present, the system still has certain defects, such as low alkali group editing efficiency in plants. At present, the optimization work of a plant base editing system is less developed, and the improvement of the base editing efficiency is limited.

Disclosure of Invention

The traditional plant gene base editing system is to introduce the editing system into plant cells by means of transient or stable genetic transformation. In stable genetic transformation, the anti-screener genes used are all constitutively expressed, and the base editor genes are likewise constitutively expressed, but both have their own expression cassette. This is likely to occur: in the screening process, the expression level of the base editor in the cell strongly expressing the anti-screening agent gene is not high.

The invention aims to improve ABE base editing efficiency by increasing the protein level of an ABE editor in a plant body in view of the fact that the insufficient expression of the base editor is probably one of the factors causing the insufficient gene editing efficiency aiming at the outstanding problem of low ABE base editing efficiency of the adenine base editor with site-specific substitution of A: T into G: C in the plant.

Specifically, the invention provides a co-transcription unit gene ABEHPT for improving single-base editing efficiency of rice, which is characterized in that the co-transcription unit gene ABEHPT comprises a hygromycin protein-resistant encoding gene HPT, a SpCas9 protein encoding gene SpCas9n and an adenine deaminase encoding gene ABE, wherein the co-transcription unit gene ABEHPT and the sgRNA encoding gene are constructed in the same expression vector.

Preferably, each gene fragment of the co-transcriptional unit gene ABEHPT is inserted into the same expression frame, and the sequence of the co-transcriptional unit gene ABEHPT after being connected with the sgRNA coding gene at least comprises:

(a) a nucleotide sequence shown in SEQ ID No.1 in a sequence table; or

(b) A nucleotide sequence which is capable of replacing one or more nucleotides in the nucleotide sequence shown in SEQ ID No.1 in the sequence table and performing rice genome shearing; or

(c) A nucleotide sequence which is obtained by adding one or more nucleotides into the nucleotide sequence shown in SEQ ID No.1 in the sequence table and can perform rice genome shearing; or

(d) A nucleotide sequence which is obtained by deleting one or more nucleotides from the nucleotide sequence shown in SEQ ID No.1 in the sequence table and can perform rice genome shearing.

Preferably, the coding gene ABE of adenine deaminase in the co-transcription unit gene ABEHPT is positioned at the 5' end of the coding gene SpCas9n of SpCas9 protein; the encoding gene HPT of the hygromycin-resistant protein is positioned at the 3' end of the encoding gene SpCas9n of the SpCas9 protein and is connected with self-cleavage polypeptide 2A (self-cleavage 2A peptide,2A) by a 3X nuclear localization signal NLS; the 3X nuclear localization signal NLS is at the 3' end of SpCas9 n.

In another aspect, the present invention provides a method for improving single base editing efficiency of rice, wherein the method comprises introducing a gene encoding sgRNA, a gene encoding hygromycin-resistant protein HPT, a gene encoding SpCas9n of SpCas9 protein, and a gene encoding adenine deaminase ABE into a receptor, and expressing the sgRNA, the hygromycin-resistant protein, the SpCas9 protein, and the adenine deaminase in the receptor, thereby performing base editing on a target gene in the receptor genome.

Preferably, the method comprises the steps of synthesizing a gene sequence ABEHPT containing the encoding gene HPT of the hygromycin-resistant protein, the encoding gene SpCas9n of the SpCas9 protein and the encoding gene ABE of adenine deaminase, adding NotI/SacI enzyme cutting sites at two ends, utilizing NotI/SacI enzyme cutting of the plant expression vector pHUN900 vector and recycling, connecting the gene sequence ABEHPT to the expression vector, utilizing the enzyme cutting sites to cut off a promoter on the vector and the gene sequence ABEHPT, connecting the promoter and the gene sequence ABEHPT to a plant expression vector which does not contain the selection marker gene HPT, synthesizing a sgRNA expression frame containing the HindIII enzyme cutting sites, introducing the sgRNA expression frame into the plant expression vector, and then introducing the plant expression vector into a receptor.

Preferably, the gene encoding hygromycin protein HPT, the gene encoding Cas9 protein SpCas9n and the adenine deaminase encoding gene ABE use the same constitutive promoter Ubiqutin and the same 35S terminator.

Preferably, the sgRNA expression cassette comprises: the rice gene expression vector comprises a rice OsU3 promoter, a spectinomycin resistance gene SpR, an artificially synthesized sgRNA framework sequence and a Poly-T terminator, wherein the nucleotide sequence of the rice OsU3 promoter is shown as Seq ID No.2 from 1 st to 382 th positions, the nucleotide sequence of the spectinomycin resistance gene SpR is shown as Seq ID No.2 from 388 th to 1595 th positions, the nucleotide sequence of the artificially synthesized sgRNA framework sequence is shown as Seq ID No.2 from 1603 th to 1688 th positions, and the nucleotide sequence of the Poly-T terminator is shown as Seq ID No.1 from 1689 th to 1696 th positions.

A plant expression vector comprising a co-transcriptional unit gene, ABEHPT, of claim 1 and a sgRNA expression cassette comprising: the rice gene expression vector comprises a rice OsU3 promoter, a spectinomycin resistance gene SpR, an artificially synthesized sgRNA framework sequence and a Poly-T terminator, wherein the nucleotide sequence of the rice OsU3 promoter is shown as Seq ID No.2 from 1 st to 382 th positions, the nucleotide sequence of the spectinomycin resistance gene SpR is shown as Seq ID No.2 from 388 th to 1595 th positions, the nucleotide sequence of the artificially synthesized sgRNA framework sequence is shown as Seq ID No.2 from 1603 th to 1688 th positions, and the nucleotide sequence of the Poly-T terminator is shown as Seq ID No.1 from 1689 th to 1696 th positions.

Preferably, said use comprises introducing said co-transcriptional unit gene ABEHPT into plant callus.

Preferably, the application comprises the steps of infecting, co-culturing and screening to obtain edited plant callus, then differentiating the callus into a plant, and improving the fixed point replacement efficiency of mutation from A: T to G: C on a rice genome by using the ABEHPT with high editing efficiency to obtain a transgenic plant or a plant part containing a mutation site.

The method enables sgRNA, hygromycin-resistant protein, Cas9 protein and adenine deaminase to be expressed in a receptor, so that base editing is carried out on a target gene in a receptor genome.

The invention introduces the encoding gene HPT of the hygromycin-resistant protein, the encoding gene SpCas9n of the SpCas9 protein and the adenine deaminase encoding gene ABE into a receptor through a plant expression vector.

In one implementation, the gene encoding hygromycin protein, HPT, the gene encoding Cas9 protein, SpCas9n, and the adenine deaminase encoding gene, ABE, use the same constitutive promoter, Ubiqutin, and the same 35S terminator, such that they form a co-transcriptional unit, designated ABEHPT (ABE-SpCas9 n-HPT).

Preferably, the ABEHPT co-transcription unit gene with high editing efficiency is composed of a nucleotide sequence shown as SEQ ID NO.1 in a sequence table. Wherein the adenine deaminase coding gene ABE is formed by translating a nucleotide sequence shown in the 1 st to 1191 th positions from the 5 'tail end of a sequence 1 in a sequence table, and the SpCas9 protein is formed by translating a nucleotide sequence shown in the 4102 th to 5292 th positions from the 5' tail end of the sequence 1 in the sequence table; the 3X Nuclear Localization Signal (NLS) is formed by translating a nucleotide sequence shown in 5293 th to 5391 th positions from the 5' tail end of a sequence 1 in a sequence table; the hygromycin-resistant protein is formed by translating a nucleotide sequence shown in positions 5446 to 6471 from the 5 'end of a sequence 1 in a sequence table, is connected by self-cleavage polypeptide 2A (2A), and is formed by translating a nucleotide sequence shown in positions 5392 to 5445 from the 5' end of the sequence 1 in the sequence table.

Preferably, the expression vector does not contain the HPT gene on the backbone.

In another aspect, the invention provides an expression vector, wherein the expression vector backbone comprises a sgRNA expression cassette, and the nucleotide sequence of the sgRNA expression cassette is shown in SEQ ID No. 2.

In the method, the receptor may be a plant callus.

In the method, the 'introduced plant callus' can be subjected to infection, co-culture and screening steps to obtain edited plant callus, and the callus is differentiated to form a plant. Wherein hygromycin is used as the screening agent during the screening and differentiation steps.

The method for constructing the plant expression vector containing the ABEHPT gene comprises the following steps: the synthesized ABEHPT gene sequence is added with NotI/SacI enzyme cutting sites at both ends. The plant expression vector pHUN900 vector is cut by NotI/SacI enzyme and recovered, and the synthesized ABEHPT sequence has NotI/SacI enzyme cutting sites at two ends, so that the ABEHPT can be connected to the pHUN900 vector by using T4 ligase to obtain the plant expression vector pHUN 400-ABEHPT. Then, the Ubiqitin promoter and the ABEHPT sequence on the vector are cut off by using HindIII/SacI enzyme cutting sites and are connected into a plant expression vector pNNC900 vector without a screening marker gene HPT. The vector is derived from pCAMBIA1300, the basic skeleton of the pCAMBIA1300 vector is reserved, but the vector does not contain a hygromycin gene HPT expression frame of a 35S promoter, a hygromycin gene HPT and a 35S terminator, and finally the plant expression vector pHUC400-ABEHPT is obtained. Synthesizing a sgRNA expression frame with HindIII enzyme cutting sites at two ends, and utilizing HindIII enzyme cutting to connect the sgRNA expression frame into a pHUC400-ABEHPT vector to finally obtain a plant expression vector pHUC411-ABEHPTsg2.0 with both an ABEHPT co-transcription unit and a sgRNA expression frame, wherein the nucleotide sequence of the plant expression vector is shown in SEQ ID NO. 5. .

Preferably, the application comprises constructing the corresponding gene targeting vector according to the actual needs of the experiment.

A method for introducing a targeting vector into rice cells, comprising the steps of:

(1) removing the hull of the rice seed, sterilizing, separating the embryo, and placing on a callus induction culture medium to generate secondary callus;

(2) transferring the secondary callus to a new callus induction culture medium for pre-culture;

(3) contacting the callus obtained in the step (2) with agrobacterium targeting vector for 15 minutes;

(4) transferring the callus tissue of the step (3) to a culture dish on which three pieces of sterile filter paper (added with 2.5-3.5mL of agrobacterium suspension culture medium) are placed, and culturing for 48 hours at 21-23 ℃;

(5) placing the callus of the step (4) on a pre-screening culture medium for culturing for 5-7 days;

(6) transferring the callus tissue of the step (5) to a screening culture medium to obtain resistant callus tissue;

(7) transferring the resistant callus to a differentiation regeneration culture medium to differentiate into seedlings; and

(8) and (4) transferring the seedling in the step (7) to a rooting culture medium for rooting.

Wherein the seed in step (1) is a mature seed; the induction culture medium in the steps (1) and (2) is the induction culture medium listed in the description table 1; the agrobacterium is contacted in the step (3) by soaking the callus in the agrobacterium suspension; the agrobacterium suspension culture medium in the step (4) is a suspension culture medium listed in the description table 1; the pre-screening medium in the step (5) is a pre-screening medium listed in the description table 1; the screening medium in the step (6) is a screening medium listed in the description table 1; the differentiation regeneration culture medium in the step (7) is a differentiation regeneration culture medium listed in the description table 1; the rooting medium in the step (8) is the rooting medium listed in the description table 1.

In a preferred embodiment, wherein the rice is japonica rice, more preferably, the rice is japonica Nipponbare.

Table 1 exemplary formulations of the culture media

The "optimized N6 majors" mentioned in the table means that [ NO ] in the N6 majors₃-]/[NH₄+]＝40mM/10mM。

Technical effects

The encoding gene HPT of the hygromycin-resistant protein and the ABE editor gene mediated by the SpCas9 protein are placed in the same expression frame, and after an expression vector containing the expression frame is introduced into a plant cell, the encoding gene HPT and the ABE editor mediated by the SpCas9 protein are transcribed into RNA and translated into protein simultaneously, and the protein amounts of the encoding gene HPT and the ABE editor are approximately the same. And the hygromycin protein and the SpCas9 protein-mediated ABE editor are separated and function respectively through the self-cleavage effect of T2A.

During the introduction process, by using hygromycin as a screening agent, plant cells with high hygromycin expression can grow rapidly, and the SpCas9 protein-mediated ABE editor can also be expressed in high quantity, so that more efficient target editing can be generated.

Drawings

FIG. 1 is a schematic diagram of pHUC411-ABEHPTsg2.0 vector plasmid.

Detailed Description

Embodiments of the present invention are described below with reference to the drawings. It should be noted that the following embodiments are only used for illustrating exemplary implementations of the present invention, and do not limit the present invention in any way. Certain equivalent modifications and obvious improvements to this invention may be made by those skilled in the art.

The operations in the following detailed description are performed by conventional operations commonly used in the art, unless otherwise specifically indicated. The skilled person can readily derive from the prior art teachings regarding such routine procedures, for example, reference may be made to the textbooks Sambrook and David Russell, Molecular Cloning: A Laboratory Manual,3rd ed., Vols1, 2; charles neural Stewart, Alisher Touraev, Vitaly Citovsky and Tzvi Tzfira, Plant Transformation Technologies, and the like. The raw materials, reagents, materials and the like used in the following examples are all commercially available products unless otherwise specified.

Example 1 pHUC411-ABEHPTsg2.0 vector construction

The sequence of the co-transcription unit ABEHPT is shown as SEQ ID NO. 1. The gene sequence is sent to Suzhou Jinwei Zhi Biotechnology limited company for synthesis, then is connected to a PUC57-AMP vector, and both ends of the gene sequence are provided with NotI/SacI enzyme cutting sites to form a PUC57-AMP-ABEHPT vector which is loaded into an escherichia coli XL-blue strain.

Extracting plasmids from the Axygen plasmid extraction kit, carrying out enzyme digestion by NotI/SacI, and recovering an ABEHPT fragment. The plant expression vector pHUN900 vector (publicly used vector) is digested with NotI/SacI and recovered, and since NotI/SacI cleavage sites are added at both ends of the synthesized ABEHPT sequence, ABEHPT can be ligated to the pHUN900 vector using T4 ligase to obtain the plant expression vector pHUN 400-ABEHPT. Then, a Ubiqitin promoter and an ABEHPT sequence on the vector are cut off by using HindIII/SacI enzyme cutting sites and are connected into a plant expression vector pNNC900 vector which does not contain a screening marker gene HPT, so that a plant expression vector pHUC400-ABEHPT is obtained.

An artificially synthesized sgRNA expression cassette comprising: a rice OsU3 promoter, a spectinomycin resistance gene SpR, a sgRNA framework sequence and a Poly-T terminator. The spectinomycin resistance gene SpR contains BsaI endonuclease at both ends. The gene sequence is synthesized by Suzhou Jinwei Zhi Biotechnology Co., Ltd, and then is connected to a PUC57-AMP vector, two ends of which are provided with HindIII enzyme cutting sites to form a PUC57-AMP-sgRNA vector, and the vector is loaded into an escherichia coli XL-blue strain.

Extracting plasmids from an Axygen plasmid extraction kit, carrying out enzyme digestion by HindIII, recovering sgRNA expression frame fragments, simultaneously carrying out enzyme digestion on a plant expression vector pHUC400-ABEHPT vector by HindIII and recovering, and connecting the sgRNA expression frame fragments to the pHUC400-ABEHPT vector by using T4 ligase to obtain a plant expression vector pHUC411-ABEHPTsg2.0, wherein a vector diagram is shown in figure 1.

Example 2 base editing target Gene vector construction

Selection of the nucleotide sequence in the Rice Pi-d3 Gene (Os06g0330100)CCCGTCTTGGGATCTAGGCAGAC (the underlined part is the PAM sequence reverse complement of the 5 'NGG-3' structure) as the targeting site. Synthesizing a forward oligonucleotide chain (Pi-d 3P 1) and a complementary reverse oligonucleotide chain (Pi-d 3P 2) according to the selected target site,

the specific sequence is as follows:

Pi-d3 P1:GGCAGTCTGCCTAGATCCCAAGAC

Pi-d3 P2:AAACGTCTTGGGATCTAGGCAGAC

wherein the part not underlined is the sequence or the complementary sequence of the target site from which NGG has been removed, and the underlined is the cohesive end for ligation to the vector.

After annealing, both strands of Pi-d 3P 1 and Pi-d 3P 2 were annealed to form duplex DNA with sticky ends as an insert for constructing a recombinant vector.

The pHUC411-ABEHPTsg2.0 vector was digested with BsaI endonuclease (NEB) at 37 ℃ for 2 hours, and the digestion system was inactivated at 65 ℃ for 10 minutes, to serve as a backbone fragment for constructing a recombinant vector.

The recombinant vector backbone fragment and the insert fragment were ligated with T4 ligase (NEB) and transformed into E.coli. Positive transformants were obtained by selecting plaques with kanamycin resistance and no spectinomycin resistance. After sequencing verification, positive plasmids are extracted to form a recombinant vector plasmid for targeting rice Pi-d3 gene CRISPR/Cas9, and the recombinant vector plasmid is named as pHUC411-ABEHPT-Pi-d 3.

The plant expression vector pHUC411-ABEHPT-Pi-d3 is transferred into an Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 strain (stored by the Rice research institute of agricultural sciences, Anhui province) by a freeze-thaw method for genetic transformation.

Similarly, a control expression vector pHUC411-ABE-Pi-d3 was constructed in a similar manner, using the same targeting site as pHUC411-ABEHPT-Pi-d 3. The pHUC411-ABE vector and the pHUC411-ABEHPT-sg2.0 have the same framework, except that nSpCas9 in the pHUC411-ABE vector and an ABE base editor are fused to express protein, a promoter is an Ubiqutin promoter, and a terminator is a 35S terminator; the promoter of the encoding gene HPT of the hygromycin-resistant protein is enhanced 35S promoter, and the terminator is 35S terminator. Therefore, the nspscas 9 and the ABE base editor fusion expression protein, the encoding gene HPT of the hygromycin-resistant protein, are located in two expression cassettes. The expression cassette of pHUC411-ABE vector and pHUC411-ABEHPTsg2.0 sgRNA are consistent. The control vector was transformed into Agrobacterium tumefaciens EHA105 strain for genetic transformation.

Example 3 genetic transformation of Rice with the pHUC411-ABEHPT-Pi-d3 and pHUC411-ABE-Pi-d3 targeting vectors and mutant acquisition, the subsequent steps were performed for both targeting vectors separately and will not be repeated.

1. Induction and preculture of mature embryo calli

Removing shells of mature seeds of Nipponbare, selecting seeds with normal appearance, cleanness and no mildew stains, shaking for 90sec with 70% alcohol, and pouring off the alcohol; then 50% sodium hypochlorite solution containing Tween20 (the effective chlorine concentration of the stock solution is more than 4%, 1 drop of Tween20 is added per 100 ml) is used for cleaning the seeds, and the seeds are shaken on a shaking table for 45min (180 r/min). Pouring out sodium hypochlorite, washing with sterile water for 5-10 times until no smell of sodium hypochlorite exists, adding sterile water, and soaking at 30 deg.C overnight. Embryos were separated along the aleurone layer with scalpel blade, scutellum up placed on induction medium (see table 1 for ingredients), 12 grains/dish, dark cultured at 30 ℃ to induce callus.

Spherical, rough and light yellow secondary callus appears after two weeks, and the preculture operation can be carried out, that is, the secondary callus is transferred to a new callus induction culture medium and precultured for 5 days at 30 ℃ in dark. After the pre-culture is finished, collecting the small particles with good state and vigorous division into a 50mL sterile centrifuge tube by using a spoon for agrobacterium infection.

2. Culture and suspension preparation of Agrobacterium strains

Agrobacterium strain EHA105 containing the pHUC411-ABEHPT-Pi-d3 and pHUC411-ABE-Pi-d3 vectors was streaked on LB plate containing 50mg/L kanamycin (see Table 1 for components), dark-cultured at 28 ℃ for 24 hours, and then the activated Agrobacterium was inoculated on a fresh LB plate containing 50mg/L kanamycin using a sterile inoculating loop, followed by secondary activation and dark-culture at 28 ℃ overnight. 20-30mL of Agrobacterium suspension medium (see Table 1 for ingredients) was added to a 50mL sterile centrifuge tube, the Agrobacterium activated 2 times was scraped off with an inoculating loop, OD660 was adjusted to about 0.10-0.25, and the tube was allowed to stand at room temperature for more than 30 min.

3. Infection and Co-cultivation

To the prepared callus (see step 1), the Agrobacterium suspension was added and soaked for 15min with occasional gentle shaking. After soaking, pouring off the liquid (dripping the liquid as far as possible), sucking the redundant agrobacterium liquid on the surface of the callus by using sterile filter paper, and drying the callus by using sterile wind in a super clean bench. Three pieces of sterile filter paper are placed on a disposable sterile culture dish pad with the diameter of 100 multiplied by 25mm, 2.5mL of agrobacterium suspension culture medium is added, the callus after being sucked dry is evenly dispersed on the filter paper, and the mixture is cultured in the dark for 48h at the temperature of 23 ℃.

4. Pre-screening and screening cultures

After the completion of co-culture, the co-cultured calli were uniformly spread on a pre-screening medium (see Table 1 for components), and cultured in the dark at 30 ℃ for 5 days. After the pre-screening culture is finished, transferring the callus onto a screening culture medium (the components are shown in table 1), inoculating 25 calli to each culture dish, culturing in the dark at the temperature of 30 ℃, and after 2-3 weeks, obviously growing the resistant calli and carrying out differentiation and regeneration operation.

5. Differentiation and regeneration

2-3 fresh small particles with good growth state were selected from each independent transformant and transferred to differentiation regeneration medium (see table 1 for composition). Each culture dish was inoculated with 5 independent transformants. Culturing at 28 ℃ under illumination, wherein the illumination period is 16h, the illumination period is 8h, and the light intensity is 3000-6000 lx.

6. Rooting and transplanting

When the bud differentiated from the resistant callus grows to about 2cm, only one well-grown seedling is taken from each independent transformant and transferred to a rooting medium (the components are shown in the table 1), the seedling is cultured by illumination at 28 ℃, the illumination period is 16h, the illumination period is 8h, the darkness is 8h, and the light intensity is 3000-. After two weeks, seedlings with developed root systems are selected, washed with water to remove the culture medium, and transplanted into soil.

7. Molecular identification

Before transplanting, a rice leaf sample is taken, and DNA is subjected to small extraction by a CTAB method. The resulting genomic DNA samples were used for PCR analysis. PCR primers 5'-CACCTTTGCGTATCTGCTCCAT-3' and 5'-CTTCAGGTTTGGACAGAGCAGG-3' were designed to amplify a sequence of approximately 580bp near the Pi-d3 target. The PCR components were first kept at 95 ℃ for 5 minutes and then subjected to 32 cycles: 94 ℃ for 45 seconds, 56 ℃ for 45 seconds, 72 ℃ for 45 seconds, and finally extension at 72 ℃ for 10 minutes. The PCR product was sequenced. The results were aligned to the wild type sequence.

Of the plants obtained from pHUC411-ABEHPT-Pi-d3, 21 of the 40 plants tested appeared in the target sequence

The T at the 9 th position in the middle is mutated into C, the single base mutation efficiency reaches 52.5 percent, and other mutation modes are not found. Similarly, in the plants obtained from pHUC411-ABE-Pi-d3, 12 target sequences in 40 tested plants showed base variation, and the mutation rate was only 30%. But T₉The clean mutant plants like the mutant C have only 4 plants, the mutation rate is only 10 percent, and the rest mutant forms are inserted or deleted unnecessary bases. Therefore, pHUC411-ABEHPTsg2.0 can obtain higher single base mutation rate.

Sequence listing

<110> institute of Paddy Rice of agricultural science institute of Anhui province

<120> gene for improving single-base editing efficiency of rice, method and application

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 6471

<212> DNA

<213> man made

<400> 1

atgagcgaag tggagttctc ccatgagtac tggatgaggc atgccctcac cctggccaag 60

agggcctggg atgagaggga agtcccagtg ggcgccgtgc tcgtgcacaa caacagggtg 120

attggcgaag gttggaatcg cccgattggc aggcacgatc caaccgccca cgcggaaatt 180

atggccctcc gccagggtgg cttagttatg caaaactacc gcctcatcga tgcgacactg 240

tacgtgaccc tcgagccgtg cgtcatgtgt gcgggcgcca tgatccatag ccgcatcggg 300

agggtggtct ttggcgccag ggatgccaag acaggcgctg ctggcagcct catggacgtg 360

ctccatcatc cggggatgaa ccatagggtg gagatcaccg agggcatcct cgcggatgag 420

tgtgcggccc tcctcagcga tttcttcagg atgcgtcgtc aagagatcaa ggcccaaaag 480

aaggcgcagt cctccacaga tagcgggggc tcttctggtg gttcctccgg cagcgagaca 540

ccaggcacca gcgagtccgc gacaccagaa agcagcggtg gtagcagcgg tggtagctcc 600

gaggtggaat ttagccacga gtattggatg aggcacgcgc tcacactcgc caagagggcg 660

agggacgaga gggaagtgcc agtcggcgcg gtgctggtgc tgaacaaccg cgtgatcggc 720

gagggttgga atagggccat tggcctccac gacccgacag cccatgccga gattatggcc 780

ctcaggcagg gtggtctggt gatgcagaac tatcgcctca tcgacgccac cctctacgtc 840

acctttgagc catgcgtgat gtgcgccggc gccatgatcc actccaggat cggccgcgtc 900

gtcttcggcg tgaggaacgc caaaacaggc gccgcgggca gcctcatgga tgtgctccac 960

tacccgggga tgaatcacag ggtggaaatc accgaaggca ttctcgccga tgagtgcgct 1020

gctctgctgt gctacttctt taggatgccg aggcaggtgt ttaacgccca gaagaaggcg 1080

caatcctcca ccgatagcgg tggttcctcc gggggctcct ccggctccga aactccgggc 1140

acaagcgaaa gcgccacacc ggaatcctcc ggcgggtcct ccggtggttc cgacaagaag 1200

tactccatcg gcctcgctat cggcaccaat tctgttggct gggccgtgat caccgacgag 1260

tacaaggtgc cgtccaagaa gttcaaggtc ctcggcaaca ccgaccgcca ctccatcaag 1320

aagaatctca tcggcgccct gctgttcgac tctggcgaga cagccgaggc tacaaggctc 1380

aagaggaccg ctagacgcag gtacaccagg cgcaagaacc gcatctgcta cctccaagag 1440

atcttctcca acgagatggc caaggtggac gacagcttct tccacaggct cgaggagagc 1500

ttcctcgtcg aggaggacaa gaagcacgag cgccatccga tcttcggcaa catcgtggat 1560

gaggtggcct accacgagaa gtacccgacc atctaccacc tccgcaagaa gctcgtcgac 1620

tccaccgata aggccgacct caggctcatc tacctcgccc tcgcccacat gatcaagttc 1680

aggggccact tcctcatcga gggcgacctc aacccggaca actccgatgt ggacaagctg 1740

ttcatccagc tcgtgcagac ctacaaccag ctgttcgagg agaacccgat caacgcctct 1800

ggcgttgacg ccaaggctat tctctctgcc aggctctcta agtcccgcag gctcgagaat 1860

ctgatcgccc aacttccggg cgagaagaag aatggcctct tcggcaacct gatcgccctc 1920

tctcttggcc tcaccccgaa cttcaagtcc aacttcgacc tcgccgagga cgccaagctc 1980

cagctttcca aggacaccta cgacgacgac ctcgacaatc tcctcgccca gattggcgat 2040

cagtacgccg atctgttcct cgccgccaag aatctctccg acgccatcct cctcagcgac 2100

atcctcaggg tgaacaccga gatcaccaag gccccactct ccgcctccat gatcaagagg 2160

tacgacgagc accaccagga cctcacactc ctcaaggccc tcgtgagaca gcagctccca 2220

gagaagtaca aggagatctt cttcgaccag tccaagaacg gctacgccgg ctacatcgat 2280

ggcggcgctt ctcaagagga gttctacaag ttcatcaagc cgatcctcga gaagatggac 2340

ggcaccgagg agctgctcgt gaagctcaat agagaggacc tcctccgcaa gcagcgcacc 2400

ttcgataatg gctccatccc gcaccagatc cacctcggcg agcttcatgc tatcctccgc 2460

aggcaagagg acttctaccc gttcctcaag gacaaccgcg agaagattga gaagatcctc 2520

accttccgca tcccgtacta cgtgggcccg ctcgccaggg gcaactccag gttcgcctgg 2580

atgaccagaa agtccgagga gacaatcacc ccctggaact tcgaggaggt ggtggataag 2640

ggcgcctctg cccagtcttt catcgagcgc atgaccaact tcgacaagaa cctcccgaac 2700

gagaaggtgc tcccgaagca ctcactcctc tacgagtact tcaccgtgta caacgagctg 2760

accaaggtga agtacgtgac cgaggggatg aggaagccag ctttccttag cggcgagcaa 2820

aagaaggcca tcgtcgacct gctgttcaag accaaccgca aggtgaccgt gaagcagctc 2880

aaggaggact acttcaagaa aatcgagtgc ttcgactccg tcgagatctc cggcgtcgag 2940

gataggttca atgcctccct cgggacctac cacgacctcc tcaagattat caaggacaag 3000

gacttcctcg acaacgagga gaacgaggac atcctcgagg acatcgtgct caccctcacc 3060

ctcttcgagg accgcgagat gatcgaggag cgcctcaaga catacgccca cctcttcgac 3120

gacaaggtga tgaagcagct gaagcgcagg cgctataccg gctggggcag gctctctagg 3180

aagctcatca acggcatccg cgacaagcag tccggcaaga cgatcctcga cttcctcaag 3240

tccgacggct tcgccaaccg caacttcatg cagctcatcc acgacgactc cctcaccttc 3300

aaggaggaca tccaaaaggc ccaggtgtcc ggccaaggcg attccctcca tgaacatatc 3360

gccaatctcg ccggctcccc ggctatcaag aagggcattc tccagaccgt gaaggtggtg 3420

gacgagctgg tgaaggtgat gggcaggcac aagccagaga acatcgtgat cgagatggcc 3480

cgcgagaacc agaccacaca gaagggccaa aagaactccc gcgagcgcat gaagaggatc 3540

gaggagggca ttaaggagct gggctcccag atcctcaagg agcacccagt cgagaacacc 3600

cagctccaga acgagaagct ctacctctac tacctccaga acggccgcga catgtacgtg 3660

gaccaagagc tggacatcaa ccgcctctcc gactacgacg tggaccatat tgtgccgcag 3720

tccttcctga aggacgactc catcgacaac aaggtgctca cccgctccga caagaacagg 3780

ggcaagtccg ataacgtgcc gtccgaagag gtcgtcaaga agatgaagaa ctactggcgc 3840

cagctcctca acgccaagct catcacccag aggaagttcg acaacctcac caaggccgag 3900

agaggcggcc tttccgagct tgataaggcc ggcttcatca agcgccagct cgtcgagaca 3960

cgccagatca caaagcacgt ggcccagatc ctcgactccc gcatgaacac caagtacgac 4020

gagaacgaca agctcatccg cgaggtgaag gtcatcaccc tcaagtccaa gctcgtgtcc 4080

gacttccgca aggacttcca gttctacaag gtgcgcgaga tcaacaacta ccaccacgcc 4140

cacgacgcct acctcaatgc cgtggtgggc acagccctca tcaagaagta cccaaagctc 4200

gagtccgagt tcgtgtacgg cgactacaag gtgtacgacg tgcgcaagat gatcgccaag 4260

tccgagcaag agatcggcaa ggcgaccgcc aagtacttct tctactccaa catcatgaat 4320

ttcttcaaga ccgagatcac gctcgccaac ggcgagatta ggaagaggcc gctcatcgag 4380

acaaacggcg agacaggcga gatcgtgtgg gacaagggca gggatttcgc cacagtgcgc 4440

aaggtgctct ccatgccgca agtgaacatc gtgaagaaga ccgaggttca gaccggcggc 4500

ttctccaagg agtccatcct cccaaagcgc aactccgaca agctgatcgc ccgcaagaag 4560

gactgggacc cgaagaagta tggcggcttc gattctccga ccgtggccta ctctgtgctc 4620

gtggttgcca aggtcgagaa gggcaagagc aagaagctca agtccgtcaa ggagctgctg 4680

ggcatcacga tcatggagcg cagcagcttc gagaagaacc caatcgactt cctcgaggcc 4740

aagggctaca aggaggtgaa gaaggacctc atcatcaagc tcccgaagta cagcctcttc 4800

gagcttgaga acggccgcaa gagaatgctc gcctctgctg gcgagcttca gaagggcaac 4860

gagcttgctc tcccgtccaa gtacgtgaac ttcctctacc tcgcctccca ctacgagaag 4920

ctcaagggct ccccagagga caacgagcaa aagcagctgt tcgtcgagca gcacaagcac 4980

tacctcgacg agatcatcga gcagatctcc gagttctcca agcgcgtgat cctcgccgat 5040

gccaacctcg ataaggtgct cagcgcctac aacaagcacc gcgataagcc aattcgcgag 5100

caggccgaga acatcatcca cctcttcacc ctcaccaacc tcggcgctcc agccgccttc 5160

aagtacttcg acaccaccat cgaccgcaag cgctacacct ctaccaagga ggttctcgac 5220

gccaccctca tccaccagtc tatcacaggc ctctacgaga cacgcatcga cctctcacaa 5280

ctcggcggcg attccggcgg cagcccaaag aagaagcgga aggtgtctgg aggttctcct 5340

aagaaaaaga gaaaagtgtc cggcggctcc ccgaagaaga agcgcaaggt ggagggccgc 5400

ggctctttac tcacttgtgg cgacgtggag gaaaatccgg gcccgatgaa aaagcctgaa 5460

ctcaccgcga cgtctgtcga gaagtttctg atcgaaaagt tcgacagcgt ctccgacctg 5520

atgcagctct cggagggcga agaatctcgt gctttcagct tcgatgtagg agggcgtgga 5580

tatgtcctgc gggtaaatag ctgcgccgat ggtttctaca aagatcgtta tgtttatcgg 5640

cactttgcat cggccgcgct cccgattccg gaagtgcttg acattgggga gtttagcgag 5700

agcctgacct attgcatctc ccgccgtgca cagggtgtca cgttgcaaga cctgcctgaa 5760

accgaactgc ccgctgttct acaaccggtc gcggaggcta tggatgcgat cgctgcggcc 5820

gatcttagcc agacgagcgg gttcggccca ttcggaccgc aaggaatcgg tcaatacact 5880

acatggcgtg atttcatatg cgcgattgct gatccccatg tgtatcactg gcaaactgtg 5940

atggacgaca ccgtcagtgc gtccgtcgcg caggctctcg atgagctgat gctttgggcc 6000

gaggactgcc ccgaagtccg gcacctcgtg cacgcggatt tcggctccaa caatgtcctg 6060

acggacaatg gccgcataac agcggtcatt gactggagcg aggcgatgtt cggggattcc 6120

caatacgagg tcgccaacat cttcttctgg aggccgtggt tggcttgtat ggagcagcag 6180

acgcgctact tcgagcggag gcatccggag cttgcaggat cgccacgact ccgggcgtat 6240

atgctccgca ttggtcttga ccaactctat cagagcttgg ttgacggcaa tttcgatgat 6300

gcagcttggg cgcagggtcg atgcgacgca atcgtccgat ccggagccgg gactgtcggg 6360

cgtacacaaa tcgcccgcag aagcgcggcc gtctggaccg atggctgtgt agaagtactc 6420

gccgatagtg gaaaccgacg ccccagcact cgtccgaggg caaagaaata g 6471

<210> 2

<211> 1696

<212> DNA

<213> man made 2

<400> 2

aagggatctt taaacatacg aacagatcac ttaaagttct tctgaagcaa cttaaagtta 60

tcaggcatgc atggatcttg gaggaatcag atgtgcagtc agggaccata gcacaagaca 120

ggcgtcttct actggtgcta ccagcaaatg ctggaagccg ggaacactgg gtacgttgga 180

aaccacgtga tgtgaagaag taagataaac tgtaggagaa aagcatttcg tagtgggcca 240

tgaagccttt caggacatgt attgcagtat gggccggccc attacgcaat tggacgacaa 300

caaagactag tattagtacc acctcggcta tccacataga tcaaagctga tttaaaagag 360

ttgtgcagat gatccgtggc aagagaccaa cccagtggac ataagcctgt tcggttcgta 420

agctgtaatg caagtagcgt atgcgctcac gcaactggtc cagaaccttg accgaacgca 480

gcggtggtaa cggcgcagtg gcggttttca tggcttgtta tgactgtttt tttggggtac 540

agtctatgcc tcgggcatcc aagcagcaag cgcgttacgc cgtgggtcga tgtttgatgt 600

tatggagcag caacgatgtt acgcagcagg gcagtcgccc taaaacaaag ttaaacatca 660

tgggggaagc ggtgatcgcc gaagtatcga ctcaactatc agaggtagtt ggcgtcatcg 720

agcgccatct cgaaccgacg ttgctggccg tacatttgta cggctccgca gtggatggcg 780

gcctgaagcc acacagtgat attgatttgc tggttacggt gaccgtaagg cttgatgaaa 840

caacgcggcg agctttgatc aacgaccttt tggaaacttc ggcttcccct ggagagagcg 900

agattctccg cgctgtagaa gtcaccattg ttgtgcacga cgacatcatt ccgtggcgtt 960

atccagctaa gcgcgaactg caatttggag aatggcagcg caatgacatt cttgcaggta 1020

tcttcgagcc agccacgatc gacattgatc tggctatctt gctgacaaaa gcaagagaac 1080

atagcgttgc cttggtaggt ccagcggcgg aggaactctt tgatccggtt cctgaacagg 1140

atctatttga ggcgctaaat gaaaccttaa cgctatggaa ctcgccgccc gactgggctg 1200

gcgatgagcg aaatgtagtg cttacgttgt cccgcatttg gtacagcgca gtaaccggca 1260

aaatcgcgcc gaaggatgtc gctgccgact gggcaatgga gcgcctgccg gcccagtatc 1320

agcccgtcat acttgaagct agacaggctt atcttggaca agaagaagat cgcttggcct 1380

cgcgcgcaga tcagttggaa gaatttgtcc actacgtgaa aggcgagatc accaaggtag 1440

tcggcaaata atgtctagct agaaattcgt tcaagccgac gccgcttcgc ggcgcggctt 1500

aactcaagcg ttagatgcac taagcacata attgctcaca gccaaactat caggtcaagt 1560

ctgcttttat tatttttaag cgtgcataat aagccggtct cagtttcaga gctatgctgg 1620

aaacagcata gcaagttgaa ataaggctag tccgttatca acttgaaaaa gtggcaccga 1680

gtcggtgctt tttttt 1696

<210> 3

<211> 24

<212> DNA

<213> man made 3

<400> 3

ggcagtctgc ctagatccca agac 24

<210> 4

<211> 24

<212> DNA

<213> man made 4

<400> 4

aaacgtcttg ggatctaggc agac 24

<210> 5

<211> 19401

<212> DNA

<213> man made 5

<400> 5

taaacgctct tttctcttag gtttacccgc caatatatcc tgtcaaacac tgatagttta 60

aactgaaggc gggaaacgac aatctgatcc aagctcaagc tgctctagca ttcgccattc 120

aggctgcgca actgttggga agggcgatcg gtgcgggcct cttcgctatt acgccagctg 180

gcgaaagggg gatgtgctgc aaggcgatta agttgggtaa cgccagggtt ttcccagtca 240

cgacgttgta aaacgacggc cagtgccaag cttaagggat ctttaaacat acgaacagat 300

cacttaaagt tcttctgaag caacttaaag ttatcaggca tgcatggatc ttggaggaat 360

cagatgtgca gtcagggacc atagcacaag acaggcgtct tctactggtg ctaccagcaa 420

atgctggaag ccgggaacac tgggtacgtt ggaaaccacg tgatgtgaag aagtaagata 480

aactgtagga gaaaagcatt tcgtagtggg ccatgaagcc tttcaggaca tgtattgcag 540

tatgggccgg cccattacgc aattggacga caacaaagac tagtattagt accacctcgg 600

ctatccacat agatcaaagc tgatttaaaa gagttgtgca gatgatccgt ggcatgagac 660

caacccagtg gacataagcc tgttcggttc gtaagctgta atgcaagtag cgtatgcgct 720

cacgcaactg gtccagaacc ttgaccgaac gcagcggtgg taacggcgca gtggcggttt 780

tcatggcttg ttatgactgt ttttttgggg tacagtctat gcctcgggca tccaagcagc 840

aagcgcgtta cgccgtgggt cgatgtttga tgttatggag cagcaacgat gttacgcagc 900

agggcagtcg ccctaaaaca aagttaaaca tcatggggga agcggtgatc gccgaagtat 960

cgactcaact atcagaggta gttggcgtca tcgagcgcca tctcgaaccg acgttgctgg 1020

ccgtacattt gtacggctcc gcagtggatg gcggcctgaa gccacacagt gatattgatt 1080

tgctggttac ggtgaccgta aggcttgatg aaacaacgcg gcgagctttg atcaacgacc 1140

ttttggaaac ttcggcttcc cctggagaga gcgagattct ccgcgctgta gaagtcacca 1200

ttgttgtgca cgacgacatc attccgtggc gttatccagc taagcgcgaa ctgcaatttg 1260

gagaatggca gcgcaatgac attcttgcag gtatcttcga gccagccacg atcgacattg 1320

atctggctat cttgctgaca aaagcaagag aacatagcgt tgccttggta ggtccagcgg 1380

cggaggaact ctttgatccg gttcctgaac aggatctatt tgaggcgcta aatgaaacct 1440

taacgctatg gaactcgccg cccgactggg ctggcgatga gcgaaatgta gtgcttacgt 1500

tgtcccgcat ttggtacagc gcagtaaccg gcaaaatcgc gccgaaggat gtcgctgccg 1560

actgggcaat ggagcgcctg ccggcccagt atcagcccgt catacttgaa gctagacagg 1620

cttatcttgg acaagaagaa gatcgcttgg cctcgcgcgc agatcagttg gaagaatttg 1680

tccactacgt gaaaggcgag atcaccaagg tagtcggcaa ataatgtcta gctagaaatt 1740

cgttcaagcc gacgccgctt cgcggcgcgg cttaactcaa gcgttagatg cactaagcac 1800

ataattgctc acagccaaac tatcaggtca agtctgcttt tattattttt aagcgtgcat 1860

aataagccgg tctcagtttc agagctatgc tggaaacagc atagcaagtt gaaataaggc 1920

tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttttttta gtaaagcttg 1980

atatcgaatt cctgcagtgc agcgtgaccc ggtcgtgccc ctctctagag ataatgagca 2040

ttgcatgtct aagttataaa aaattaccac atattttttt tgtcacactt gtttgaagtg 2100

cagtttatct atctttatac atatatttaa actttactct acgaataata taatctatag 2160

tactacaata atatcagtgt tttagagaat catataaatg aacagttaga catggtctaa 2220

aggacaattg agtattttga caacaggact ctacagtttt atctttttag tgtgcatgtg 2280

ttctcctttt tttttgcaaa tagcttcacc tatataatac ttcatccatt ttattagtac 2340

atccatttag ggtttagggt taatggtttt tatagactaa tttttttagt acatctattt 2400

tattctattt tagcctctaa attaagaaaa ctaaaactct attttagttt ttttatttaa 2460

taatttagat ataaaataga ataaaataaa gtgactaaaa attaaacaaa taccctttaa 2520

gaaattaaaa aaactaagga aacatttttc ttgtttcgag tagataatgc cagcctgtta 2580

aacgccgtcg acgagtctaa cggacaccaa ccagcgaacc agcagcgtcg cgtcgggcca 2640

agcgaagcag acggcacggc atctctgtcg ctgcctctgg acccctctcg agagttccgc 2700

tccaccgttg gacttgctcc gctgtcggca tccagaaatg cgtggcggag cggcagacgt 2760

gagccggcac ggcaggcggc ctcctcctcc tctcacggca cggcagctac gggggattcc 2820

tttcccaccg ctccttcgct ttcccttcct cgcccgccgt aataaataga caccccctcc 2880

acaccctctt tccccaacct cgtgttgttc ggagcgcaca cacacacaac cagatctccc 2940

ccaaatccac ccgtcggcac ctccgcttca aggtacgccg ctcgtcctcc cccccccccc 3000

ctctctacct tctctagatc ggcgttccgg tccatggtta gggcccggta gttctacttc 3060

tgttcatgtt tgtgttagat ccgtgtttgt gttagatccg tgctgctagc gttcgtacac 3120

ggatgcgacc tgtacgtcag acacgttctg attgctaact tgccagtgtt tctctttggg 3180

gaatcctggg atggctctag ccgttccgca gacgggatcg atttcatgat tttttttgtt 3240

tcgttgcata gggtttggtt tgcccttttc ctttatttca atatatgccg tgcacttgtt 3300

tgtcgggtca tcttttcatg cttttttttg tcttggttgt gatgatgtgg tctggttggg 3360

cggtcgttct agatcggagt agaattctgt ttcaaactac ctggtggatt tattaatttt 3420

ggatctgtat gtgtgtgcca tacatattca tagttacgaa ttgaagatga tggatggaaa 3480

tatcgatcta ggataggtat acatgttgat gcgggtttta ctgatgcata tacagagatg 3540

ctttttgttc gcttggttgt gatgatgtgg tgtggttggg cggtcgttca ttcgttctag 3600

atcggagtag aatactgttt caaactacct ggtgtattta ttaattttgg aactgtatgt 3660

gtgtgtcata catcttcata gttacgagtt taagatggat ggaaatatcg atctaggata 3720

ggtatacatg ttgatgtggg ttttactgat gcatatacat gatggcatat gcagcatcta 3780

ttcatatgct ctaaccttga gtacctatct attataataa acaagtatgt tttataatta 3840

ttttgatctt gatatacttg gatgatggca tatgcagcag ctatatgtgg atttttttag 3900

ccctgccttc atacgctatt tatttgcttg gtactgtttc ttttgtcgat gctcaccctg 3960

ttgtttggtg ttacttctgc agcccggggg atccccaata cttgtatggc cgcggccgca 4020

tgagcgaagt ggagttctcc catgagtact ggatgaggca tgccctcacc ctggccaaga 4080

gggcctggga tgagagggaa gtcccagtgg gcgccgtgct cgtgcacaac aacagggtga 4140

ttggcgaagg ttggaatcgc ccgattggca ggcacgatcc aaccgcccac gcggaaatta 4200

tggccctccg ccagggtggc ttagttatgc aaaactaccg cctcatcgat gcgacactgt 4260

acgtgaccct cgagccgtgc gtcatgtgtg cgggcgccat gatccatagc cgcatcggga 4320

gggtggtctt tggcgccagg gatgccaaga caggcgctgc tggcagcctc atggacgtgc 4380

tccatcatcc ggggatgaac catagggtgg agatcaccga gggcatcctc gcggatgagt 4440

gtgcggccct cctcagcgat ttcttcagga tgcgtcgtca agagatcaag gcccaaaaga 4500

aggcgcagtc ctccacagat agcgggggct cttctggtgg ttcctccggc agcgagacac 4560

caggcaccag cgagtccgcg acaccagaaa gcagcggtgg tagcagcggt ggtagctccg 4620

aggtggaatt tagccacgag tattggatga ggcacgcgct cacactcgcc aagagggcga 4680

gggacgagag ggaagtgcca gtcggcgcgg tgctggtgct gaacaaccgc gtgatcggcg 4740

agggttggaa tagggccatt ggcctccacg acccgacagc ccatgccgag attatggccc 4800

tcaggcaggg tggtctggtg atgcagaact atcgcctcat cgacgccacc ctctacgtca 4860

cctttgagcc atgcgtgatg tgcgccggcg ccatgatcca ctccaggatc ggccgcgtcg 4920

tcttcggcgt gaggaacgcc aaaacaggcg ccgcgggcag cctcatggat gtgctccact 4980

acccggggat gaatcacagg gtggaaatca ccgaaggcat tctcgccgat gagtgcgctg 5040

ctctgctgtg ctacttcttt aggatgccga ggcaggtgtt taacgcccag aagaaggcgc 5100

aatcctccac cgatagcggt ggttcctccg ggggctcctc cggctccgaa actccgggca 5160

caagcgaaag cgccacaccg gaatcctccg gcgggtcctc cggtggttcc gacaagaagt 5220

actccatcgg cctcgctatc ggcaccaatt ctgttggctg ggccgtgatc accgacgagt 5280

acaaggtgcc gtccaagaag ttcaaggtcc tcggcaacac cgaccgccac tccatcaaga 5340

agaatctcat cggcgccctg ctgttcgact ctggcgagac agccgaggct acaaggctca 5400

agaggaccgc tagacgcagg tacaccaggc gcaagaaccg catctgctac ctccaagaga 5460

tcttctccaa cgagatggcc aaggtggacg acagcttctt ccacaggctc gaggagagct 5520

tcctcgtcga ggaggacaag aagcacgagc gccatccgat cttcggcaac atcgtggatg 5580

aggtggccta ccacgagaag tacccgacca tctaccacct ccgcaagaag ctcgtcgact 5640

ccaccgataa ggccgacctc aggctcatct acctcgccct cgcccacatg atcaagttca 5700

ggggccactt cctcatcgag ggcgacctca acccggacaa ctccgatgtg gacaagctgt 5760

tcatccagct cgtgcagacc tacaaccagc tgttcgagga gaacccgatc aacgcctctg 5820

gcgttgacgc caaggctatt ctctctgcca ggctctctaa gtcccgcagg ctcgagaatc 5880

tgatcgccca acttccgggc gagaagaaga atggcctctt cggcaacctg atcgccctct 5940

ctcttggcct caccccgaac ttcaagtcca acttcgacct cgccgaggac gccaagctcc 6000

agctttccaa ggacacctac gacgacgacc tcgacaatct cctcgcccag attggcgatc 6060

agtacgccga tctgttcctc gccgccaaga atctctccga cgccatcctc ctcagcgaca 6120

tcctcagggt gaacaccgag atcaccaagg ccccactctc cgcctccatg atcaagaggt 6180

acgacgagca ccaccaggac ctcacactcc tcaaggccct cgtgagacag cagctcccag 6240

agaagtacaa ggagatcttc ttcgaccagt ccaagaacgg ctacgccggc tacatcgatg 6300

gcggcgcttc tcaagaggag ttctacaagt tcatcaagcc gatcctcgag aagatggacg 6360

gcaccgagga gctgctcgtg aagctcaata gagaggacct cctccgcaag cagcgcacct 6420

tcgataatgg ctccatcccg caccagatcc acctcggcga gcttcatgct atcctccgca 6480

ggcaagagga cttctacccg ttcctcaagg acaaccgcga gaagattgag aagatcctca 6540

ccttccgcat cccgtactac gtgggcccgc tcgccagggg caactccagg ttcgcctgga 6600

tgaccagaaa gtccgaggag acaatcaccc cctggaactt cgaggaggtg gtggataagg 6660

gcgcctctgc ccagtctttc atcgagcgca tgaccaactt cgacaagaac ctcccgaacg 6720

agaaggtgct cccgaagcac tcactcctct acgagtactt caccgtgtac aacgagctga 6780

ccaaggtgaa gtacgtgacc gaggggatga ggaagccagc tttccttagc ggcgagcaaa 6840

agaaggccat cgtcgacctg ctgttcaaga ccaaccgcaa ggtgaccgtg aagcagctca 6900

aggaggacta cttcaagaaa atcgagtgct tcgactccgt cgagatctcc ggcgtcgagg 6960

ataggttcaa tgcctccctc gggacctacc acgacctcct caagattatc aaggacaagg 7020

acttcctcga caacgaggag aacgaggaca tcctcgagga catcgtgctc accctcaccc 7080

tcttcgagga ccgcgagatg atcgaggagc gcctcaagac atacgcccac ctcttcgacg 7140

acaaggtgat gaagcagctg aagcgcaggc gctataccgg ctggggcagg ctctctagga 7200

agctcatcaa cggcatccgc gacaagcagt ccggcaagac gatcctcgac ttcctcaagt 7260

ccgacggctt cgccaaccgc aacttcatgc agctcatcca cgacgactcc ctcaccttca 7320

aggaggacat ccaaaaggcc caggtgtccg gccaaggcga ttccctccat gaacatatcg 7380

ccaatctcgc cggctccccg gctatcaaga agggcattct ccagaccgtg aaggtggtgg 7440

acgagctggt gaaggtgatg ggcaggcaca agccagagaa catcgtgatc gagatggccc 7500

gcgagaacca gaccacacag aagggccaaa agaactcccg cgagcgcatg aagaggatcg 7560

aggagggcat taaggagctg ggctcccaga tcctcaagga gcacccagtc gagaacaccc 7620

agctccagaa cgagaagctc tacctctact acctccagaa cggccgcgac atgtacgtgg 7680

accaagagct ggacatcaac cgcctctccg actacgacgt ggaccatatt gtgccgcagt 7740

ccttcctgaa ggacgactcc atcgacaaca aggtgctcac ccgctccgac aagaacaggg 7800

gcaagtccga taacgtgccg tccgaagagg tcgtcaagaa gatgaagaac tactggcgcc 7860

agctcctcaa cgccaagctc atcacccaga ggaagttcga caacctcacc aaggccgaga 7920

gaggcggcct ttccgagctt gataaggccg gcttcatcaa gcgccagctc gtcgagacac 7980

gccagatcac aaagcacgtg gcccagatcc tcgactcccg catgaacacc aagtacgacg 8040

agaacgacaa gctcatccgc gaggtgaagg tcatcaccct caagtccaag ctcgtgtccg 8100

acttccgcaa ggacttccag ttctacaagg tgcgcgagat caacaactac caccacgccc 8160

acgacgccta cctcaatgcc gtggtgggca cagccctcat caagaagtac ccaaagctcg 8220

agtccgagtt cgtgtacggc gactacaagg tgtacgacgt gcgcaagatg atcgccaagt 8280

ccgagcaaga gatcggcaag gcgaccgcca agtacttctt ctactccaac atcatgaatt 8340

tcttcaagac cgagatcacg ctcgccaacg gcgagattag gaagaggccg ctcatcgaga 8400

caaacggcga gacaggcgag atcgtgtggg acaagggcag ggatttcgcc acagtgcgca 8460

aggtgctctc catgccgcaa gtgaacatcg tgaagaagac cgaggttcag accggcggct 8520

tctccaagga gtccatcctc ccaaagcgca actccgacaa gctgatcgcc cgcaagaagg 8580

actgggaccc gaagaagtat ggcggcttcg attctccgac cgtggcctac tctgtgctcg 8640

tggttgccaa ggtcgagaag ggcaagagca agaagctcaa gtccgtcaag gagctgctgg 8700

gcatcacgat catggagcgc agcagcttcg agaagaaccc aatcgacttc ctcgaggcca 8760

agggctacaa ggaggtgaag aaggacctca tcatcaagct cccgaagtac agcctcttcg 8820

agcttgagaa cggccgcaag agaatgctcg cctctgctgg cgagcttcag aagggcaacg 8880

agcttgctct cccgtccaag tacgtgaact tcctctacct cgcctcccac tacgagaagc 8940

tcaagggctc cccagaggac aacgagcaaa agcagctgtt cgtcgagcag cacaagcact 9000

acctcgacga gatcatcgag cagatctccg agttctccaa gcgcgtgatc ctcgccgatg 9060

ccaacctcga taaggtgctc agcgcctaca acaagcaccg cgataagcca attcgcgagc 9120

aggccgagaa catcatccac ctcttcaccc tcaccaacct cggcgctcca gccgccttca 9180

agtacttcga caccaccatc gaccgcaagc gctacacctc taccaaggag gttctcgacg 9240

ccaccctcat ccaccagtct atcacaggcc tctacgagac acgcatcgac ctctcacaac 9300

tcggcggcga ttccggcggc agcccaaaga agaagcggaa ggtgtctgga ggttctccta 9360

agaaaaagag aaaagtgtcc ggcggctccc cgaagaagaa gcgcaaggtg gagggccgcg 9420

gctctttact cacttgtggc gacgtggagg aaaatccggg cccgatgaaa aagcctgaac 9480

tcaccgcgac gtctgtcgag aagtttctga tcgaaaagtt cgacagcgtc tccgacctga 9540

tgcagctctc ggagggcgaa gaatctcgtg ctttcagctt cgatgtagga gggcgtggat 9600

atgtcctgcg ggtaaatagc tgcgccgatg gtttctacaa agatcgttat gtttatcggc 9660

actttgcatc ggccgcgctc ccgattccgg aagtgcttga cattggggag tttagcgaga 9720

gcctgaccta ttgcatctcc cgccgtgcac agggtgtcac gttgcaagac ctgcctgaaa 9780

ccgaactgcc cgctgttcta caaccggtcg cggaggctat ggatgcgatc gctgcggccg 9840

atcttagcca gacgagcggg ttcggcccat tcggaccgca aggaatcggt caatacacta 9900

catggcgtga tttcatatgc gcgattgctg atccccatgt gtatcactgg caaactgtga 9960

tggacgacac cgtcagtgcg tccgtcgcgc aggctctcga tgagctgatg ctttgggccg 10020

aggactgccc cgaagtccgg cacctcgtgc acgcggattt cggctccaac aatgtcctga 10080

cggacaatgg ccgcataaca gcggtcattg actggagcga ggcgatgttc ggggattccc 10140

aatacgaggt cgccaacatc ttcttctgga ggccgtggtt ggcttgtatg gagcagcaga 10200

cgcgctactt cgagcggagg catccggagc ttgcaggatc gccacgactc cgggcgtata 10260

tgctccgcat tggtcttgac caactctatc agagcttggt tgacggcaat ttcgatgatg 10320

cagcttgggc gcagggtcga tgcgacgcaa tcgtccgatc cggagccggg actgtcgggc 10380

gtacacaaat cgcccgcaga agcgcggccg tctggaccga tggctgtgta gaagtactcg 10440

ccgatagtgg aaaccgacgc cccagcactc gtccgagggc aaagaaatag gagctccggc 10500

cgggagcatg cgacgtcgat ctaactgact agccgcggcc atgctagagt ccgcaaaaat 10560

caccagtctc tctctacaaa tctatctctc tctatttttc tccagaataa tgtgtgagta 10620

gttcccagat aagggaatta gggttcttat agggtttcgc tcatgtgttg agcatataag 10680

aaacccttag tatgtatttg tatttgtaaa atacttctat caataaaatt tctaattcct 10740

aaaaccaaaa tccagtgacc tgaattcgta atcatgtcat agctgtttcc tgtgtgaaat 10800

tgttatccgc tcacaattcc acacaacata cgagccggaa gcataaagtg taaagcctgg 10860

ggtgcctaat gagtgagcta actcacatta attgcgttgc gctcactgcc cgctttccag 10920

tcgggaaacc tgtcgtgcca gctgcattaa tgaatcggcc aacgcgcggg gagaggcggt 10980

ttgcgtattg gctagagcag cttgccaaca tggtggagca cgacactctc gtctactcca 11040

agaatatcaa agatacagtc tcagaagacc aaagggctat tgagactttt caacaaaggg 11100

taatatcggg aaacctcctc ggattccatt gcccagctat ctgtcacttc atcaaaagga 11160

cagtagaaaa ggaaggtggc acctacaaat gccatcattg cgataaagga aaggctatcg 11220

ttcaagatgc ctctgccgac agtggtccca aagatggacc cccacccacg aggagcatcg 11280

tggaaaaaga agacgttcca accacgtctt caaagcaagt ggattgatgt gataacatgg 11340

tggagcacga cactctcgtc tactccaaga atatcaaaga tacagtctca gaagaccaaa 11400

gggctattga gacttttcaa caaagggtaa tatcgggaaa cctcctcgga ttccattgcc 11460

cagctatctg tcacttcatc aaaaggacag tagaaaagga aggtggcacc tacaaatgcc 11520

atcattgcga taaaggaaag gctatcgttc aagatgcctc tgccgacagt ggtcccaaag 11580

atggaccccc acccacgagg agcatcgtgg aaaaagaaga cgttccaacc acgtcttcaa 11640

agcaagtgga ttgatgtgat atctccactg acgtaaggga tgacgcacaa tcccactatc 11700

cttcgcaaga ccttcctcta tataaggaag ttcatttcat ttggagagga cacgctgaaa 11760

tcaccagtct ctctctacaa atctatctct ctcgagcttt cgcagatccc ggggggcaat 11820

gagatatgaa aaagcctgaa ctcaccgcga cgtctgtcga gaagtttctg atcgaaaagt 11880

tcgacagcgt ctccgacctg atgcagctct cggagggcga agaatctcgt gctttcagct 11940

tcgatgtagg agggcgtgga tatgtcctgc gggtaaatag ctgcgccgat ggtttctaca 12000

aagatcgtta tgtttatcgg cactttgcat cggccgcgct cccgattccg gaagtgcttg 12060

acattgggga gtttagcgag agcctgacct attgcatctc ccgccgtgca cagggtgtca 12120

cgttgcaaga cctgcctgaa accgaactgc ccgctgttct acaaccggtc gcggaggcta 12180

tggatgcgat cgctgcggcc gatcttagcc agacgagcgg gttcggccca ttcggaccgc 12240

aaggaatcgg tcaatacact acatggcgtg atttcatatg cgcgattgct gatccccatg 12300

tgtatcactg gcaaactgtg atggacgaca ccgtcagtgc gtccgtcgcg caggctctcg 12360

atgagctgat gctttgggcc gaggactgcc ccgaagtccg gcacctcgtg cacgcggatt 12420

tcggctccaa caatgtcctg acggacaatg gccgcataac agcggtcatt gactggagcg 12480

aggcgatgtt cggggattcc caatacgagg tcgccaacat cttcttctgg aggccgtggt 12540

tggcttgtat ggagcagcag acgcgctact tcgagcggag gcatccggag cttgcaggat 12600

cgccacgact ccgggcgtat atgctccgca ttggtcttga ccaactctat cagagcttgg 12660

ttgacggcaa tttcgatgat gcagcttggg cgcagggtcg atgcgacgca atcgtccgat 12720

ccggagccgg gactgtcggg cgtacacaaa tcgcccgcag aagcgcggcc gtctggaccg 12780

atggctgtgt agaagtactc gccgatagtg gaaaccgacg ccccagcact cgtccgaggg 12840

caaagaaata gagtagatgc cgaccggatc tgtcgatcga caagctcgag tttctccata 12900

ataatgtgtg agtagttccc agataaggga attagggttc ctatagggtt tcgctcatgt 12960

gttgagcata taagaaaccc ttagtatgta tttgtatttg taaaatactt ctatcaataa 13020

aatttctaat tcctaaaacc aaaatccagt actaaaatcc agatcccccg aattaattcg 13080

gcgttaattc agtacattaa aaacgtccgc aatgtgttat taagttgtct aagcgtcaat 13140

ttgtttacac cacaatatat cctgccacca gccagccaac agctccccga ccggcagctc 13200

ggcacaaaat caccactcga tacaggcagc ccatcagtcc gggacggcgt cagcgggaga 13260

gccgttgtaa ggcggcagac tttgctcatg ttaccgatgc tattcggaag aacggcaact 13320

aagctgccgg gtttgaaaca cggatgatct cgcggagggt agcatgttga ttgtaacgat 13380

gacagagcgt tgctgcctgt gatcaccgcg gtttcaaaat cggctccgtc gatactatgt 13440

tatacgccaa ctttgaaaac aactttgaaa aagctgtttt ctggtattta aggttttaga 13500

atgcaaggaa cagtgaattg gagttcgtct tgttataatt agcttcttgg ggtatcttta 13560

aatactgtag aaaagaggaa ggaaataata aatggctaaa atgagaatat caccggaatt 13620

gaaaaaactg atcgaaaaat accgctgcgt aaaagatacg gaaggaatgt ctcctgctaa 13680

ggtatataag ctggtgggag aaaatgaaaa cctatattta aaaatgacgg acagccggta 13740

taaagggacc acctatgatg tggaacggga aaaggacatg atgctatggc tggaaggaaa 13800

gctgcctgtt ccaaaggtcc tgcactttga acggcatgat ggctggagca atctgctcat 13860

gagtgaggcc gatggcgtcc tttgctcgga agagtatgaa gatgaacaaa gccctgaaaa 13920

gattatcgag ctgtatgcgg agtgcatcag gctctttcac tccatcgaca tatcggattg 13980

tccctatacg aatagcttag acagccgctt agccgaattg gattacttac tgaataacga 14040

tctggccgat gtggattgcg aaaactggga agaagacact ccatttaaag atccgcgcga 14100

gctgtatgat tttttaaaga cggaaaagcc cgaagaggaa cttgtctttt cccacggcga 14160

cctgggagac agcaacatct ttgtgaaaga tggcaaagta agtggcttta ttgatcttgg 14220

gagaagcggc agggcggaca agtggtatga cattgccttc tgcgtccggt cgatcaggga 14280

ggatatcggg gaagaacagt atgtcgagct attttttgac ttactgggga tcaagcctga 14340

ttgggagaaa ataaaatatt atattttact ggatgaattg ttttagtacc tagaatgcat 14400

gaccaaaatc ccttaacgtg agttttcgtt ccactgagcg tcagaccccg tagaaaagat 14460

caaaggatct tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc aaacaaaaaa 14520

accaccgcta ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc tttttccgaa 14580

ggtaactggc ttcagcagag cgcagatacc aaatactgtc cttctagtgt agccgtagtt 14640

aggccaccac ttcaagaact ctgtagcacc gcctacatac ctcgctctgc taatcctgtt 14700

accagtggct gctgccagtg gcgataagtc gtgtcttacc gggttggact caagacgata 14760

gttaccggat aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac agcccagctt 14820

ggagcgaacg acctacaccg aactgagata cctacagcgt gagctatgag aaagcgccac 14880

gcttcccgaa gggagaaagg cggacaggta tccggtaagc ggcagggtcg gaacaggaga 14940

gcgcacgagg gagcttccag ggggaaacgc ctggtatctt tatagtcctg tcgggtttcg 15000

ccacctctga cttgagcgtc gatttttgtg atgctcgtca ggggggcgga gcctatggaa 15060

aaacgccagc aacgcggcct ttttacggtt cctggccttt tgctggcctt ttgctcacat 15120

gttctttcct gcgttatccc ctgattctgt ggataaccgt attaccgcct ttgagtgagc 15180

tgataccgct cgccgcagcc gaacgaccga gcgcagcgag tcagtgagcg aggaagcgga 15240

agagcgcctg atgcggtatt ttctccttac gcatctgtgc ggtatttcac accgcatatg 15300

gtgcactctc agtacaatct gctctgatgc cgcatagtta agccagtata cactccgcta 15360

tcgctacgtg actgggtcat ggctgcgccc cgacacccgc caacacccgc tgacgcgccc 15420

tgacgggctt gtctgctccc ggcatccgct tacagacaag ctgtgaccgt ctccgggagc 15480

tgcatgtgtc agaggttttc accgtcatca ccgaaacgcg cgaggcaggg tgccttgatg 15540

tgggcgccgg cggtcgagtg gcgacggcgc ggcttgtccg cgccctggta gattgcctgg 15600

ccgtaggcca gccatttttg agcggccagc ggccgcgata ggccgacgcg aagcggcggg 15660

gcgtagggag cgcagcgacc gaagggtagg cgctttttgc agctcttcgg ctgtgcgctg 15720

gccagacagt tatgcacagg ccaggcgggt tttaagagtt ttaataagtt ttaaagagtt 15780

ttaggcggaa aaatcgcctt ttttctcttt tatatcagtc acttacatgt gtgaccggtt 15840

cccaatgtac ggctttgggt tcccaatgta cgggttccgg ttcccaatgt acggctttgg 15900

gttcccaatg tacgtgctat ccacaggaaa cagacctttt cgaccttttt cccctgctag 15960

ggcaatttgc cctagcatct gctccgtaca ttaggaaccg gcggatgctt cgccctcgat 16020

caggttgcgg tagcgcatga ctaggatcgg gccagcctgc cccgcctcct ccttcaaatc 16080

gtactccggc aggtcatttg acccgatcag cttgcgcacg gtgaaacaga acttcttgaa 16140

ctctccggcg ctgccactgc gttcgtagat cgtcttgaac aaccatctgg cttctgcctt 16200

gcctgcggcg cggcgtgcca ggcggtagag aaaacggccg atgccgggat cgatcaaaaa 16260

gtaatcgggg tgaaccgtca gcacgtccgg gttcttgcct tctgtgatct cgcggtacat 16320

ccaatcagct agctcgatct cgatgtactc cggccgcccg gtttcgctct ttacgatctt 16380

gtagcggcta atcaaggctt caccctcgga taccgtcacc aggcggccgt tcttggcctt 16440

cttcgtacgc tgcatggcaa cgtgcgtggt gtttaaccga atgcaggttt ctaccaggtc 16500

gtctttctgc tttccgccat cggctcgccg gcagaacttg agtacgtccg caacgtgtgg 16560

acggaacacg cggccgggct tgtctccctt cccttcccgg tatcggttca tggattcggt 16620

tagatgggaa accgccatca gtaccaggtc gtaatcccac acactggcca tgccggccgg 16680

ccctgcggaa acctctacgt gcccgtctgg aagctcgtag cggatcacct cgccagctcg 16740

tcggtcacgc ttcgacagac ggaaaacggc cacgtccatg atgctgcgac tatcgcgggt 16800

gcccacgtca tagagcatcg gaacgaaaaa atctggttgc tcgtcgccct tgggcggctt 16860

cctaatcgac ggcgcaccgg ctgccggcgg ttgccgggat tctttgcgga ttcgatcagc 16920

ggccgcttgc cacgattcac cggggcgtgc ttctgcctcg atgcgttgcc gctgggcggc 16980

ctgcgcggcc ttcaacttct ccaccaggtc atcacccagc gccgcgccga tttgtaccgg 17040

gccggatggt ttgcgaccgc tcacgccgat tcctcgggct tgggggttcc agtgccattg 17100

cagggccggc agacaaccca gccgcttacg cctggccaac cgcccgttcc tccacacatg 17160

gggcattcca cggcgtcggt gcctggttgt tcttgatttt ccatgccgcc tcctttagcc 17220

gctaaaattc atctactcat ttattcattt gctcatttac tctggtagct gcgcgatgta 17280

ttcagatagc agctcggtaa tggtcttgcc ttggcgtacc gcgtacatct tcagcttggt 17340

gtgatcctcc gccggcaact gaaagttgac ccgcttcatg gctggcgtgt ctgccaggct 17400

ggccaacgtt gcagccttgc tgctgcgtgc gctcggacgg ccggcactta gcgtgtttgt 17460

gcttttgctc attttctctt tacctcatta actcaaatga gttttgattt aatttcagcg 17520

gccagcgcct ggacctcgcg ggcagcgtcg ccctcgggtt ctgattcaag aacggttgtg 17580

ccggcggcgg cagtgcctgg gtagctcacg cgctgcgtga tacgggactc aagaatgggc 17640

agctcgtacc cggccagcgc ctcggcaacc tcaccgccga tgcgcgtgcc tttgatcgcc 17700

cgcgacacga caaaggccgc ttgtagcctt ccatccgtga cctcaatgcg ctgcttaacc 17760

agctccacca ggtcggcggt ggcccatatg tcgtaagggc ttggctgcac cggaatcagc 17820

acgaagtcgg ctgccttgat cgcggacaca gccaagtccg ccgcctgggg cgctccgtcg 17880

atcactacga agtcgcgccg gccgatggcc ttcacgtcgc ggtcaatcgt cgggcggtcg 17940

atgccgacaa cggttagcgg ttgatcttcc cgcacggccg cccaatcgcg ggcactgccc 18000

tggggatcgg aatcgactaa cagaacatcg gccccggcga gttgcagggc gcgggctaga 18060

tgggttgcga tggtcgtctt gcctgacccg cctttctggt taagtacagc gataaccttc 18120

atgcgttccc cttgcgtatt tgtttattta ctcatcgcat catatacgca gcgaccgcat 18180

gacgcaagct gttttactca aatacacatc acctttttag acggcggcgc tcggtttctt 18240

cagcggccaa gctggccggc caggccgcca gcttggcatc agacaaaccg gccaggattt 18300

catgcagccg cacggttgag acgtgcgcgg gcggctcgaa cacgtacccg gccgcgatca 18360

tctccgcctc gatctcttcg gtaatgaaaa acggttcgtc ctggccgtcc tggtgcggtt 18420

tcatgcttgt tcctcttggc gttcattctc ggcggccgcc agggcgtcgg cctcggtcaa 18480

tgcgtcctca cggaaggcac cgcgccgcct ggcctcggtg ggcgtcactt cctcgctgcg 18540

ctcaagtgcg cggtacaggg tcgagcgatg cacgccaagc agtgcagccg cctctttcac 18600

ggtgcggcct tcctggtcga tcagctcgcg ggcgtgcgcg atctgtgccg gggtgagggt 18660

agggcggggg ccaaacttca cgcctcgggc cttggcggcc tcgcgcccgc tccgggtgcg 18720

gtcgatgatt agggaacgct cgaactcggc aatgccggcg aacacggtca acaccatgcg 18780

gccggccggc gtggtggtgt cggcccacgg ctctgccagg ctacgcaggc ccgcgccggc 18840

ctcctggatg cgctcggcaa tgtccagtag gtcgcgggtg ctgcgggcca ggcggtctag 18900

cctggtcact gtcacaacgt cgccagggcg taggtggtca agcatcctgg ccagctccgg 18960

gcggtcgcgc ctggtgccgg tgatcttctc ggaaaacagc ttggtgcagc cggccgcgtg 19020

cagttcggcc cgttggttgg tcaagtcctg gtcgtcggtg ctgacgcggg catagcccag 19080

caggccagcg gcggcgctct tgttcatggc gtaatgtctc cggttctagt cgcaagtatt 19140

ctactttatg cgactaaaac acgcgacaag aaaacgccag gaaaagggca gggcggcagc 19200

ctgtcgcgta acttaggact tgtgcgacat gtcgttttca gaagacggct gcactgaacg 19260

tcagaagccg actgcactat agcagcggag gggttggatc aaagtacttt gatcccgagg 19320

ggaaccctgt ggttggcatg cacatacaaa tggacgaacg gataaacctt ttcacgccct 19380

tttaaatatc cgttattcta a 19401

Claims (6)

1. The utility model provides a improve co-transcription unit gene ABEHPT of rice single base editing efficiency which characterized in that, co-transcription unit gene ABEHPT includes the encoding gene HPT of anti-hygromycin protein, the encoding gene SpCas9n of SpCas9 protein and the encoding gene ABE of adenine deaminase, wherein, co-transcription unit gene ABEHPT constructs in same expression vector with the encoding gene of sgRNA, each gene fragment of co-transcription unit gene ABEHPT inserts in same expression frame, and the sequence of co-transcription unit gene ABEHPT is: the nucleotide sequence shown in SEQ ID No.1 in the sequence table.

2. A method for improving single base editing efficiency of rice is characterized in that the method comprises the steps of introducing a coding gene of sgRNA, a coding gene HPT of hygromycin-resistant protein, a coding gene of SpCas9 protein, a coding gene of SpCas9n of adenine deaminase and a coding gene ABE of adenine deaminase into a receptor, and expressing the sgRNA, the hygromycin-resistant protein, the SpCas9 protein and the adenine deaminase in the receptor so as to edit the base of a target gene in a receptor genome, and further comprises the steps of synthesizing a coding gene of HPT containing the hygromycin-resistant protein, SpCas9 protein, a coding gene of SpCas9n and a gene sequence ABEHPT of adenine deaminase, adding NotI/SacI enzyme cutting sites at two ends, carrying out enzyme cutting on a plant expression vector UNpH900 vector by utilizing NotI/SacI, recovering, connecting the gene sequence ABEHPT to an expression vector, cutting off the promoter on the ABEHPT together with the gene sequence ABEHPT by utilizing the enzyme cutting sites, the method comprises the following steps of connecting a plant expression vector without a screening marker gene HPT, synthesizing a sgRNA expression frame containing a HindIII enzyme cutting site, introducing the sgRNA expression frame into the plant expression vector, and introducing the plant expression vector into a receptor, wherein the coding gene HPT of the hygromycin protein resistant, the coding gene SpCas9n of the SpCas9 protein and the adenine deaminase coding gene ABE use the same constitutive promoter Ubiqutin and the same 35S terminator, and the sequence of ABEHPT is as follows: the nucleotide sequence shown in SEQ ID No.1 in the sequence table.

3. The method for improving rice single base editing efficiency according to claim 2, wherein the sgRNA expression cassette comprises: the rice gene expression vector comprises a rice OsU3 promoter, a spectinomycin resistance gene SpR, an artificially synthesized sgRNA framework sequence and a Poly-T terminator, wherein the nucleotide sequence of the rice OsU3 promoter is shown as Seq ID No.2 from 1 st to 382 th positions, the nucleotide sequence of the spectinomycin resistance gene SpR is shown as Seq ID No.2 from 388 th to 1595 th positions, the nucleotide sequence of the artificially synthesized sgRNA framework sequence is shown as Seq ID No.2 from 1603 th to 1688 th positions, and the nucleotide sequence of the Poly-T terminator is shown as Seq ID No.2 from 1689 th to 1696 th positions.

4. A plant expression vector comprising a co-transcriptional unit gene, ABEHPT, of claim 1, and a sgRNA expression cassette comprising: the rice gene expression vector comprises a rice OsU3 promoter, a spectinomycin resistance gene SpR, an artificially synthesized sgRNA framework sequence and a Poly-T terminator, wherein the nucleotide sequence of the rice OsU3 promoter is shown as Seq ID No.2 from 1 st to 382 th positions, the nucleotide sequence of the spectinomycin resistance gene SpR is shown as Seq ID No.2 from 388 th to 1595 th positions, the nucleotide sequence of the artificially synthesized sgRNA framework sequence is shown as Seq ID No.2 from 1603 th to 1688 th positions, and the nucleotide sequence of the Poly-T terminator is shown as Seq ID No.2 from 1689 th to 1696 th positions.

5. Use of the co-transcriptional unit gene ABEHPT as claimed in claim 1 comprising introducing said co-transcriptional unit gene ABEHPT into plant callus by the steps of infecting, co-culturing and screening to obtain edited plant callus.

6. The use of claim 5, wherein said use comprises differentiating said plant callus into a plant, and increasing the efficiency of site-specific replacement of A: T to G: C on the rice genome using said co-transcriptional unit gene ABEHPT, to obtain a transgenic plant or plant part containing a mutation site.

Images