CN114480474B - Construction and application of marine nannochloropsis transcription activation CRISPRa system - Google Patents

Abstract

The invention belongs to the technical field of biology, and particularly relates to a marine nannochloropsis transcriptional activation CRISPRa system, a construction method and application thereof. The system vector contains a Cas9 inactivating protein, a transcriptional activation effector protein VP64, a resistance selection marker gene, at least one gRNA scaffold sequence, and a specific sequence that enhances transcriptional activation (SunTag sequence). The CRISPRa vector for transcription activation of the nannochloropsis gene is applied to gene transformation. The invention provides a new model and a feasibility method for the functional research of the nannochloropsis gene.

Description

Construction and application of marine nannochloropsis transcription activation CRISPRa system

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a marine nannochloropsis transcriptional activation CRISPRa system, a construction method and application thereof.

Background

The marine parachloropsis microalgae is a single-cell photosynthetic microalgae and is widely distributed in different water environment water areas such as oceans, lakes, marshes and the like. Because of the characteristics of high grease content, good environmental adaptability, suitability for flue gas culture and the like, the microbial fertilizer is favored in the fields of microalgae biological energy, microalgae functional foods, microalgae feeds and the like, and is one of important biological resources of a blue granary. With the rise of synthetic biology in recent years, nannochloropsis has risen as one of new generation synthetic biological photosynthetic chassis cells, and developed to a position of equal importance as model algae strains such as chlamydomonas reinhardtii, chlorella and the like. To date, the entire genome of a number of nannochloropsis has been sequenced, covering essentially the known representative species within this genus, including N.oceanica IMET1, N.oceanica CCMP1779, N.oceanica CCMP526, etc. Despite their full genome sequencing, most of their genes (more than 50%) are of unknown function and an understanding of metabolic processes remains a "black box". This requires the development of genetic transformation methods and genetic manipulation tools to reveal the "black box" puzzle. Fortunately, genetic transformation methods based on electric transformation or gene gun and the like are also basically established in several strains of nannochloropsis (N.oceanica IMET1, N.oceanica CCMP1779, N.oceanica CCMP526, N.oceanica CCMP526 and the like) representative species, and forward and reverse genetic tools such as random insertion mutation, overexpression, RNAi technology and homologous recombination methods are reported in different species (such as N.salina). In addition, gene editing techniques have also been established in several representative species (e.g., n. Salina), such as episome-based non-selective pressure gene editing, and the like.

Gene editing CRISPR-Cas9 is currently the most widely used CRISPR system, and is widely used in many other fields in addition to genes used to rapidly and efficiently edit prokaryotic and eukaryotic cells at the cell line, stem cell and induced multifunctional stem cell level. For example, by using inactivated CRISPR-Cas9 protein (dCAS 9 protein for short) and domain proteins with specific functions (such as a transcription activation domain VP64, a transcription inhibition domain KRAB, an epigenetic regulatory acetylation domain P300, a methylation domain DnMT3a and the like) for fusion expression, and combining specific guide RNA, the aim of specifically regulating the expression level of a certain gene can be achieved. This technology system has been successfully used in mammalian and plant research systems. At present, a high coverage sgRNA library is produced, each gene of cells can be covered, and the channels or genes of interest are screened by a positive and negative screening method, so that the technology greatly expands the method of scientists for researching functional genomics. However, this technology is very rare in plants, especially in microalgae, because of the slow establishment of gene editing methods, and because of the recognition of the transcriptional activation complex system and the lack of knowledge of other commonly used transcriptional activation domains that can be applied or not clearly established in microalgae.

Disclosure of Invention

The invention aims to provide a marine nannochloropsis transcription activation CRISPRa system, a construction method thereof and application of the system in metabolic engineering transformation and synthetic biology research of nannochloropsis, and optimization of specific economic characters of nannochloropsis species.

In order to achieve the above purpose, the invention adopts the technical scheme that:

a marine nannochloropsis transcriptional activation CRISPRa system, the system carrier contains Cas9 inactivating protein, transcriptional activation effector protein VP64, resistance selection marker gene, at least one gRNA bracket sequence and a specific sequence (SunTag sequence) for enhancing transcriptional activation.

The system takes a Cas9 expression vector (pNOC-ARS-CRISPR) of nannochloropsis as a framework, and contains an endogenous promoter and a terminator, wherein the promoter is a Ribi bidirectional promoter and a LDSP promoter, and the terminator is a LDSP terminator.

One end of the backbone vector Ribi bidirectional promoter is sequentially connected with dCAS9 protein, a specific sequence for enhancing transcription activation and transcription activation effector protein; the other end is connected with a gRNA bracket sequence which drives gRNA expression; the hygromycin resistance gene is positioned downstream of the skeleton vector LDSP promoter; the dCas9 protein, specific sequences that enhance transcriptional activation, and transcriptional activation effector proteins were all preceded by a leader localization signal.

Further, aiming at the nannoc skeleton vector pNOC-ARS-CRISPR, the key structure dCAS9-SunTag-VP64 for transcriptional activation of specific target genes is designed and fusion expressed in series. That is, three proteins of dCAS9-SunTag-VP64 are fused and expressed in the nannochloropsis, and are placed in a triple complex of the same reading frame (the codon optimization of the nannochloropsis, the GC content is changed, so that the triple complex is more suitable for expression in the nannochloropsis or the expression efficiency is higher), and a leader nuclear localization signal (SLV 40; used for nuclear localization expression and increasing the expression copy number of dCAS9 protein and transcription activation domain) is connected before each structure. In addition, sunTag sequences (10 XGCN4 was selected) were used to increase transcriptional activation efficiency, and to enhance transcriptional activation VP64, and also to increase expression efficiency using nuclear localization expression.

The vector contains at least one gRNA scaffold sequence, and the multiple gRNA scaffold sequences are formed by serially connecting gRNAs designed by multiple target genes; each gRNA scaffold sequence is a guide sequence designed for a specific target gene; wherein the specific target gene is a candidate gene related to the trait.

The multiple gRNAs are connected in series to realize simultaneous transcriptional activation of multiple genes, and genes in the same metabolic pathway can be designed as target genes, so that the whole metabolic pathway is activated.

The above and the propertiesThe related candidate genes are directly or indirectly involved in photosynthesis, carbon fixation, stress resistance, grease accumulation, high temperature resistance and high CO resistance ₂ Concentration, acid, oxygen and water stress resistance related genes

The dmas 9 protein mentioned above is a protein which is obtained by point mutation and has the function of inactivating and cutting a target sequence, only retains the targeting function of the gene, but the function of cutting a DNA sequence disappears, and in order to improve the expression efficiency, the GC content is changed through codon optimization, so that the dmas 9 protein is more suitable for expressing in nannochloropsis;

the gRNA knockout sequence is a nannochloropsis methyltransferase gene and any DNA sequence on the genome (the gRNA sequence can be designed for different target genes);

the resistance gene is hygromycin gene and all genes corresponding to antibiotics and pesticides sensitive to the nannochloropsis;

the transcriptional activation effector protein VP64 is a heterologous protein domain that is codon optimized for (and made suitable for expression in) nannochloropsis, and comprises a codon optimized nuclear localization signal sequence;

the Cas9 inactivated protein, the transcriptional activation effector protein, the resistance selection marker gene, the gRNA bracket sequence and the specific sequence for enhancing transcriptional activation are respectively corresponding gene sequences after the optimization of the nannochloropsis codon; wherein, the base of the codon-optimized dCAS9 protein is from 6279bp to 10379bp in SEQ ID NO. 1, the codon-optimized transcriptional activation effector protein VP64 is from 5187bp to 5336bp in SEQ ID NO. 1, the codon-optimized resistance selection marker gene is from 2617bp to 3642bp in SEQ ID NO. 1, and the specific sequence of the codon-optimized enhanced transcriptional activation is from 5397bp to 6101bp in SEQ ID NO. 1.

A construction method of the system comprises the following steps:

(1) Constructing an expression vector containing Cas9 inactivated protein, transcriptional activation effector protein VP64 and a SunTag sequence for enhancing transcriptional activation by using a framework vector, and driving the expression by the same promoter;

(2) Construction of specific gRNA sequences was ligated to the above vectors to construct transcription activation vectors.

The construction of the recombinant plasmid in the step (1), namely (1) constructing a recombinant plasmid containing a Cas9 inactivated protein, a promoter, a terminator and a hygromycin resistance gene by utilizing a skeleton vector, and inactivating the original carrier Cas9 protein into dCAS9 protein; (2) The transcriptional activation effector protein VP64 and the SunTag sequence for enhancing transcriptional activation are connected to the downstream of dCAS9 protein and are driven to express by the same promoter; (3) And (3) connecting at least one gRNA scaffold sequence to the recombinant plasmid, and constructing and obtaining a transcription activation system.

An application of a nannochloropsis gene transcription activation CRISPRa system in gene transformation.

A host cell comprising said vector.

The host cell is marine nannochloropsis.

The method successfully constructs a CRISPRa (dCAS 9-SunTag-VP64 mediated transcriptional regulation) based transcriptional activation expression system of the nannochloropsis. The invention designs the gRNA of specific target genes or the gRNA series connection of a plurality of target genes, can effectively activate the transcription level of the nannochloropsis target genes, and obtains the transgenic mutant alga strain through molecular and physiological phenotype screening. Compared with the prior art, the invention realizes the key breakthrough of the genome engineering technology of the nannochloropsis, and has the following beneficial effects:

1. the invention establishes a transcription activation platform based on dCS 9-VP64/gRNA genes in marine nannochloropsis, uses inactivated dCS 9 to combine with a transcription activation domain VP64, realizes the transcription activation of target genes by using the recruitment function of dCS 9 under the guidance of gRNA, and can be used for the transcription activation of multiple genes in series, namely, the vector can be used for gene function research and large-scale genetic screening, and is a preferred tool for non-coding RNA research.

2. The present invention provides dCS 9-SunTag-VP64/gRNA (CRISPRa) systems for metabolic engineering of nannochloropsis or design of synthetic biological chassis cells. The CRISPRa system can be used for resolving the regulation and control mechanism of all related proteins, enzymes and non-coding RNA in the genome of the nannochloropsis and improving specific biological properties (such as improving the efficiency of capturing, absorbing and utilizing light and converting energy, improving the multi-element stress resistance, greatly improving the biomass yield, improving the grease yield and the like).

3. The invention provides a dmas 9-SunTag-VP64/gRNA sequence for transcription activation (CRISPRa) of nannochloropsis, which comprises a SunTag sequence designed and codon optimized, can be used for a genetic modification system for nannochloropsis or a genetic modification system for single-cell nannochloropsis of a plurality of species, and can also be used for constructing an apparent genome editing system of nannochloropsis.

4. The invention can target the endogenous gene of transcription activation nannochloropsis, and constructs a dCAS9-SunTag-VP64/gRNA gene transcription activation system of nannochloropsis by using the methyltransferase gene.

5. The invention utilizes the sensitivity of the nannochloropsis to hygromycin, adopts a feasible selection marker gene-selection pressure combination (Hyg gene-hygromycin; the gene is already optimized by the codon of the nannochloropsis) to construct a dCAS9-SunTag-VP64/gRNA gene transcription activation system.

6. The CRISPRa system can regulate and control the transcription level of endogenous genes of the nannochloropsis so as to influence the metabolic pathway of target genes.

7. The transgenic engineering microalgae constructed by the invention can have more excellent multielement stress resistance, such as insect resistance, disease resistance, salt resistance, drought resistance, herbicide resistance and the like. The low-cost high-light-efficiency reaction facility aiming at the specific engineering microalgae is designed and constructed, and the large-scale culture cost is reduced. The nannochloropsis is a substrate with high added value (polyunsaturated fatty acids such as EPA and DHA, pigments, astaxanthin, sterols and the like) accumulated, and the yield of the high added value product can be further improved by means of the constructed transgenic engineering microalgae; meanwhile, the nannochloropsis has the characteristics of high photosynthetic efficiency, rapid propagation and strong environmental adaptability, and the carbon fixation efficiency of the constructed transgenic engineering nannochloropsis can be further improved by means of the constructed transgenic engineering nannochloropsis, so that the carbon dioxide can be effectively fixed, and the concentration of the carbon dioxide in the atmosphere is reduced;

8. the nannochloropsis nuclear genome sequence, the chloroplast genome sequence and the non-coding RNA genome sequence have been determined, and the invention can be used for carrying out functional genomics research on the nannochloropsis and the interaction between the nuclear genome and the chloroplast genome; functional genomics research can also be carried out on the nannochloropsis; meanwhile, the functional genomics research can be carried out on the nannochloropsis, and the research on non-coding RNA is carried out by means of a CRISPRa system;

9. the nannochloropsis can screen a condition specific promoter and drive a transcription activation system to which the method belongs, so that the condition specific transcription activation can be realized. In addition, the transcription activation system of the method can be driven by a promoter for screening specific organelle expression, so that the transcription activation of chloroplast or mitochondrial genes can be realized. Thus, the present system can be used to develop space-time specific transcription activation expression.

Drawings

FIG. 1 is a physical map of a transcription activation system expression vector for simultaneously expressing dmas 9 protein, a codon optimized VP64 transcription activation domain, a codon optimized SunTag sequence, gRNA and hygromycin genes by artificial synthesis provided by the embodiment of the invention.

FIG. 2 is a diagram showing the identification of DNA level of a target gene methyltransferase-activated transformant according to an embodiment of the present invention.

FIG. 3 shows the identification of the levels of target gene methyltransferases in nannochloropsis (wild type and mutant) in which WT is wild type, according to the examples of the present invention.

FIG. 4 shows the growth of a mutant strain transcribed and activated by a nannochloropsis methyl transferase provided by the embodiment of the invention.

FIG. 5 shows the phenotype identification of growth curves of the nannochloropsis methyltransferase transcriptional activation mutants (M4 and M7) and the wild type (white circles) provided by the embodiment of the invention.

FIG. 6 shows the measurement of photosynthetic parameters of a nannochloropsis methyltransferase transcriptional activation mutant strain provided by the embodiment of the present invention.

Detailed Description

The following description of the embodiments of the present invention is further provided in connection with the accompanying examples, and it should be noted that the embodiments described herein are for the purpose of illustration and explanation only, and are not limiting of the invention.

The invention establishes a dCAS9-VP64/gRNA gene transcription activation system based on gene editing in marine nannochloropsis, wherein, a transcription activator is connected with Cas9 (dCAS 9) of which the CRISPRa is catalyzed and inactivated, and can effectively promote the transcription of specific sites of genome, namely, sunTag and VP64 systems are introduced into the nannochloropsis, wherein, the SunTag system is similar to a set of molecular hooks, which can hang a plurality of copies of bioactive molecules on a protein bracket which can be used for targeting some genes or other molecules, and VP64 catalytic domain has a transcription activation function, and the two are fused and realize the transcription activation of specific genes under the targeting effect of dCAS9 protein.

The obtained mutant strain of the transgenic transcription activation system of the nannochloropsis is obtained by introducing the dCS 9-SunTag-VP64/gRNA vector containing the invention into the nannochloropsis by using the targeting function of dCS 9 protein under the guidance of gRNA and the activation function of VP64 transcription activation domain, and the transcription level of target genes is directionally improved.

It is simpler to use than cDNA overexpression, which is a common method of up-regulating the expression levels of individual genes, and allows for simultaneous activation of multiple genes. Furthermore, CRISPRa is a powerful weapon for non-coding RNA research.

Examples:

realizing the construction of a targeted transcription activation system of an endogenous gene methyltransferase gene (g 1248) in nannochloropsis:

1. synthetic transcription activation vector (CRISPR/dCas 9-SunTag-VP 64) that can express dCas9 protein (codon optimization, adjustment of GC content to fit expression in nannochloropsis), VP64 domain (codon optimization), sunTag sequence (codon optimization), hygromycin resistance gene (codon optimization), nuclear localization signal SLV (codon optimization):

1) Framework carrier: using the known marine nannochloropsis genome (NCBI:ASM187094v1) The sequence takes the nannochloropsis gene editing vector (pNOC-ARS-CRISPR) as a framework, and the framework vector contains an endogenous promoter (Ribi and LDSP) and an LDSP terminator, which are expression vectors capable of driving the expression of Cas9 protein to express and capable of gene editing.

2) Synthesis of dCas9 protein: the Cas9 protein is inactivated or the original vector Cas9 protein is replaced with the inactivated dCas protein (DNA sequence is fully synthesized). Namely, the 2539-2541 locus (CAT) of the DNA sequence of the original Cas9 protein is mutated into (GCC) so that the function of cutting a target sequence is lost, the targeting function is only reserved, and the dCAS9 protein complete sequence is synthesized by a chemical synthesis mode.

3) The VP64 domain is derived from sequences commonly used in plant or mammalian systems and codon optimized for expression in marine nannochloropsis, its VP64 sequence (3 '-5'): from 5187bp to 5336bp in the sequence table, the length is 150bp,

the SunTag sequence is derived from sequences commonly used in plant or mammalian systems and codon optimized for expression in marine nannochloropsis, and its SunTag sequence (3 '-5'): from 5397bp to 6101bp in the sequence table, the length is 705bpDNA,

the nuclear localization signal SLV40 is derived from the original vector pNOC-ARS-CRISPR and has a DNA sequence of CCGAAAAAGAAGAGGAAGGTC.

4) And (3) constructing a carrier:

the synthesized dCAS9 protein, VP64 structural domain (fusion expression with dCAS9 protein), sunTag sequence (fusion expression with dCAS9 protein), hygromycin resistance gene and gRNA are respectively put at the downstream of different promoters to be respectively expressed; wherein dCAS9 protein, 10XSuntag and VP64 are expressed by the Ribi bi-directional promoter, and gRNA is also expressed by the Ribi bi-directional promoter. The hygromycin resistance gene is expressed driven by the LDSP promoter (FIG. 1); meanwhile, dCAS9 protein, a specific sequence for enhancing transcriptional activation and transcriptional activation effector protein are all connected by a leader nuclear localization signal before; the specific process is as follows: firstly, carrying out point mutation design on a functional domain of a cleavage target sequence of a Cas9 protein of a primary carrier, and then synthesizing a DNA sequence of a dCAS9 protein with optimized codons (enzyme cleavage sites PspXI and HpaI are designed at two ends and used for replacing the Cas9 protein of the primary carrier), so as to obtain a carrier of the inactivated dCAS9 protein; next, sunTag sequence and VP64 domain were synthesized, the two domains were sequence synthesized in the same reading frame, and cleavage sites (HpaI and NheI) were designed at both ends, and the two cleavage sites were used to ligate into a vector containing dCas9 protein in the previous step, thereby obtaining a transcription activation vector (CRISPR/dCas 9-SunTag-VP 64) (fig. 1).

2. gRNA design and construction of transcription activation vector

The gRNA design of the transcription activation vector used in this example uses the ChopChop (http:// ChopChop. Cbu. Uib. No /) software to select the target gene (g 1248; the potential involved in the transcription activation of genes, i.e., the promoter region or transcription initiation site upstream sequence that may be capable of activating the expression of genes related to some economic traits, such as activating photosynthetic carbon fixation or oil accumulation, etc.) as the target site region (CGACGTGAAGAAACGATGCAGGG; red GGG is a PAM site), and then designs the synthetic primer F:

5-cgaACGTCGctgatgagtccgtgaggacgaaacgagtaagctcgtcCGACGTGAAGAAACGATGCA-3; and, a step of, in the first embodiment,

R5-AAATGCATCGTTTCTTCACGTCGgacgagcttactcgtttcgtcctcacggactcatcagCGACGT-3, firstly mixing forward and reverse primers in equal volume ratio, boiling in water bath at 100 ℃ for 10 minutes, then naturally cooling to room temperature to form double chains, finally connecting with a transcription activation vector (CRISPR/dCAS 9-Suntag-VP 64) by using T4 ligase to obtain the dCAS9-SunTag-VP64/gRNA gene transcription activation system of the nannochloropsis, wherein the base sequence of the system is shown as SEQ ID NO. 1, converting E.coli DH5 alpha, and finally obtaining positive clone pSV64. After culturing pSV64 in liquid, the plasmid was extracted and digested with the restriction enzyme AseI to linearize the fragment (at a concentration of 1. Mu.g/. Mu.L or more) for the next electrotransformation.

Full sequence of EQ ID NO. 1 transcription activation vector

Transcription activation vector complete sequence (reverse)

accggtttcttagacggatcgcttgcctgtaacttacacgcgcctcgtatcttttaatgatggaataatttgggaatttactctgtgtttatttatttttatgttttgtatttggattttagaaagtaaataaagaaggtagaagagttacggaatgaagaaaaaaaaataaacaaaggtttaaaaaatttcaacaaaaagcgtactttacatatatatttattagacaagaaaagcagattaaatagatatacattcgattaacgataagtaaaatgtaaaatcacaggattttcgtgtgtggtcttctacacagacaagatgaaacaattcggcattaatacctgagagcaggaagtacaagataaaaggtagtatttgttggcgatccccctagagtcttttacatcttcggaaaacaaaaactattttttctttaatttctttttttactttctatttttaatttatatatttatattaaaaaatttaaattataattatttttatagcacgtgatgaaaaggacccaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggtttaaaccaggtcactggattttggttttaggaattagaaattttattgatagaagtattttacaaatacaaatacatactaagggtttcttatatgctcaacacatgagcgaaaccctataagaaccctaattcccttatctgggaactactcacacattattctggagaaaaatagagagagatagatttgtagagagagactggtgatttttgcggactccggtcggcatctactactagcctattcctttgccctcggacgagtgctggggcgtcggtttccactatcggcgagtacttctacacagccatcggtccagacggccgcgcttctgcgggcgatttgtgtacgcccgacagtcccggctccggatcggacgattgcgtcgcatcgaccctgcgcccaagctgcatcatcgaaattgccgtcaaccaagctctgatagagttggtcaagaccaatgcggagcatatacgcccggagccgcggcgatcctgcaagctccggatgcctccgctcgaagtagcgcgtctgctgctccatacaagccaaccacggcctccagaagaagatgttggcgacctcgtattgggaatccccgaacatcgcctcgctccagtcaatgaccgctgttatgcggccattgtccgtcaggacattgttggagccgaaatccgcgtgcacgaggtgccggacttcggggcagtcctcggcccaaagcatcagctcatcgagagcctgcgcgacggacgcactgacggtgtcgtccatcacagtttgccagtgatacacatggggatcagcaatcgcgcatatgaaatcacgccatgtagtgtattgaccgattccttgcggtccgaatgggccgaacccgctcgtctggctaagatcggccgcagcgatcgcatccatggcctccgcgaccggctgcagaacagcgggcagttcggtttcaggcaggtcttgcaacgtgacaccctgtgcacggcgggagatgcaataggtcaggctctcgctgaattccccaatgtcaagcacttccggaatcgggagcgcggccgatgcaaagtgccgataaacataacgatctttgtagaaaccatcggcgcagctatttacccgcaggacatatccacgccctcctacatcgaagctgaaagcacgagattcttcgccctccgagagctgcatcaggtcggagacgctgtcgaacttttcgatcagaaacttctcgacagacgtcgcggtgagttcaggctttttcatatcttattgccccccggggccctcgactgtgttgatgcgggctgagattggtggtggtctatcacgaatatgtgtgaggggtaagtgcggtgttttgcgtgagattttagaatattgccccgccccggggcaggccggcgtggcggaacaaccaggcacacgagcgcgaatggtgataccgacggagtcaaaactttgtgacaagtagctgcaccatgggcagtggtgagctttcagacgtggtatcactgtccactagttcacacacagaatgcgtgtccaaaaggtctagagccgtctcgcttgcgtctctccgtcgaagaacagtgaagaggctcgtcacgtcgaccagacgacgggaggctggtcaccatcgcagatgtctcccacaaagcagcacggcaactcctactccttcacacaatggaagaaaaggtggtctgatggttctcagtggaaaagaacgatatcaggctgaaaaaaatgatctgcaggctccagattcctgaatcacgtcgactgtgacgaagcaaaccgcgtcgaacaacatcggtcatgccaacgggtctcgtctctcgagcccttttggcggcgactaagaagtatgaagcttcaggccgcaacgcgcgacacagcgttttgtgtggtgggcctcggcattgctctttgcatggcccagcgtgattagtgcgtggattttaagcccgagaccgaaggattgcgacatgtgcctggctgtataactcacgcttgctgctacgctcgcctcctcctccatccactccatcgcggccgccatggcctctagtggatcagcttgcatgcctgcaggagacgatatcacctcttctgtttccacgataaaaatagactgctcatttcttcgtcgtcttcatcgtctgctttttctgcttcgcctctgtctggggtctgaaaccactacacacacacacaacactcgtactcccactttcacaaaagcgtaagctcaccggcttttcttacacgtacattttagtggatcccatcacgccactaccacgcccgcgggggatggaacggaggggagagagagaagggggaagcatggatgaatgagacattgagggaaaggaggggagggagcagtccatcagggcgctacctctcttgtcccccaaaccctgttgagccgttcaacatgtttcatgtttcctccctccccccttccctccctggcctttccgcggagccattcaagtgacgtctggaccgcaccgtaacaaaatcgtttctatggggggtttgtttgacaaccacgtcttcagcgtttttaaaaaaaaaagcgggcaagccctctcaccctcactcatgcccatcctcctcctctcctgcggaacattcttacaaaaggcgtaactcgacgacaactcaaagaacgacaaacatcaatcccaaaaaaaaaatctctactcgtctctcttggatctttCCAATTGTCAGACCTTCCTCTTCTTTTTCGGGCTAGCcaccatGGACGCGTAGTCGGGCACGTCGTAGGGGTACAGCATGTCCAGGTCGAAGTCATCCAGGGCGTCCGAACCCAGCATATCCAGGTCGAAGTCGTCCAGCGCGTCCGAGCCCAGCATGTCCAGGTCAAAGTCGTCCAGGGCGTCCGAGCCCAGCATGTCGAGGTCGAAGTCGTCCAGCGCGTCCGCGTCCTCGACCTTGCGCTTCTTCTTCGGGTCCTCGGAGCCGCCGCCCGAGCCGCCACCCTTCTTCAGGCGGGCGACCTCATTCTCCAGGTGGTAGTTCTTGCTCAACAGCTCCTCGCCCGAGCCAGAGCCCTTCTTGAGGCGCGCGACCTCGTTCTCCAGGTGATAGTTCTTCGACAGGAGCTCCTCTCCGGATCCGGAGCCCTTCTTGAGGCGGGCCACTTCGTTCTCGAGGTGGTAGTTTTTGCTCAGGAGCTCCTCGCCGCTGCCGCTGCCCTTCTTTAGGCGCGCGACCTCGTTCTCGAGGTGGTAGTTCTTCGAGAGCAGCTCCTCCCCCGAGCCGCTGCCCTTCTTCAGACGGGCAACCTCGTTCTCAAGGTGGTAATTCTTCGACAGCAGTTCCTCGCCGGAGCCGGAGCCCTTCTTAAGGCGGGCAACCTCGTTCTCCAGATGGTAATTCTTGGAGAGAAGCTCCTCACCGCTGCCCGAGCCCTTCTTCAGCCGGGCCACCTCGTTCTCAAGGTGGTAGTTTTTGGACAGCAGTTCCTCGCCCGAGCCGGAACCCTTCTTCAGGCGGGCCACCTCGTTTTCGAGGTGGTAATTCTTGCTCAGCAGCTCCTCACCGCTGCCCGAGCCCTTCTTAAGGCGGGCCACTTCGTTCTCCAGATGGTAGTTCTTGCTGAGCAGCTCCTCGCCGCTGCCCGATCCCTTCTTGAGCCGCGCCACCTCGTTCTCGAGATGGTAGTTCTTCGACAGCAGCTCCTCCTCGGCGGCGTCGGTCGGGCCGTTCGAGCCGGACGAGCCGTTCGAGCCGGAGCCGATGCCGTCGACCTTGCGTTTCTTCTTCGGGGCGTCCTCGACCTTACGCTTCTTCTTGGGGTCCTCCACCTTGCGCTTCTTCTTCGGGTTAACGgacccgctgccggacccgtcagccctgctgtctccaccgagctgagagaggtcgattcttgtttcatagagccccgtaattgactgatgaatcagtgtggcgtccaggacctcctttgtagaggtgtaccgctttctgtctatggtggtgtcgaagtacttgaaggctgcaggcgcgcccaagttggtcagagtaaacaagtggataatgttttctgcctgctccctgatgggcttatccctgtgcttattgtaagcagaaagcaccttatcgaggttagcgtcggcgaggatcactcttttggagaattcgcttatttgctcgatgatctcatcaaggtagtgtttgtgttgttccacgaacagctgcttctgctcattatcttcgggagaccctttgagcttttcatagtggctggccagatacaagaaattaacgtatttagagggcagtgccagctcgttacctttctgcagctcgcccgcactagcgagcattcgtttccggccgttttcaagctcaaagagagagtacttgggaagcttaatgatgaggtcttttttgacctctttatatcctttcgcctcgagaaagtcgatggggtttttttcgaagcttgatcgctccatgattgtgatgcccagcagttccttgacgcttttgagttttttagacttccctttctccactttggccacaaccagtacactgtaagcgactgtaggagaatcgaatccgccgtatttcttggggtcccaatcttttttgcgtgcgatcagcttgtcgctgttccttttcgggaggatactttccttggagaagcctccggtctgtacttcggtctttttaacgatgttcacctgcggcatggacaggaccttccggactgtcgcgaaatccctacccttgtcccacacgatttctcctgtttctccgtttgtttcgataagtggtcgcttccgaatctctccattggccagtgtaatctcggtcttgaaaaaattcataatattgctgtaaaagaagtacttagcggtggccttgcctatttcctgctcagactttgcgatcattttcctaacatcgtacactttatagtctccgtaaacaaattcagattcaagcttgggatattttttgataagtgcagtgcctaccactgcattcaggtaggcatcatgcgcatggtggtaattgttgatctctctcaccttataaaactgaaagtcctttctgaaatctgagaccagcttagacttcagagtaataactttcacctctcgaatcagtttgtcattttcatcgtacttggtgttcatgcgtgaatcgagaatttgggccacgtgcttggtgatctggcgtgtctcaacaagctgccttttgatgaagccggctttatccaactcagacaggccacctcgttcagccttagtcagattatcgaacttccgttgtgtgatcagtttggcgttcagcagctgccgccaataatttttcattttcttgacaacttcttctgaggggacgttatcactcttccctctatttttatcggatcttgtcaacactttattatcaatagaatcatctttgagaaaagactggggcacgatggcatccacgtcgtagtcggagagccgattgatgtccagttcctgatccacgtacatgtccctgccgttctgcaggtagtacaggtagagcttctcattctgaagctgggtgttttcaactgggtgttccttaaggatttgggaccccagttcttttataccctcttcaatcctcttcatcctttccctactgttcttctgtcccttctgggtagtttggttctctcgggccatctcgataacgatattctcgggcttatgccttcccattactttgacgagttcatccacgaccttaacggtctgcagtattccctttttgatagctgggctacctgcaagattagcgatgtgctcgtgaagactgtccccctggccagaaacttgtgctttctggatgtcctccttaaaggtgagagagtcatcatggatcaactgcatgaagttccggttggcaaatccatcggacttaagaaaatccaggattgtctttccactctgcttgtctcggatcccattgatcagttttcttgacagccgcccccatcctgtatatcggcgcctcttgagctgtttcatgactttgtcgtcgaagagatgagcgtaagttttcaagcgttcttcaatcatctccctatcttcaaacaacgtaagggtgaggacaatgtcctcaagaatgtcctcgttctcctcattgtccaggaagtccttgtctttaatgattttcaggagatcgtgatacgttcccagggatgcgttgaagcgatcctccactccgctgatttcaacagagtcgaaacattcaatctttttgaaatagtcttctttgagctgtttcacggtaactttccggttcgtcttgaagaggaggtccacgatagctttcttctgctctccagacaggaatgctggctttctcatcccttctgtgacgtatttgaccttggtgagctcgttataaactgtgaagtactcgtacagcagagagtgtttaggaagcaccttttcgttaggcagatttttatcaaagttagtcatcctttcgatgaaggactgggcagaggcccccttatccacgacttcctcgaagttccagggagtgatggtctcttctgatttgcgagtcatccacgcgaatctggaatttccccgggcgagggggcctacatagtagggtatccgaaatgtgaggattttctcaatcttttccctgttatctttcaaaaaggggtagaaatcctcttgccgcctgaggatagcgtgcagttcgcccaggtgaatctggtgggggatgcttccattgtcgaaagtgcgctgtttgcgcaacagatcttctctgttaagctttaccagcagctcctcggtgccgtccattttttccaagatgggcttaataaatttgtaaaattcctcctggcttgctccgccgtcaatgtatccggcgtagccatttttagactgatcgaagaaaatttccttgtacttctcaggcagttgctgtctgacaagggccttcagcaaagtcaagtcttggtggtgctcatcatagcgcttgatcatactagcgctcagcggagctttggtgatctccgtgttcactcgcagaatatcactcagcagaatggcgtctgacaggttctttgccgccaaaaaaaggtctgcgtactggtcgccgatctgggccagcagattgtcgagatcatcatcgtaggtgtctttgctcagttgaagcttggcatcttcggccaggtcgaagttagatttaaagttgggggtcagcccgagtgacagggcgataagattaccaaacaggccgttcttcttctccccagggagctgtgcgatgaggttttcgagccgccgggatttggacagcctagcgctcaggattgctttggcgtcaactccggatgcgttgatcgggttctcttcgaaaagctgattgtaagtctgaaccagttggataaagagtttgtcgacatcgctgttgtctgggttcaggtccccctcgatgaggaagtgtccccgaaatttgatcatatgcgccagcgcgagatagatcaaccgcaagtcagccttatcagtactgtctacaagcttcttcctcagatgatatatggttgggtacttttcatggtacgccacctcgtccacgatattgccaaagattgggtggcgctcgtgctttttatcctcctccaccaaaaaggactcctccagcctatggaagaaagagtcatccaccttagccatctcattactaaagatctcctgcaggtagcagatccgattctttctgcgggtatatctgcgccgtgctgttcttttgagccgcgtggcttcggccgtctccccggagtcgaacaggagggcgccaatgaggttcttctttatgctgtggcgatcggtattgcccagaactttgaattttttgctcggcaccttgtactcgtccgtaatgacggcccagccgacgctgtttgtgccgatggcgagcccaatggagtacttcttgtccaccttccgctttttcttgggcatgctcgagggttgcgtgtgtatctgtgtgcagtggatattgttaccgagtttggtgagcgtgagtccgttagtgccctggtggtggtggattaggagagtgggtgactcggtgtccatggctttcttcgctcattataggaggggaaaggaatgagggagggtggggagaccgcgtctgttgttgaccaccgatttacttcttgcctcccttcccctccctcccctcaatccgtacgacacaaatagtagccgagtgtctgctgcagagcgcatgattagtgtggtagacaacgagggagggaaggatgtacagggcatggcacggagaagcgatggtggccaggaagaggagaggtcgcgagaacaggatgtgttgcgaatggataaaaacagaaagcgatggctctgggcttcgaaagcaggggacattaggacgtgtagaccatctcgacggatccctctgtatctctgttgtgcgtgaatgttttctgtgcacgtgtagtgtgtgagagtagaacccgggaactcgaacagagaaaagcatgggtggctgtggtgtggaggcttcgttcccaccacatgcccttctccttcgcctcgcctctccctgccttcttccacgcacccttgcgcccctcgttctcaatacctggctcacttccaccattcaaacaaccatcacgatacaggcatttatctatcgttgaagacttcttcctccggtagatcttagccaaggtaagaagaggggcatgcagcaaggagaaagaaatgatgcatgatgaggaatagaaggggaggagggagggatatgatgggaagcgaaagcgcatattctggtggtctgctgcctgatggggacgcgtctagctgtgacactgaggacggtggctgctggtggctgcgggcgctgccttggtgatcaatgggagtaaagggagggaaggaggtagcgtgaacggatgacgcggagaagtttaggggtctctttacgtatcgcccctgccgcccgcctctctgcgataaatgtgcctgttaccctgcagcctctattcttcactgtgttcctgttttccaacagcctctattcttccctgtcttttgttgcagtggcgtcatcctctctttgccccagtcgtcgttctctcgactcactcactccccccctccttccctccctccatccacagaatcgatgaagagcaggccttggctcttcgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttggccggcatggtcccagcctcctcgctggcgccggctgggcaacatgcttcggcatggcgaatgggactcctgggtaccatgggaaagaaaggatgagaaaggagaaaggacatctagataaccggcatatcacggtggtgtattagtgtagaatagtgaagagaagacttgggaaaatgtgtaggaaaggttgtttctgtgtatgtgggttgggatgggtggctgtttgagaaggaacagcgggcagggcgatgtagtgctgaacgggcacggaaccactgagactgaaggaagtagggagagagaggggcaggggacgtgcactttaatctttgcctcggtagagtatacccatgcaagagtatgtggccacctgtggtggcttttggccaggtctggtgcagtgccaatcatctcccatcaataatacaacttcagaacaacggcgcattgatggggagagagaaagtaaatttaagtaaggggtacgtagtagaggattcaactgaaatattttcgaggagcggttgggaagttgaccgattgaaaggagaagggaggggagcaggtgtgatagtcatgtgtaaagtaattcttttttgccgtcgtcacacaatccacatcaatgataaaatatgtttaaggatcaatcacacggagtcggtcataaggcaaccgcaaacgcaatgcaaactagcaagcaagcaggaccacaacaacaaccattaccatcacaggcgacagcagcagcagctgcagcagcagcaaggcaagcaaaggccatctgcgcgtggacttttccaggcaccggctttaagcgtaattttcaatgattgttgtccgtgtatcctctcaccctttcaccgcttgcgcgcacgtgagcagcacaactggtaatgcccgaggacaatagacgaggaaaaagaagaagaaaaatgaagagggagtgatgaagaagaagagaagaataaaagaagacagaaaagaagataaaaaagtcaaaagacgacaaagacggaaaaaaaagaaacgcgcaattttaacaccagcaacgacgacgaaaagggcgtcagctttgc

Length of DNA sequence: 12782bp

dCAS9 sequence (3 '-5'): from 6279bp to 10379bp, the length is 4101bp

VP64 sequence (3 '-5'): from 5187bp to 5336bp, the length is 150bp

SunTag sequence (3 '-5'): from 5397bp to 6101bp, the length is 705bp

Resistance gene Hyg sequence (3 '-5'): from 2617bp to 3642bp with length 1026bp

Promoter Ribi sequence (3 '-5'): from 10411bp to 11594bp, the length is 1184bp

The nuclear localization signal SLV40 sequence is: CCGAAAAAGAAGAGGAAGGTC

3. Electroporation method of introducing linearized vector fragment into nannochloropsis and selecting monoclonal

Taking Chlorella liquid cultured to logarithmic phase 1 hr before transformation, and its concentration is about 1-3×10 ⁷ cells/mL, centrifuged at 4500g for 5min at 4deg.C, the supernatant discarded, rinsed 2 times with 375mM sorbitol solution (pre-chilled to 4deg.C) and finally adjusted to a cell concentration of 2X 10 with 375mM sorbitol ⁸ cells/mL. The concentrated algae bodies were split into 200. Mu.l aliquots, each aliquot was added with 3-10. Mu.g of the linearized vector obtained in step two above and 1. Mu.l of denatured salmon sperm DNA (to a final concentration of 15. Mu.g/mL), and the mixture was placed on ice for 10min. After precooling, the mixture of algae liquid and carrier was transferred into a 2mm shock transforming cup, shocked at 2200V (HV), 50 μf, immediately after which algae were transferred into 5mL fresh F/2 medium. Culturing and recovering at low speed of 50rpm in a 25 ℃ shaking table, and recovering for 48 hours in weak light or darkness. Microalgae cells were spread evenly on f/2 solid plates of hygromycin (5. Mu.g/ml), after 15-25 days of culture, 10-20 were picked and placed on a 24-well plate for 14 days of culture. Colony PCR was used to verify whether the transformants were transformed successfully.

4. qPCR verification of transformant strain and target gene expression level by algae colony or algae liquid PCR method

Transformants were selected by the algae-colony or algae-liquid PCR method, i.e., 2. Mu.l of algae liquid was taken in using Q5 buffer produced by NEB company as a lysate, 2. Mu.l of Q5 buffer was added, and water was added to supplement 10. Mu.l, the mixture was boiled in boiling water for 10min or heated on a thermocycler for 10min, and after cooling to room temperature or 4 ℃, PCR amplification was performed by polymerase chain reaction with a premix of primers and Taq enzyme for PCR, and the transformants were verified by electrophoresis of the PCR products (FIG. 2). The positive transformants were subjected to liquid expansion culture for verification of the expression level of the target gene.

The mutant strain and the wild strain obtained are respectively treated with CO at the air level ₂ Culturing under concentration, and controlling light intensity to be consistent at 50umol/m ² The aeration rate was 100ml/min. Collecting microalgae when the microalgae is cultivated to logarithmic phase, centrifuging for 5min at 5000g, rapidly freezing with liquid nitrogen, and storing at-80deg.C.

The experimental measurement of the expression abundance of the mutant strain is divided into the following three steps:

extracting RNA in the first step, extracting RNA from cryopreserved algae cells (mutant strain or wild type), crushing algae cells by liquid nitrogen grinding, generally liquid nitrogen grinding for 5-10min, adding 1ml Trizol (Invitrogen company), rapidly and fully mixing, adding 200ul chloroform, centrifuging at 12000rpm for 10min, sucking supernatant, transferring to a new eppendorf tube, adding equal volume chloroform, fully shaking, mixing, standing for 2-3min, centrifuging at 12000rpm for 10min, transferring supernatant to a new centrifuge tube, adding equal volume isopropanol, precipitating at room temperature for 15min, centrifuging for 15min, washing precipitate with 75% ethanol, blow drying, and adding ddH processed with 50ul DEPC ₂ O, after measuring the concentration of RNA, storing at-80 ℃ for standby;

second, cDNA preparation, the RNA samples obtained above were subjected to Takara reagent

RT reagent Kit With gDNA Eraser kit the procedure illustrates the synthesis of cDNA using random primers, remarking a genomic DNA removal reaction system of 20ul, which includes 2ug total RNA, 5X reaction buffer and gDNA Eraser enzyme;

third, fluorescent quantitative PCR reaction is performed by

(rapid with Roche)And starting the universal green fluorescence) fluorescent quantitative qRT-PCR for quantification. The PCR reaction system was 1ul of cDNA (from the reverse transcription preparation of the previous step), 1ul of forward and reverse primers, 10ul of 2X Roche FastStart SYBR Green Master (ROX), and ddH ₂ O was added 7ul to 20ul, with the primer sequence being forward primer: 5 'tccgagaaatattgcgtccatgg 3'; reverse primer: 5 'TAATTTCCTCCAGCAACCAGGTGA 3'. The reaction conditions were performed with reference to the Roche kit. Analysis of real-time fluorescence qPCR result data using 2 ^-ΔΔCt In the method, the method comprises the steps of, wherein the method comprises the steps of ΔΔΔCt the value is (Ct _{CA-2209 gene} -Ct _{Reference gene} ) _{Mutant strains} -(Ct _{CA-2209 gene} -Ct _{Reference gene} ) _{Wild type} 。

The relative wild type gene expression abundance of the g1248 gene in the mutant was calculated by the above method, and as a result, it was confirmed that the g1248 gene expression abundance of the mutant (M4 or M7) was at air level CO ₂ Expression of the g1248 gene was significantly higher than wild-type g1248 under concentrated culture conditions, confirming that the g1248 gene was activated at the transcriptional level, approximately up-regulated 2-7-fold (fig. 3).

5. Physiological phenotype identification of target gene methyltransferase transcriptional activation mutants

The wild microalgae and the mutant strain (M4 and M7 are selected from the figure 4) are respectively inoculated into a fresh f/2 liquid culture medium in a 200ml column reactor, and are cultivated under the condition of ventilation, and physiological indexes such as a growth curve and photosynthesis parameters Fv/Fm are measured every day and cultivated for 6 days.

As a result of measurement, as shown in FIG. 5, the mutant strain was found to be at the air level CO ₂ Growth was significantly faster than the wild type at the concentration, and the growth rate increased by more than 20% over 10 days of culture (FIGS. 4 and 5). In addition, the photosynthesis parameters Fv/Fm of the mutant strain were also increased by 15% as compared to the wild type (FIG. 6), further confirming that the gene may regulate its function by affecting methylation of the photosynthesis gene. Therefore, the gene function of methyltransferase g1248 was initially verified by the gene transcription activation method, and the gene plays an important role in the growth of nannochloropsis, probably capable of indirectly regulating and controlling CO ₂ The specific function of this gene is to be studied intensively, for the fixation or important enzymes of photosynthesis.

6. Design of simultaneous transcriptional activation of multiple genes

To achieve simultaneous transcriptional activation of multiple genes, the gRNA sequences of multiple genes may be designed, then the multiple gRNA sequences designed (i.e., different grnas are designed corresponding to the different target genes associated with the trait) are concatenated with a short intermediate sequence (the short intermediate sequence may be a 20-40bp random sequence, no frame of reading may be considered, no special requirements such as CTTACCGCATGACTAATCTTTAAGGCTA), and BspQI cleavage sites are designed at both ends of the multiple gRNA tandem sequences, by which sites multiple grnas may be expressed synchronously with the vector described above under the driving of the initiation. Then, dCAS9 protein and a corresponding transcription activation domain are targeted to a plurality of specific genes by utilizing the guiding function of the gene, so that the simultaneous transcription activation of a plurality of genes can be realized, and the genes in the same metabolic pathway can be designed as target genes, so that the whole metabolic pathway is activated.

Sequence listing

<110> university of Hainan teachers and students

<120> construction of CRISPRa system for transcriptional activation of marine nannochloropsis and application thereof

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 12782

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

accggtttct tagacggatc gcttgcctgt aacttacacg cgcctcgtat cttttaatga 60

tggaataatt tgggaattta ctctgtgttt atttattttt atgttttgta tttggatttt 120

agaaagtaaa taaagaaggt agaagagtta cggaatgaag aaaaaaaaat aaacaaaggt 180

ttaaaaaatt tcaacaaaaa gcgtacttta catatatatt tattagacaa gaaaagcaga 240

ttaaatagat atacattcga ttaacgataa gtaaaatgta aaatcacagg attttcgtgt 300

gtggtcttct acacagacaa gatgaaacaa ttcggcatta atacctgaga gcaggaagta 360

caagataaaa ggtagtattt gttggcgatc cccctagagt cttttacatc ttcggaaaac 420

aaaaactatt ttttctttaa tttctttttt tactttctat ttttaattta tatatttata 480

ttaaaaaatt taaattataa ttatttttat agcacgtgat gaaaaggacc caggtggcac 540

ttttcgggga aatgtgcgcg gaacccctat ttgtttattt ttctaaatac attcaaatat 600

gtatccgctc atgagacaat aaccctgata aatgcttcaa taatattgaa aaaggaagag 660

tatgagtatt caacatttcc gtgtcgccct tattcccttt tttgcggcat tttgccttcc 720

tgtttttgct cacccagaaa cgctggtgaa agtaaaagat gctgaagatc agttgggtgc 780

acgagtgggt tacatcgaac tggatctcaa cagcggtaag atccttgaga gttttcgccc 840

cgaagaacgt tttccaatga tgagcacttt taaagttctg ctatgtggcg cggtattatc 900

ccgtattgac gccgggcaag agcaactcgg tcgccgcata cactattctc agaatgactt 960

ggttgagtac tcaccagtca cagaaaagca tcttacggat ggcatgacag taagagaatt 1020

atgcagtgct gccataacca tgagtgataa cactgcggcc aacttacttc tgacaacgat 1080

cggaggaccg aaggagctaa ccgctttttt gcacaacatg ggggatcatg taactcgcct 1140

tgatcgttgg gaaccggagc tgaatgaagc cataccaaac gacgagcgtg acaccacgat 1200

gcctgtagca atggcaacaa cgttgcgcaa actattaact ggcgaactac ttactctagc 1260

ttcccggcaa caattaatag actggatgga ggcggataaa gttgcaggac cacttctgcg 1320

ctcggccctt ccggctggct ggtttattgc tgataaatct ggagccggtg agcgtgggtc 1380

tcgcggtatc attgcagcac tggggccaga tggtaagccc tcccgtatcg tagttatcta 1440

cacgacgggg agtcaggcaa ctatggatga acgaaataga cagatcgctg agataggtgc 1500

ctcactgatt aagcattggt aactgtcaga ccaagtttac tcatatatac tttagattga 1560

tttaaaactt catttttaat ttaaaaggat ctaggtgaag atcctttttg ataatctcat 1620

gaccaaaatc ccttaacgtg agttttcgtt ccactgagcg tcagaccccg tagaaaagat 1680

caaaggatct tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc aaacaaaaaa 1740

accaccgcta ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc tttttccgaa 1800

ggtaactggc ttcagcagag cgcagatacc aaatactgtt cttctagtgt agccgtagtt 1860

aggccaccac ttcaagaact ctgtagcacc gcctacatac ctcgctctgc taatcctgtt 1920

accagtggct gctgccagtg gcgataagtc gtgtcttacc gggttggact caagacgata 1980

gttaccggat aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac agcccagctt 2040

ggagcgaacg acctacaccg aactgagata cctacagcgt gagctatgag aaagcgccac 2100

gcttcccgaa gggagaaagg cggacaggta tccggtaagc ggcagggtcg gaacaggaga 2160

gcgcacgagg gagcttccag ggggaaacgc ctggtatctt tatagtcctg tcgggtttcg 2220

ccacctctga cttgagcgtc gatttttgtg atgctcgtca ggggggcgga gcctatggaa 2280

aaacgccagc aacgcggcct ttttacggtt cctggccttt tgctggcctt ttgctcacat 2340

gttctttcct gcgttatccc ctgattctgt ggtttaaacc aggtcactgg attttggttt 2400

taggaattag aaattttatt gatagaagta ttttacaaat acaaatacat actaagggtt 2460

tcttatatgc tcaacacatg agcgaaaccc tataagaacc ctaattccct tatctgggaa 2520

ctactcacac attattctgg agaaaaatag agagagatag atttgtagag agagactggt 2580

gatttttgcg gactccggtc ggcatctact actagcctat tcctttgccc tcggacgagt 2640

gctggggcgt cggtttccac tatcggcgag tacttctaca cagccatcgg tccagacggc 2700

cgcgcttctg cgggcgattt gtgtacgccc gacagtcccg gctccggatc ggacgattgc 2760

gtcgcatcga ccctgcgccc aagctgcatc atcgaaattg ccgtcaacca agctctgata 2820

gagttggtca agaccaatgc ggagcatata cgcccggagc cgcggcgatc ctgcaagctc 2880

cggatgcctc cgctcgaagt agcgcgtctg ctgctccata caagccaacc acggcctcca 2940

gaagaagatg ttggcgacct cgtattggga atccccgaac atcgcctcgc tccagtcaat 3000

gaccgctgtt atgcggccat tgtccgtcag gacattgttg gagccgaaat ccgcgtgcac 3060

gaggtgccgg acttcggggc agtcctcggc ccaaagcatc agctcatcga gagcctgcgc 3120

gacggacgca ctgacggtgt cgtccatcac agtttgccag tgatacacat ggggatcagc 3180

aatcgcgcat atgaaatcac gccatgtagt gtattgaccg attccttgcg gtccgaatgg 3240

gccgaacccg ctcgtctggc taagatcggc cgcagcgatc gcatccatgg cctccgcgac 3300

cggctgcaga acagcgggca gttcggtttc aggcaggtct tgcaacgtga caccctgtgc 3360

acggcgggag atgcaatagg tcaggctctc gctgaattcc ccaatgtcaa gcacttccgg 3420

aatcgggagc gcggccgatg caaagtgccg ataaacataa cgatctttgt agaaaccatc 3480

ggcgcagcta tttacccgca ggacatatcc acgccctcct acatcgaagc tgaaagcacg 3540

agattcttcg ccctccgaga gctgcatcag gtcggagacg ctgtcgaact tttcgatcag 3600

aaacttctcg acagacgtcg cggtgagttc aggctttttc atatcttatt gccccccggg 3660

gccctcgact gtgttgatgc gggctgagat tggtggtggt ctatcacgaa tatgtgtgag 3720

gggtaagtgc ggtgttttgc gtgagatttt agaatattgc cccgccccgg ggcaggccgg 3780

cgtggcggaa caaccaggca cacgagcgcg aatggtgata ccgacggagt caaaactttg 3840

tgacaagtag ctgcaccatg ggcagtggtg agctttcaga cgtggtatca ctgtccacta 3900

gttcacacac agaatgcgtg tccaaaaggt ctagagccgt ctcgcttgcg tctctccgtc 3960

gaagaacagt gaagaggctc gtcacgtcga ccagacgacg ggaggctggt caccatcgca 4020

gatgtctccc acaaagcagc acggcaactc ctactccttc acacaatgga agaaaaggtg 4080

gtctgatggt tctcagtgga aaagaacgat atcaggctga aaaaaatgat ctgcaggctc 4140

cagattcctg aatcacgtcg actgtgacga agcaaaccgc gtcgaacaac atcggtcatg 4200

ccaacgggtc tcgtctctcg agcccttttg gcggcgacta agaagtatga agcttcaggc 4260

cgcaacgcgc gacacagcgt tttgtgtggt gggcctcggc attgctcttt gcatggccca 4320

gcgtgattag tgcgtggatt ttaagcccga gaccgaagga ttgcgacatg tgcctggctg 4380

tataactcac gcttgctgct acgctcgcct cctcctccat ccactccatc gcggccgcca 4440

tggcctctag tggatcagct tgcatgcctg caggagacga tatcacctct tctgtttcca 4500

cgataaaaat agactgctca tttcttcgtc gtcttcatcg tctgcttttt ctgcttcgcc 4560

tctgtctggg gtctgaaacc actacacaca cacacaacac tcgtactccc actttcacaa 4620

aagcgtaagc tcaccggctt ttcttacacg tacattttag tggatcccat cacgccacta 4680

ccacgcccgc gggggatgga acggagggga gagagagaag ggggaagcat ggatgaatga 4740

gacattgagg gaaaggaggg gagggagcag tccatcaggg cgctacctct cttgtccccc 4800

aaaccctgtt gagccgttca acatgtttca tgtttcctcc ctcccccctt ccctccctgg 4860

cctttccgcg gagccattca agtgacgtct ggaccgcacc gtaacaaaat cgtttctatg 4920

gggggtttgt ttgacaacca cgtcttcagc gtttttaaaa aaaaaagcgg gcaagccctc 4980

tcaccctcac tcatgcccat cctcctcctc tcctgcggaa cattcttaca aaaggcgtaa 5040

ctcgacgaca actcaaagaa cgacaaacat caatcccaaa aaaaaaatct ctactcgtct 5100

ctcttggatc tttccaattg tcagaccttc ctcttctttt tcgggctagc caccatggac 5160

gcgtagtcgg gcacgtcgta ggggtacagc atgtccaggt cgaagtcatc cagggcgtcc 5220

gaacccagca tatccaggtc gaagtcgtcc agcgcgtccg agcccagcat gtccaggtca 5280

aagtcgtcca gggcgtccga gcccagcatg tcgaggtcga agtcgtccag cgcgtccgcg 5340

tcctcgacct tgcgcttctt cttcgggtcc tcggagccgc cgcccgagcc gccacccttc 5400

ttcaggcggg cgacctcatt ctccaggtgg tagttcttgc tcaacagctc ctcgcccgag 5460

ccagagccct tcttgaggcg cgcgacctcg ttctccaggt gatagttctt cgacaggagc 5520

tcctctccgg atccggagcc cttcttgagg cgggccactt cgttctcgag gtggtagttt 5580

ttgctcagga gctcctcgcc gctgccgctg cccttcttta ggcgcgcgac ctcgttctcg 5640

aggtggtagt tcttcgagag cagctcctcc cccgagccgc tgcccttctt cagacgggca 5700

acctcgttct caaggtggta attcttcgac agcagttcct cgccggagcc ggagcccttc 5760

ttaaggcggg caacctcgtt ctccagatgg taattcttgg agagaagctc ctcaccgctg 5820

cccgagccct tcttcagccg ggccacctcg ttctcaaggt ggtagttttt ggacagcagt 5880

tcctcgcccg agccggaacc cttcttcagg cgggccacct cgttttcgag gtggtaattc 5940

ttgctcagca gctcctcacc gctgcccgag cccttcttaa ggcgggccac ttcgttctcc 6000

agatggtagt tcttgctgag cagctcctcg ccgctgcccg atcccttctt gagccgcgcc 6060

acctcgttct cgagatggta gttcttcgac agcagctcct cctcggcggc gtcggtcggg 6120

ccgttcgagc cggacgagcc gttcgagccg gagccgatgc cgtcgacctt gcgtttcttc 6180

ttcggggcgt cctcgacctt acgcttcttc ttggggtcct ccaccttgcg cttcttcttc 6240

gggttaacgg acccgctgcc ggacccgtca gccctgctgt ctccaccgag ctgagagagg 6300

tcgattcttg tttcatagag ccccgtaatt gactgatgaa tcagtgtggc gtccaggacc 6360

tcctttgtag aggtgtaccg ctttctgtct atggtggtgt cgaagtactt gaaggctgca 6420

ggcgcgccca agttggtcag agtaaacaag tggataatgt tttctgcctg ctccctgatg 6480

ggcttatccc tgtgcttatt gtaagcagaa agcaccttat cgaggttagc gtcggcgagg 6540

atcactcttt tggagaattc gcttatttgc tcgatgatct catcaaggta gtgtttgtgt 6600

tgttccacga acagctgctt ctgctcatta tcttcgggag accctttgag cttttcatag 6660

tggctggcca gatacaagaa attaacgtat ttagagggca gtgccagctc gttacctttc 6720

tgcagctcgc ccgcactagc gagcattcgt ttccggccgt tttcaagctc aaagagagag 6780

tacttgggaa gcttaatgat gaggtctttt ttgacctctt tatatccttt cgcctcgaga 6840

aagtcgatgg ggtttttttc gaagcttgat cgctccatga ttgtgatgcc cagcagttcc 6900

ttgacgcttt tgagtttttt agacttccct ttctccactt tggccacaac cagtacactg 6960

taagcgactg taggagaatc gaatccgccg tatttcttgg ggtcccaatc ttttttgcgt 7020

gcgatcagct tgtcgctgtt ccttttcggg aggatacttt ccttggagaa gcctccggtc 7080

tgtacttcgg tctttttaac gatgttcacc tgcggcatgg acaggacctt ccggactgtc 7140

gcgaaatccc tacccttgtc ccacacgatt tctcctgttt ctccgtttgt ttcgataagt 7200

ggtcgcttcc gaatctctcc attggccagt gtaatctcgg tcttgaaaaa attcataata 7260

ttgctgtaaa agaagtactt agcggtggcc ttgcctattt cctgctcaga ctttgcgatc 7320

attttcctaa catcgtacac tttatagtct ccgtaaacaa attcagattc aagcttggga 7380

tattttttga taagtgcagt gcctaccact gcattcaggt aggcatcatg cgcatggtgg 7440

taattgttga tctctctcac cttataaaac tgaaagtcct ttctgaaatc tgagaccagc 7500

ttagacttca gagtaataac tttcacctct cgaatcagtt tgtcattttc atcgtacttg 7560

gtgttcatgc gtgaatcgag aatttgggcc acgtgcttgg tgatctggcg tgtctcaaca 7620

agctgccttt tgatgaagcc ggctttatcc aactcagaca ggccacctcg ttcagcctta 7680

gtcagattat cgaacttccg ttgtgtgatc agtttggcgt tcagcagctg ccgccaataa 7740

tttttcattt tcttgacaac ttcttctgag gggacgttat cactcttccc tctattttta 7800

tcggatcttg tcaacacttt attatcaata gaatcatctt tgagaaaaga ctggggcacg 7860

atggcatcca cgtcgtagtc ggagagccga ttgatgtcca gttcctgatc cacgtacatg 7920

tccctgccgt tctgcaggta gtacaggtag agcttctcat tctgaagctg ggtgttttca 7980

actgggtgtt ccttaaggat ttgggacccc agttctttta taccctcttc aatcctcttc 8040

atcctttccc tactgttctt ctgtcccttc tgggtagttt ggttctctcg ggccatctcg 8100

ataacgatat tctcgggctt atgccttccc attactttga cgagttcatc cacgacctta 8160

acggtctgca gtattccctt tttgatagct gggctacctg caagattagc gatgtgctcg 8220

tgaagactgt ccccctggcc agaaacttgt gctttctgga tgtcctcctt aaaggtgaga 8280

gagtcatcat ggatcaactg catgaagttc cggttggcaa atccatcgga cttaagaaaa 8340

tccaggattg tctttccact ctgcttgtct cggatcccat tgatcagttt tcttgacagc 8400

cgcccccatc ctgtatatcg gcgcctcttg agctgtttca tgactttgtc gtcgaagaga 8460

tgagcgtaag ttttcaagcg ttcttcaatc atctccctat cttcaaacaa cgtaagggtg 8520

aggacaatgt cctcaagaat gtcctcgttc tcctcattgt ccaggaagtc cttgtcttta 8580

atgattttca ggagatcgtg atacgttccc agggatgcgt tgaagcgatc ctccactccg 8640

ctgatttcaa cagagtcgaa acattcaatc tttttgaaat agtcttcttt gagctgtttc 8700

acggtaactt tccggttcgt cttgaagagg aggtccacga tagctttctt ctgctctcca 8760

gacaggaatg ctggctttct catcccttct gtgacgtatt tgaccttggt gagctcgtta 8820

taaactgtga agtactcgta cagcagagag tgtttaggaa gcaccttttc gttaggcaga 8880

tttttatcaa agttagtcat cctttcgatg aaggactggg cagaggcccc cttatccacg 8940

acttcctcga agttccaggg agtgatggtc tcttctgatt tgcgagtcat ccacgcgaat 9000

ctggaatttc cccgggcgag ggggcctaca tagtagggta tccgaaatgt gaggattttc 9060

tcaatctttt ccctgttatc tttcaaaaag gggtagaaat cctcttgccg cctgaggata 9120

gcgtgcagtt cgcccaggtg aatctggtgg gggatgcttc cattgtcgaa agtgcgctgt 9180

ttgcgcaaca gatcttctct gttaagcttt accagcagct cctcggtgcc gtccattttt 9240

tccaagatgg gcttaataaa tttgtaaaat tcctcctggc ttgctccgcc gtcaatgtat 9300

ccggcgtagc catttttaga ctgatcgaag aaaatttcct tgtacttctc aggcagttgc 9360

tgtctgacaa gggccttcag caaagtcaag tcttggtggt gctcatcata gcgcttgatc 9420

atactagcgc tcagcggagc tttggtgatc tccgtgttca ctcgcagaat atcactcagc 9480

agaatggcgt ctgacaggtt ctttgccgcc aaaaaaaggt ctgcgtactg gtcgccgatc 9540

tgggccagca gattgtcgag atcatcatcg taggtgtctt tgctcagttg aagcttggca 9600

tcttcggcca ggtcgaagtt agatttaaag ttgggggtca gcccgagtga cagggcgata 9660

agattaccaa acaggccgtt cttcttctcc ccagggagct gtgcgatgag gttttcgagc 9720

cgccgggatt tggacagcct agcgctcagg attgctttgg cgtcaactcc ggatgcgttg 9780

atcgggttct cttcgaaaag ctgattgtaa gtctgaacca gttggataaa gagtttgtcg 9840

acatcgctgt tgtctgggtt caggtccccc tcgatgagga agtgtccccg aaatttgatc 9900

atatgcgcca gcgcgagata gatcaaccgc aagtcagcct tatcagtact gtctacaagc 9960

ttcttcctca gatgatatat ggttgggtac ttttcatggt acgccacctc gtccacgata 10020

ttgccaaaga ttgggtggcg ctcgtgcttt ttatcctcct ccaccaaaaa ggactcctcc 10080

agcctatgga agaaagagtc atccacctta gccatctcat tactaaagat ctcctgcagg 10140

tagcagatcc gattctttct gcgggtatat ctgcgccgtg ctgttctttt gagccgcgtg 10200

gcttcggccg tctccccgga gtcgaacagg agggcgccaa tgaggttctt ctttatgctg 10260

tggcgatcgg tattgcccag aactttgaat tttttgctcg gcaccttgta ctcgtccgta 10320

atgacggccc agccgacgct gtttgtgccg atggcgagcc caatggagta cttcttgtcc 10380

accttccgct ttttcttggg catgctcgag ggttgcgtgt gtatctgtgt gcagtggata 10440

ttgttaccga gtttggtgag cgtgagtccg ttagtgccct ggtggtggtg gattaggaga 10500

gtgggtgact cggtgtccat ggctttcttc gctcattata ggaggggaaa ggaatgaggg 10560

agggtgggga gaccgcgtct gttgttgacc accgatttac ttcttgcctc ccttcccctc 10620

cctcccctca atccgtacga cacaaatagt agccgagtgt ctgctgcaga gcgcatgatt 10680

agtgtggtag acaacgaggg agggaaggat gtacagggca tggcacggag aagcgatggt 10740

ggccaggaag aggagaggtc gcgagaacag gatgtgttgc gaatggataa aaacagaaag 10800

cgatggctct gggcttcgaa agcaggggac attaggacgt gtagaccatc tcgacggatc 10860

cctctgtatc tctgttgtgc gtgaatgttt tctgtgcacg tgtagtgtgt gagagtagaa 10920

cccgggaact cgaacagaga aaagcatggg tggctgtggt gtggaggctt cgttcccacc 10980

acatgccctt ctccttcgcc tcgcctctcc ctgccttctt ccacgcaccc ttgcgcccct 11040

cgttctcaat acctggctca cttccaccat tcaaacaacc atcacgatac aggcatttat 11100

ctatcgttga agacttcttc ctccggtaga tcttagccaa ggtaagaaga ggggcatgca 11160

gcaaggagaa agaaatgatg catgatgagg aatagaaggg gaggagggag ggatatgatg 11220

ggaagcgaaa gcgcatattc tggtggtctg ctgcctgatg gggacgcgtc tagctgtgac 11280

actgaggacg gtggctgctg gtggctgcgg gcgctgcctt ggtgatcaat gggagtaaag 11340

ggagggaagg aggtagcgtg aacggatgac gcggagaagt ttaggggtct ctttacgtat 11400

cgcccctgcc gcccgcctct ctgcgataaa tgtgcctgtt accctgcagc ctctattctt 11460

cactgtgttc ctgttttcca acagcctcta ttcttccctg tcttttgttg cagtggcgtc 11520

atcctctctt tgccccagtc gtcgttctct cgactcactc actccccccc tccttccctc 11580

cctccatcca cagaatcgat gaagagcagg ccttggctct tcgttttaga gctagaaata 11640

gcaagttaaa ataaggctag tccgttatca acttgaaaaa gtggcaccga gtcggtgctt 11700

ttggccggca tggtcccagc ctcctcgctg gcgccggctg ggcaacatgc ttcggcatgg 11760

cgaatgggac tcctgggtac catgggaaag aaaggatgag aaaggagaaa ggacatctag 11820

ataaccggca tatcacggtg gtgtattagt gtagaatagt gaagagaaga cttgggaaaa 11880

tgtgtaggaa aggttgtttc tgtgtatgtg ggttgggatg ggtggctgtt tgagaaggaa 11940

cagcgggcag ggcgatgtag tgctgaacgg gcacggaacc actgagactg aaggaagtag 12000

ggagagagag gggcagggga cgtgcacttt aatctttgcc tcggtagagt atacccatgc 12060

aagagtatgt ggccacctgt ggtggctttt ggccaggtct ggtgcagtgc caatcatctc 12120

ccatcaataa tacaacttca gaacaacggc gcattgatgg ggagagagaa agtaaattta 12180

agtaaggggt acgtagtaga ggattcaact gaaatatttt cgaggagcgg ttgggaagtt 12240

gaccgattga aaggagaagg gaggggagca ggtgtgatag tcatgtgtaa agtaattctt 12300

ttttgccgtc gtcacacaat ccacatcaat gataaaatat gtttaaggat caatcacacg 12360

gagtcggtca taaggcaacc gcaaacgcaa tgcaaactag caagcaagca ggaccacaac 12420

aacaaccatt accatcacag gcgacagcag cagcagctgc agcagcagca aggcaagcaa 12480

aggccatctg cgcgtggact tttccaggca ccggctttaa gcgtaatttt caatgattgt 12540

tgtccgtgta tcctctcacc ctttcaccgc ttgcgcgcac gtgagcagca caactggtaa 12600

tgcccgagga caatagacga ggaaaaagaa gaagaaaaat gaagagggag tgatgaagaa 12660

gaagagaaga ataaaagaag acagaaaaga agataaaaaa gtcaaaagac gacaaagacg 12720

gaaaaaaaag aaacgcgcaa ttttaacacc agcaacgacg acgaaaaggg cgtcagcttt 12780

gc 12782

Claims (6)

1. A marine nannochloropsis transcriptional activation crispla system vector, which is characterized in that the system vector comprises a Cas9 inactivating protein (namely dCas9 protein), a transcriptional activation effector protein VP64, a resistance selection marker gene, at least one gRNA scaffold sequence and a specific sequence SunTag sequence for enhancing transcriptional activation;

the system vector takes a Cas9 expression vector pNOC-ARS-CRISPR of the nannochloropsis as a framework, and contains an endogenous promoter and a terminator, wherein the promoter is a Ribi bidirectional promoter and a LDSP promoter, and the terminator is a LDSP terminator;

one end of a Ribi bidirectional promoter in the skeleton carrier is sequentially connected with dCAS9 protein, a specific sequence SunTag sequence for enhancing transcriptional activation and transcriptional activation effector protein VP64; the other end is connected with a gRNA bracket sequence which drives gRNA expression; the hygromycin resistance gene is positioned downstream of the skeleton vector LDSP promoter;

the Cas9 inactivated protein, the transcriptional activation effector protein VP64, the resistance selection marker gene, the gRNA bracket sequence and the specific sequence SunTag sequence for enhancing transcriptional activation are respectively corresponding gene sequences after the codon optimization of the nannochloropsis; wherein the coding nucleic acid sequence of the codon-optimized dCAS9 protein is from 6279bp to 10379bp in SEQ ID NO. 1, the coding nucleic acid sequence of the codon-optimized transcription activation effector protein VP64 is from 5187bp to 5336bp in SEQ ID NO. 1, the codon-optimized resistance selection marker gene is from 2617bp to 3642bp in SEQ ID NO. 1, and the codon-optimized specific sequence SunTag for enhancing transcription activation is from 5397bp to 6101bp in SEQ ID NO. 1.

2. A method of constructing the system carrier of claim 1, comprising the steps of:

(1) Constructing an expression vector containing Cas9 inactivated protein, transcriptional activation effector protein VP64 and a SunTag sequence for enhancing transcriptional activation by using a framework vector, and driving the expression by the same promoter;

(2) Construction of specific gRNA sequences the expression vector in step (1) is ligated to construct a transcription activation vector, i.e.the system vector of claim 1.

3. A method of constructing the system carrier of claim 1, comprising the steps of:

(1) Construction of recombinant plasmids: constructing a gene containing a Cas9 inactivated protein, a promoter and a terminator and a hygromycin resistance gene by utilizing a skeleton vector, and inactivating the original carrier Cas9 protein into dCS 9 protein;

(2) The transcriptional activation effector protein VP64 and the SunTag sequence for enhancing transcriptional activation are connected to the downstream of dCAS9 protein and are driven to express by the same promoter;

(3) At least one gRNA scaffold sequence is connected to the recombinant plasmid, so that a transcription activation vector, namely the system vector of claim 1, is constructed.

4. Use of the system vector of claim 1 in metabolic engineering and synthetic biology research of nannochloropsis.

5. A host cell characterized in that said host cell is a vector comprising the system of claim 1.

6. The host cell of claim 5, wherein the host is a marine nannochloropsis.

Images