CN113736797B

CN113736797B - Culture method for improving yield of microalgae Triglyceride (TAG) and application thereof

Info

Publication number: CN113736797B
Application number: CN202010459816.6A
Authority: CN
Inventors: 张鹏; 辛一; 徐健
Original assignee: Qingdao Institute of Bioenergy and Bioprocess Technology of CAS
Current assignee: Shandong energy research institute
Priority date: 2020-05-27
Filing date: 2020-05-27
Publication date: 2023-08-15
Anticipated expiration: 2040-05-27
Also published as: WO2021239071A1; CN113736797A

Abstract

The invention belongs to the field of biotechnology. The invention relates to a functional gene affecting Triglyceride (TAG) synthesis, a culture method capable of efficiently improving the yield of microalgae TAG, and a combined application thereof in efficiently improving the yield of microalgae TAG. The gene NobZIP77 that affects Triglyceride (TAG) synthesis 1) has the base sequence shown in SEQ ID NO 1; or 2) DNA sequence which has more than 95% homology with the nucleic acid sequence limited by the sequence 1 in the sequence table and codes the same biological functional protein. The gene and the amino acid sequence obtained by the invention are the first reports in microalgae, and the knockout of the gene can obviously improve the capability of synthesizing TAG by the nannochloropsis, and in addition, the TAG yield of the nannochloropsis can be improved by combining the genetic engineering and the culture method, so that the method has application potential in the industries of biological energy and health care products.

Description

Culture method for improving yield of microalgae Triglyceride (TAG) and application thereof

Technical Field

The invention belongs to the field of biotechnology. The invention relates to a functional gene affecting Triglyceride (TAG) synthesis, a culture method capable of efficiently improving the yield of microalgae TAG, and a combined application thereof in efficiently improving the yield of microalgae TAG.

Background

Under the guidance of the current concept of energy conservation and emission reduction, the development of renewable energy sources is a popular research direction. Biofuel plays an important role in the development of renewable energy sources, where biodiesel is more suitable for current internal combustion engines and in addition possesses many features over petroleum such as reduced carbon monoxide emissions and improved combustion efficiency, etc. Unlike bioethanol and natural gas, biodiesel can be efficiently distributed using currently mature petroleum transportation systems, which creates advantages for its large-scale popularization. Biodiesel is derived mainly from Triglycerides (TAG) in plants. Theoretically, if oil crops are produced on a large scale, the current energy requirements must be met, however, this approach also creates problems including competing for food and land with humans, increasing net carbon emissions, and so on. In this case, oleaginous microalgae are an important concern for the biodiesel industry. Most microalgae have higher TAG unit yield than terrestrial plants, and the TAG content of some microalgae is reported to be more than 75% of dry weight, in addition, microalgae are cultivated without occupying cultivated land, and have the potential of being cultivated on water, marine algae further avoid the hidden danger of competing with people for fresh water, so that microalgae have quite optimistic prospect for oil production.

However, even in oleaginous microalgae, TAG is not accumulated under good culture conditions, and it is necessary to stress-culture them. The most commonly used stress method at present is nitrogen deficiency culture, which is divided into natural nitrogen deficiency and two-step nitrogen deficiency, however, the natural nitrogen deficiency needs long-term culture, the time cost is higher, the two-step method needs artificial nitrogen deficiency, and the time cost can be obviously reduced, but the cost of manpower and material resources is higher. In view of the foregoing, there is a need to develop a low-cost technology for efficiently increasing the yield of microalgae TAG, so as to promote the development of microalgae biodiesel industry. The current common methods include a process control method and a metabolic engineering method, wherein the process control method pays attention to exogenous factors and has the characteristics of blindness and quick response; the metabolic engineering method focuses on the intrinsic cause, has the characteristics of rationality but insufficient obvious effect, and in recent years, the problem of effect is solved to a great extent by replacing key enzymes with transcription factors, so that the utilization of the transcription factors for efficiently improving the yield of microalgae TAG has become the development direction in the industry.

As outstanding representation of industrial oil-producing microalgae, the nannochloropsis has the advantages of high photosynthetic efficiency, strong carbon fixation capacity, high TAG content and the like, so that the nannochloropsis is an ideal species for applying the method. The early-stage research shows that the lipid content of the nannochloropsis can be respectively improved by 26.9 percent and 39.4 percent (Sung, 2018) compared with the lipid content of the control group by 10 days of red light and blue light, which indicates that the light quality is likely to become an environmental factor for effectively improving the TAG yield of the nannochloropsis. In addition, transcription factor prediction and transformation of nannochloropsis have been reported (Hu, 2014; kang, 2015), and an objective foundation is laid for the development of the technology.

Disclosure of Invention

The invention aims to invent a gene with Triglyceride (TAG) synthesis regulation function, a culture method capable of efficiently improving the yield of microalgae TAG, and application of the gene in efficiently improving the yield of microalgae TAG.

In order to achieve the above purpose, the invention adopts the following technical scheme:

a gene NobZIP77 affecting the synthesis of Triglyceride (TAG),

1) Has a base sequence shown in SEQ ID NO 1;

or alternatively, the first and second heat exchangers may be,

2) DNA sequences which have more than 95 percent of homology with the nucleic acid sequences limited by the sequence 1 in the sequence table and code the same biological functional protein.

A protein encoded by the gene, the protein encoded by the gene having an amino acid sequence of one of:

1) Has an amino acid sequence shown in SEQ ID NO 2;

2) An amino acid sequence of a derivative protein produced by substitution, deletion or addition of one or more amino acid residues to the amino acid residue sequence of SEQ ID NO 2, which has the same biological function as the protein of SEQ ID NO 2.

A vector for increasing microalgae Triglyceride (TAG) production, said vector comprising a base sequence that results in NobZIP77 gene silencing.

The vector is formed by combining a vector with a BspQI cohesive end serving as a framework with a double-stranded fragment with the BspQI cohesive end formed by annealing a single-stranded primer with a ribozyme gene and a NobZIP77 gRNA target sequence.

The carrier has a base sequence shown in SEQ ID NO 3.

A nannochloropsis genetically engineered strain has the NobZIP77 gene silenced, which contains the vector in the genome. The host bacteria are the industrial alga strain IMET1 of the nannochloropsis.

A culture method for improving microalgae TAG yield comprises culturing engineering bacteria into culture solution, and applying 30-50 μmol photons m ^-2 s ^-1 Is cultured for 3-4 days.

Or;

1) Using the nannochloropsis genetically engineered strain;

and, in addition, the method comprises the steps of,

2) The culture method comprises the following steps: culturing engineering strain to contain NaNO ₃ Adding 30-50. Mu. Mol of photons m into 2-4g/L culture solution ^-2 s ^-1 Is cultured for 9-12 days, and then 30-50 mu mol of photons m is applied ^-2 s ^-1 Is cultured for 3-4 days.

The culture solution is f/2 liquid culture medium.

Drawings

FIG. 1 shows the gene structure of NobZIP77 used in the present invention.

FIG. 2 is a knockout vector containing a partial sequence of NobZIP77 for use in the present invention.

FIG. 3 shows the result of genomic sequence alignment of the knockout strain NobZIP77ko-1 obtained by the present invention with wild IMET1.

FIG. 4 shows the results of comparing the TAG yield of wild IMET1 under artificial nitrogen deficiency under the irradiation of blue light and white light, wherein the asterisk indicates that p in t-test is less than or equal to 0.05.

FIG. 5 shows the results of the comparison of TAG yields of the knockout strain NobZIP77ko-1 and wild IMET1 under normal culture conditions under white light irradiation, and asterisks indicate that p in t-test is less than or equal to 0.05.

FIG. 6 shows the results of TAG yield comparison of white light treated wild IMET1 and blue light treated knockout strain NobZIP77ko-1 under artificial nitrogen deficiency condition in the present invention, with asterisks indicating that p in t-test is less than or equal to 0.05.

FIG. 7 shows the TAG yield comparison result of white and blue light rationally treated knockout strain NobZIP77ko-1 and white light treated wild IMET1 under normal conditions in the invention, and asterisks indicate that p in t-test is less than or equal to 0.05.

Detailed description of the preferred embodiments

The invention will be further illustrated with reference to specific examples. It should be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention.

According to the invention, the coding gene NobZIP77 of the negative regulation transcription factor of the nuclear genome of the nannochloropsis industrial algae strain IMET1 (namely, marine nannochloropsis (Nannochloropsis oceanica) IMET1 is obtained by giving away from the university of Maryland in the United states and can be used for issuing the strain to the public in research direction) is knocked out, the gene and the amino acid sequence are the first reports in microalgae, the gene is knocked out, and the aim of effectively and remarkably improving the TAG yield of the nannochloropsis can be realized by combining blue light irradiation. The invention separates the full-length cDNA sequence of NobZIP77 gene, and uses the gene transformation system of nannochloropsis to make endogenous knockout, and experiments prove that the knockout of NobZIP77 can obviously improve the TAG yield of nannochloropsis. The disclosed full-length gene and amino acid sequence are the first reports in the nannochloropsis, and the capability of synthesizing TAG by the nannochloropsis can be obviously improved by knocking out the genes, thus proving the application value of the nannochloropsis in the aspect of improving the production of TAG by organisms by using genetic engineering means; the light quality regulation method is the first report in microalgae, can effectively improve the TAG yield of the nannochloropsis, and proves the application value of the nannochloropsis in the aspect of improving the industrial oil-producing microalgae culture process; in addition, the TAG production of the nannochloropsis through rational combination of the genetic engineering and the culture method can achieve obviously accelerated TAG yield improvement compared with the independent use of the two methods, so that the method has application potential in the industries of bioenergy and health care products.

The experimental procedures, which do not give any indication of the specific experimental conditions, are generally followed by molecular cloning (Molecular Cloning: A Laboratory Manual,3 ^rd ed.) or as recommended by the manufacturer.

Example 1: cloning and analysis of the NobZIP77 Gene

Cloning NobZIP77 gene from cDNA of nannochloropsis IMET1 by PCR technology, designing the used primer, and synthesizing by Shanghai engineering:

1)NobZIP77-for：

5’ATGGAAGGGCTAGGACAGC 3’；

2)NobZIP77-rev:

5’CTATCCCTTCAAATGCATCC 3’。

the PCR apparatus used was a MasterCycler from Eppendorf company, 50. Mu.L of a reaction system comprising 4. Mu.L of dNTPs (2.5mM each,TAKARA), 2. Mu.L (10. Mu.M) of each of the forward and reverse primers, 5. Mu.L of 10 Xbuffer (Mg) ²⁺ plus，TAKARA)，0.4μL rTaq enzyme (5U/. Mu.L, TAKARA), 1. Mu.L wild IMET1cDNA template (50 ng/. Mu.L), and 35.6. Mu.L of ultrapure water. The reaction system is as follows: pre-denaturation at 94℃for 3min, then denaturation at 94℃for 30sec, annealing at 55℃for 30sec, extension at 72℃for 1min,30 cycles, and finally reaction at 72℃for 7min.

After the reaction, 5. Mu.L of the PCR product was mixed with 1. Mu.L of 6×loading buffer (TAKARA), spotted into 1% (w/V) agarose (BIOWET) gel, and subjected to electrophoresis at 120V for 25min on an electrophoresis system produced by Liujingjingjingjinggao, and then observed and photographed using a UVP company UV gel imager BioChemiHR. The desired fragment was purified and recovered from the PCR product by using the Cycle-Pure Kit or Gel Extraction Kit from Omega company, and the procedure was performed entirely according to the instructions.

The obtained purified fragment was ligated into pMD18-T vector of TAKARA company, and transferred into competent cell Trans5α of E.coli of full-size gold company by means of heat shock transformation, and the positive clone was sent to Invitrogen company for sequencing, finally obtaining the full-length coding region sequence of NobZIP77 gene, see sequence shown in sequence table SEQ ID NO 1. In addition, the gene structure of NobZIP77 was obtained by alignment with the genomic sequence, see fig. 1, with flanking sequences at each of the 5 'and 3' ends of the gene, with 1 intron inside the gene.

Example 2: construction of knockout vector (one) of NobZIP77 in marine nannochloropsis IMET1

See fig. 2. The method for constructing the vector reference Poliner et al is specifically as follows: single-stranded primers containing a ribozyme gene and a NobZIP77 gRNA target sequence were designed, and the sequences were as follows:

1)g77-Cas9-for：

5’CGACACCGTCTGATGAGTCCGTGAGGACGAAACGAGTA AGCTCGTCACGGTGGTGAACAATGGAGGG 3’；

2)g77-Cas9-rev:

5’AAACCCTCCATTGTTCACCACCGTGACGAGCTTACTCGT TTCGTCCTCACGGACTCATCAGACGGTG 3’。

the two primers were combined into a double-stranded fragment with a cohesive end of BspQI by gradient descent annealing (95℃to 25℃for 1 sec per cycle descent) and ligated to the pNOC-ARS-CRISPR-v2 vector backbone, also with a cohesive end of BspQI, given by Poliner, university of Michigan State university, U.S.A., to give recombinant vector pXJ630.

(II) electroporation method of introducing vector pXJ630 into Chlorella

1h before conversion, the concentration was taken to be about 1-3X 10 ⁷ centrifuging 4000g of Nannochloropsis liquid in logarithmic growth phase of cells/mL for 5min, discarding supernatant, rinsing 375mM sorbitol for 2 times, and adjusting cell concentration to 2×10 with sorbitol ⁸ cells/mL. The concentrated algae were aliquoted into 200. Mu.l aliquots, while pXJ empty vector was selected as control, 3. Mu.g of pXJ630 vector was added to each aliquot, and 1. Mu.l of salmon sperm DNA denatured at 95℃for 1min (15. Mu.g/mL) was mixed and incubated for 10min. The mixture was transferred into a 2mm cuvette and shocked at 2200V (HV), 50. Mu.F, immediately after which the algae were transferred into 5mL fresh F/2 medium. After resuscitating at 100rpm in a shaker at 25℃for 48h with low light, the solution was applied to an f/2 plate containing 5. Mu.g/mL zeocin at 25℃and 50. Mu. Mol m ^-2 s ^-1 Light culture until clones grew out.

Molecular identification of NobZIP77 knockout strain of nannochloropsis

The transformed clone was picked up into f/2 medium containing 5. Mu.g/mL zeocin for activation and total DNA was extracted for PCR identification using the following primer sequences:

1)g77-Cas9-DNA-for：

5’ACGATGATGATGCCTACGGG 3’；

2)g77-Cas9–DNA-rev:

5’GAACTTCTTCCTCACACGGGA 3’。

the PCR apparatus used was a MasterCycler from Eppendorf company, 50. Mu.L of a reaction system comprising 4. Mu.L of dNTPs (2.5mM each,TAKARA), 2. Mu.L (10. Mu.M) of each of the forward and reverse primers, 5. Mu.L of 10 Xbuffer (Mg) ²⁺ plus, TAKARA), 0.4. Mu.L of rTaq enzyme (5U/. Mu.L, TAKARA), 1. Mu.L of cDNA template of the transformant (50 ng/. Mu.L), and 35.6. Mu.L of ultrapure water. The reaction system is as follows: pre-denaturation at 94℃for 3min, then denaturation at 94℃for 30sec, annealing at 55℃for 30sec, extension at 72℃for 1min,30 cycles, and finally reaction at 72℃for 7min.

After the reaction, 5. Mu.L of the PCR product was mixed with 1. Mu.L of 6×loading buffer (TAKARA), spotted into 1% (w/V) agarose (BIOWET) gel, and subjected to electrophoresis at 120V for 25min on an electrophoresis system produced by Liujingjingjingjinggao, and then observed and photographed using a UVP company UV gel imager BioChemiHR. The desired fragment was purified and recovered from the PCR product by using the Cycle-Pure Kit or Gel Extraction Kit from Omega company, and the procedure was performed entirely according to the instructions. The recovered product was sent to Invitrogen company for sequencing, and the sequencing result was compared with the NobZIP77 genome sequence, finally 1 strain NobZIP77ko-1 was selected, the comparison result with the sequencing result of wild IMET1 is shown in FIG. 3, and the sequence ACGGTGGTGAACAATGGAGG at 501-521bp of the NobZIP77 gene in the wild type of the screened strain and the nannochloropsis industrial strain IMET1 was mutated to ACGGTGGTGAACAATG-AGG, thus causing the frame shift mutation of the subsequent sequence, and silencing the NobZIP77 gene in the strain.

Light quality culture of nannochloropsis strain and TAG yield measurement

1) Light quality culture and TAG yield measurement of the nannochloropsis strain:

wild IMET1 of nannochloropsis and knockout strain NobZIP77ko-1 are firstly respectively at 25 ℃ and the light intensity is 50 mu mol photons m ^-2 s ^-1 Is cultured in f/2 liquid culture medium under the condition of white light and sterile air until OD ₇₅₀ After centrifugation at 3500g for 5min at normal temperature and discarding the supernatant, the pellet was resuspended in 150ml of nitrogen-containing or nitrogen-free f/2 liquid medium (the nitrogen-containing or nitrogen-free f/2 liquid medium is prepared by mixing NaNO ₃ Added into f/2 liquid culture medium, wherein the nitrogen content is 2 g/L), and after being resuspended, the light intensity is 50 mu mol photons m respectively ^-2 s ^-1 Is cultured under the irradiation of white light or blue light (445 nm) at 25 ℃ by sterile air, and is sampled at different time points for subsequent detection.

TAG yield measurement Raman spectroscopy (He, 2017) was used to obtain 1ml each of the nitrogen-deficient-photoperiod cultured nannochloropsis samples described above, with 3 biological replicates per strain. Centrifugation at 3000g for 5min at normal temperature to collect algae, washing 3 times with 200 μl deionized water and resuspending the cells, suction of quartz capillaries (50 mm long by 1mm wide by 0.1mm high, camlab, UK), bleaching to remove pigments, randomly selecting 20 cells per sample, irradiating each cell with a 532nm laser light source for 1 sec, obtaining Raman spectra between 393.8cm-3341.3cm, baseline normalization with Labspec 5 (HORIBA Jobinyvon Ltd., UK), and conversion of Raman raw data into TAG yields with PLSR model (Almeida, 2010).

From the analysis of the results shown in fig. 4 to 6, the following conclusion is reached: firstly, the yield of TAG irradiated by blue light is improved by 3.6-48.3% compared with white light between 6h and 264h of artificial nitrogen deficiency (figure 4), which shows that the blue light has better TAG yield promoting effect compared with the white light; secondly, the TAG yield is improved by 60.9% -184.5% compared with the wild type in white light normal culture for 24h to 264h, and reaches a peak value of 184.5% on the 9 th day (216 h) (figure 5), which shows that the knockout strain has better TAG yield promotion effect compared with the wild type; again, at artificial nitrogen deficiency for 72h and 96h, TAG yield of the blue light treated knockout strain was increased by 35.3% and 21.1% respectively compared to white light treated wild type, and reached a peak of 35.3% on day 3 (72 h) (fig. 6), indicating that the blue light treated knockout strain had better TAG yield promoting effect than the white light treated wild type.

2) Light quality culture and TAG yield measurement of the nannochloropsis strain:

according to the research results, designing an experiment: wild IMET1 of nannochloropsis and knockout strain NobZIP77ko-1 are firstly respectively at 25 ℃ and the light intensity is 50 mu mol photons m ^-2 s ^-1 Is cultured in f/2 liquid culture medium under the condition of white light and sterile air until OD ₇₅₀ =3.0, centrifuging at room temperature of 3500g for 5min, discarding supernatant, and re-suspending the precipitate with 150ml of nitrogen-containing f/2 liquid medium (the nitrogen-containing or nitrogen-free f/2 liquid medium is prepared by mixing NaNO ₃ Added into f/2 liquid culture medium, wherein the nitrogen content is 2 g/L), and after being resuspended, the light intensity is 50 mu mol photons m respectively ^-2 s ^-1 Is incubated for 9 days at 25℃with sterile air under white light, and then is incubated at a light intensity of 50. Mu. Mol photons m ^-2 s ^-1 Is incubated at 25℃for 3 days with sterile air and samples are taken at various time points for subsequent detection (see FIG. 7).

As can be seen from FIG. 7, TAG yield of the knockout strain was increased by 62.9% as compared to the wild type for 12 days of white light culture. In summary, the invention provides a technical method capable of effectively improving the yield of microalgae TAG, and provides a feasible idea for improving the industrial oil-producing microalgae culture process.

While the invention has been described with respect to specific examples, it will be apparent to those skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope thereof. Accordingly, it is intended that the appended claims cover all such modifications as fall within the scope of the invention.

SEQ ID NO1

1401

DNA

Nannochloropsis (Nannochloropsis oceanica IMET 1)

SEQ ID NO：2

466

PRT

Nannochloropsis (Nannochloropsis oceanica IMET 1)

SEQ ID NO3

12282

DNA

pXJ630

/>

Sequence listing

<110> Qingdao bioenergy and Process institute of China academy of sciences

<120> culture method for increasing yield of microalgae Triglyceride (TAG) and application thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1401

<212> DNA

<213> nannochloropsis (Nannochloropsis oceanica IMET 1)

<400> 1

atggaagggc taggacagcc gggagatgcc ggggggggaa gtggcagcag tactggtgga 60

ggtgcatcag caggagccag cgccagcttc ccccctcctc cagtctttgg cttctccagg 120

gacgactcga ttaatctgga ggacatcttc gtagattggt tcaacgaaga taatctcaac 180

ggcccgcctt cttcctatca aagtagtagc caggattctg ctgctcctgc tatccttccg 240

caagaggctt atgtccccgc cctcaccacc gctcagaagc tccagcagtt gcaacagctt 300

caacagcagc aacgactgga gcagcagcag cttctggcgt cgcaccaggc gtcagagcag 360

cagcagcagc agcagcagca gcagttccag cagtcaggaa ttgggaaggc agggagaacg 420

tcgccattga cgatgatgat gcctacggga ggagataaaa gcaaggctgc tggtgctgct 480

actgttggtg gtgggagggc cacggtggtg aacaatggag gaggaatggg aggggttgag 540

gacgaggaag gggaggagga cgactttgag gatgactatg aggacgatga tggggggact 600

agcacaggga gtggaggggg aggaggaggg cgacgcaaga agcggcaaag gggcgcggga 660

ggggggggaa gtatgggtgg agggagttcg gggaggagga tgactgagga gcagaaagtg 720

gaaaggcggg agaggaatcg ggagcatgcc aaacggtccc gtgtgaggaa gaagttcttg 780

ttggagtcat tgcagaagag cgtgaatgcc ttgcaggagg agaacgacaa gctgcggggg 840

gccattcgca cgcatctcaa ggacggggca cacgatttac tcaagtcgtg tgaggtggag 900

ccggaggact ctttgttgac ctcagatcct gcatcggcga ccaagatttt ggatgatcca 960

gattacaccc ttgtgaaggc cctacagacc gcccagcaga acttcgtgat caccgacccg 1020

acgctgcctg acaatcccat tgtctacgcc tctggcggct ttttaaatct caccggctac 1080

caaatggatc aaatcctcgg ccgcaactgt cgcttcctcc aagggcctga cacggaccct 1140

tccgccgtgg acaagatccg aagagccatc gaagatggga cagacgggag cgtgtgtctg 1200

ttgaattacc gcgcggacgg cacgactttt tggaaccagt ttttcatcgc ggccctgcgt 1260

ggggcggatg ggaacgttgt caactttgtt ggtgtacaat gccgtgtgag cgaggagtac 1320

gcgctggagg tgctgaaaaa ggagatggag agcacgacct cgacgggggc gccgtcgacg 1380

gggatgcatt tgaagggata g 1401

<210> 2

<211> 466

<212> PRT

<213> nannochloropsis (Nannochloropsis oceanica IMET 1)

<400> 2

Met Glu Gly Leu Gly Gln Pro Gly Asp Ala Gly Gly Gly Ser Gly Ser

1 5 10 15

Ser Thr Gly Gly Gly Ala Ser Ala Gly Ala Ser Ala Ser Phe Pro Pro

20 25 30

Pro Pro Val Phe Gly Phe Ser Arg Asp Asp Ser Ile Asn Leu Glu Asp

35 40 45

Ile Phe Val Asp Trp Phe Asn Glu Asp Asn Leu Asn Gly Pro Pro Ser

50 55 60

Ser Tyr Gln Ser Ser Ser Gln Asp Ser Ala Ala Pro Ala Ile Leu Pro

65 70 75 80

Gln Glu Ala Tyr Val Pro Ala Leu Thr Thr Ala Gln Lys Leu Gln Gln

85 90 95

Leu Gln Gln Leu Gln Gln Gln Gln Arg Leu Glu Gln Gln Gln Leu Leu

100 105 110

Ala Ser His Gln Ala Ser Glu Gln Gln Gln Gln Gln Gln Gln Gln Gln

115 120 125

Phe Gln Gln Ser Gly Ile Gly Lys Ala Gly Arg Thr Ser Pro Leu Thr

130 135 140

Met Met Met Pro Thr Gly Gly Asp Lys Ser Lys Ala Ala Gly Ala Ala

145 150 155 160

Thr Val Gly Gly Gly Arg Ala Thr Val Val Asn Asn Gly Gly Gly Met

165 170 175

Gly Gly Val Glu Asp Glu Glu Gly Glu Glu Asp Asp Phe Glu Asp Asp

180 185 190

Tyr Glu Asp Asp Asp Gly Gly Thr Ser Thr Gly Ser Gly Gly Gly Gly

195 200 205

Gly Gly Arg Arg Lys Lys Arg Gln Arg Gly Ala Gly Gly Gly Gly Ser

210 215 220

Met Gly Gly Gly Ser Ser Gly Arg Arg Met Thr Glu Glu Gln Lys Val

225 230 235 240

Glu Arg Arg Glu Arg Asn Arg Glu His Ala Lys Arg Ser Arg Val Arg

245 250 255

Lys Lys Phe Leu Leu Glu Ser Leu Gln Lys Ser Val Asn Ala Leu Gln

260 265 270

Glu Glu Asn Asp Lys Leu Arg Gly Ala Ile Arg Thr His Leu Lys Asp

275 280 285

Gly Ala His Asp Leu Leu Lys Ser Cys Glu Val Glu Pro Glu Asp Ser

290 295 300

Leu Leu Thr Ser Asp Pro Ala Ser Ala Thr Lys Ile Leu Asp Asp Pro

305 310 315 320

Asp Tyr Thr Leu Val Lys Ala Leu Gln Thr Ala Gln Gln Asn Phe Val

325 330 335

Ile Thr Asp Pro Thr Leu Pro Asp Asn Pro Ile Val Tyr Ala Ser Gly

340 345 350

Gly Phe Leu Asn Leu Thr Gly Tyr Gln Met Asp Gln Ile Leu Gly Arg

355 360 365

Asn Cys Arg Phe Leu Gln Gly Pro Asp Thr Asp Pro Ser Ala Val Asp

370 375 380

Lys Ile Arg Arg Ala Ile Glu Asp Gly Thr Asp Gly Ser Val Cys Leu

385 390 395 400

Leu Asn Tyr Arg Ala Asp Gly Thr Thr Phe Trp Asn Gln Phe Phe Ile

405 410 415

Ala Ala Leu Arg Gly Ala Asp Gly Asn Val Val Asn Phe Val Gly Val

420 425 430

Gln Cys Arg Val Ser Glu Glu Tyr Ala Leu Glu Val Leu Lys Lys Glu

435 440 445

Met Glu Ser Thr Thr Ser Thr Gly Ala Pro Ser Thr Gly Met His Leu

450 455 460

Lys Gly

465

<210> 3

<211> 12282

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

accggtttct tagacggatc gcttgcctgt aacttacacg cgcctcgtat cttttaatga 60

tggaataatt tgggaattta ctctgtgttt atttattttt atgttttgta tttggatttt 120

agaaagtaaa taaagaaggt agaagagtta cggaatgaag aaaaaaaaat aaacaaaggt 180

ttaaaaaatt tcaacaaaaa gcgtacttta catatatatt tattagacaa gaaaagcaga 240

ttaaatagat atacattcga ttaacgataa gtaaaatgta aaatcacagg attttcgtgt 300

gtggtcttct acacagacaa gatgaaacaa ttcggcatta atacctgaga gcaggaagta 360

caagataaaa ggtagtattt gttggcgatc cccctagagt cttttacatc ttcggaaaac 420

aaaaactatt ttttctttaa tttctttttt tactttctat ttttaattta tatatttata 480

ttaaaaaatt taaattataa ttatttttat agcacgtgat gaaaaggacc caggtggcac 540

ttttcgggga aatgtgcgcg gaacccctat ttgtttattt ttctaaatac attcaaatat 600

gtatccgctc atgagacaat aaccctgata aatgcttcaa taatattgaa aaaggaagag 660

tatgagtatt caacatttcc gtgtcgccct tattcccttt tttgcggcat tttgccttcc 720

tgtttttgct cacccagaaa cgctggtgaa agtaaaagat gctgaagatc agttgggtgc 780

acgagtgggt tacatcgaac tggatctcaa cagcggtaag atccttgaga gttttcgccc 840

cgaagaacgt tttccaatga tgagcacttt taaagttctg ctatgtggcg cggtattatc 900

ccgtattgac gccgggcaag agcaactcgg tcgccgcata cactattctc agaatgactt 960

ggttgagtac tcaccagtca cagaaaagca tcttacggat ggcatgacag taagagaatt 1020

atgcagtgct gccataacca tgagtgataa cactgcggcc aacttacttc tgacaacgat 1080

cggaggaccg aaggagctaa ccgctttttt gcacaacatg ggggatcatg taactcgcct 1140

tgatcgttgg gaaccggagc tgaatgaagc cataccaaac gacgagcgtg acaccacgat 1200

gcctgtagca atggcaacaa cgttgcgcaa actattaact ggcgaactac ttactctagc 1260

ttcccggcaa caattaatag actggatgga ggcggataaa gttgcaggac cacttctgcg 1320

ctcggccctt ccggctggct ggtttattgc tgataaatct ggagccggtg agcgtgggtc 1380

tcgcggtatc attgcagcac tggggccaga tggtaagccc tcccgtatcg tagttatcta 1440

cacgacgggg agtcaggcaa ctatggatga acgaaataga cagatcgctg agataggtgc 1500

ctcactgatt aagcattggt aactgtcaga ccaagtttac tcatatatac tttagattga 1560

tttaaaactt catttttaat ttaaaaggat ctaggtgaag atcctttttg ataatctcat 1620

gaccaaaatc ccttaacgtg agttttcgtt ccactgagcg tcagaccccg tagaaaagat 1680

caaaggatct tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc aaacaaaaaa 1740

accaccgcta ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc tttttccgaa 1800

ggtaactggc ttcagcagag cgcagatacc aaatactgtt cttctagtgt agccgtagtt 1860

aggccaccac ttcaagaact ctgtagcacc gcctacatac ctcgctctgc taatcctgtt 1920

accagtggct gctgccagtg gcgataagtc gtgtcttacc gggttggact caagacgata 1980

gttaccggat aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac agcccagctt 2040

ggagcgaacg acctacaccg aactgagata cctacagcgt gagctatgag aaagcgccac 2100

gcttcccgaa gggagaaagg cggacaggta tccggtaagc ggcagggtcg gaacaggaga 2160

gcgcacgagg gagcttccag ggggaaacgc ctggtatctt tatagtcctg tcgggtttcg 2220

ccacctctga cttgagcgtc gatttttgtg atgctcgtca ggggggcgga gcctatggaa 2280

aaacgccagc aacgcggcct ttttacggtt cctggccttt tgctggcctt ttgctcacat 2340

gttctttcct gcgttatccc ctgattctgt ggtttaaacc aggtcactgg attttggttt 2400

taggaattag aaattttatt gatagaagta ttttacaaat acaaatacat actaagggtt 2460

tcttatatgc tcaacacatg agcgaaaccc tataagaacc ctaattccct tatctgggaa 2520

ctactcacac attattctgg agaaaaatag agagagatag atttgtagag agagactggt 2580

gatttttgcg gactccggtc ggcatctact actagcctat tcctttgccc tcggacgagt 2640

gctggggcgt cggtttccac tatcggcgag tacttctaca cagccatcgg tccagacggc 2700

cgcgcttctg cgggcgattt gtgtacgccc gacagtcccg gctccggatc ggacgattgc 2760

gtcgcatcga ccctgcgccc aagctgcatc atcgaaattg ccgtcaacca agctctgata 2820

gagttggtca agaccaatgc ggagcatata cgcccggagc cgcggcgatc ctgcaagctc 2880

cggatgcctc cgctcgaagt agcgcgtctg ctgctccata caagccaacc acggcctcca 2940

gaagaagatg ttggcgacct cgtattggga atccccgaac atcgcctcgc tccagtcaat 3000

gaccgctgtt atgcggccat tgtccgtcag gacattgttg gagccgaaat ccgcgtgcac 3060

gaggtgccgg acttcggggc agtcctcggc ccaaagcatc agctcatcga gagcctgcgc 3120

gacggacgca ctgacggtgt cgtccatcac agtttgccag tgatacacat ggggatcagc 3180

aatcgcgcat atgaaatcac gccatgtagt gtattgaccg attccttgcg gtccgaatgg 3240

gccgaacccg ctcgtctggc taagatcggc cgcagcgatc gcatccatgg cctccgcgac 3300

cggctgcaga acagcgggca gttcggtttc aggcaggtct tgcaacgtga caccctgtgc 3360

acggcgggag atgcaatagg tcaggctctc gctgaattcc ccaatgtcaa gcacttccgg 3420

aatcgggagc gcggccgatg caaagtgccg ataaacataa cgatctttgt agaaaccatc 3480

ggcgcagcta tttacccgca ggacatatcc acgccctcct acatcgaagc tgaaagcacg 3540

agattcttcg ccctccgaga gctgcatcag gtcggagacg ctgtcgaact tttcgatcag 3600

aaacttctcg acagacgtcg cggtgagttc aggctttttc atatcttatt gccccccggg 3660

gccctcgact gtgttgatgc gggctgagat tggtggtggt ctatcacgaa tatgtgtgag 3720

gggtaagtgc ggtgttttgc gtgagatttt agaatattgc cccgccccgg ggcaggccgg 3780

cgtggcggaa caaccaggca cacgagcgcg aatggtgata ccgacggagt caaaactttg 3840

tgacaagtag ctgcaccatg ggcagtggtg agctttcaga cgtggtatca ctgtccacta 3900

gttcacacac agaatgcgtg tccaaaaggt ctagagccgt ctcgcttgcg tctctccgtc 3960

gaagaacagt gaagaggctc gtcacgtcga ccagacgacg ggaggctggt caccatcgca 4020

gatgtctccc acaaagcagc acggcaactc ctactccttc acacaatgga agaaaaggtg 4080

gtctgatggt tctcagtgga aaagaacgat atcaggctga aaaaaatgat ctgcaggctc 4140

cagattcctg aatcacgtcg actgtgacga agcaaaccgc gtcgaacaac atcggtcatg 4200

ccaacgggtc tcgtctctcg agcccttttg gcggcgacta agaagtatga agcttcaggc 4260

cgcaacgcgc gacacagcgt tttgtgtggt gggcctcggc attgctcttt gcatggccca 4320

gcgtgattag tgcgtggatt ttaagcccga gaccgaagga ttgcgacatg tgcctggctg 4380

tataactcac gcttgctgct acgctcgcct cctcctccat ccactccatc gcggccgcca 4440

tggcctctag tggatcagct tgcatgcctg caggagacga tatcacctct tctgtttcca 4500

cgataaaaat agactgctca tttcttcgtc gtcttcatcg tctgcttttt ctgcttcgcc 4560

tctgtctggg gtctgaaacc actacacaca cacacaacac tcgtactccc actttcacaa 4620

aagcgtaagc tcaccggctt ttcttacacg tacattttag tggatcccat cacgccacta 4680

ccacgcccgc gggggatgga acggagggga gagagagaag ggggaagcat ggatgaatga 4740

gacattgagg gaaaggaggg gagggagcag tccatcaggg cgctacctct cttgtccccc 4800

aaaccctgtt gagccgttca acatgtttca tgtttcctcc ctcccccctt ccctccctgg 4860

cctttccgcg gagccattca agtgacgtct ggaccgcacc gtaacaaaat cgtttctatg 4920

gggggtttgt ttgacaacca cgtcttcagc gtttttaaaa aaaaaagcgg gcaagccctc 4980

tcaccctcac tcatgcccat cctcctcctc tcctgcggaa cattcttaca aaaggcgtaa 5040

ctcgacgaca actcaaagaa cgacaaacat caatcccaaa aaaaaaatct ctactcgtct 5100

ctcttggatc tttccaattg tcagaccttc ctcttctttt tcgggctagc caccatggac 5160

gcgtagtcgg gcacgtcgta ggggtatccg gccaggatgc gctcgcacag gcgccagccg 5220

gttaccccgt tgatggtcac gcggaacaac agcgagccat ccgggttgat cagccgctcg 5280

tcaatgatct tattgccgtt ccacagggtg ccggtcaccg tgatcttctt gccgtcgaac 5340

acggcaatgc cctcgtaagg acggccgaag tagtcaatca tgttcggcgt cacaccgtcg 5400

atgaccagcg tcccgtagtg cagtatcacc ttgaagtggt gatcgtccac ggggtacaca 5460

accttgaaga tcttctcgat ctggcccatt tggtccccgc tcaggccctc gtagggaatg 5520

atgacgtgga tgtcgatctt caggccgttc tcgccgctca ggacgatgcg ctggattggg 5580

gtcacggaga cgcccaggtt ctggaaaagc gaggacacac cgccctgctc cagcacctgg 5640

tcgaggttat agccagctgt ctgccgccag tcgcccacga agtcctcgag agtaaacacc 5700

atgttaacgg acccgctgcc ggacccgtca gccctgctgt ctccaccgag ctgagagagg 5760

tcgattcttg tttcatagag ccccgtaatt gactgatgaa tcagtgtggc gtccaggacc 5820

tcctttgtag aggtgtaccg ctttctgtct atggtggtgt cgaagtactt gaaggctgca 5880

ggcgcgccca agttggtcag agtaaacaag tggataatgt tttctgcctg ctccctgatg 5940

ggcttatccc tgtgcttatt gtaagcagaa agcaccttat cgaggttagc gtcggcgagg 6000

atcactcttt tggagaattc gcttatttgc tcgatgatct catcaaggta gtgtttgtgt 6060

tgttccacga acagctgctt ctgctcatta tcttcgggag accctttgag cttttcatag 6120

tggctggcca gatacaagaa attaacgtat ttagagggca gtgccagctc gttacctttc 6180

tgcagctcgc ccgcactagc gagcattcgt ttccggccgt tttcaagctc aaagagagag 6240

tacttgggaa gcttaatgat gaggtctttt ttgacctctt tatatccttt cgcctcgaga 6300

aagtcgatgg ggtttttttc gaagcttgat cgctccatga ttgtgatgcc cagcagttcc 6360

ttgacgcttt tgagtttttt agacttccct ttctccactt tggccacaac cagtacactg 6420

taagcgactg taggagaatc gaatccgccg tatttcttgg ggtcccaatc ttttttgcgt 6480

gcgatcagct tgtcgctgtt ccttttcggg aggatacttt ccttggagaa gcctccggtc 6540

tgtacttcgg tctttttaac gatgttcacc tgcggcatgg acaggacctt ccggactgtc 6600

gcgaaatccc tacccttgtc ccacacgatt tctcctgttt ctccgtttgt ttcgataagt 6660

ggtcgcttcc gaatctctcc attggccagt gtaatctcgg tcttgaaaaa attcataata 6720

ttgctgtaaa agaagtactt agcggtggcc ttgcctattt cctgctcaga ctttgcgatc 6780

attttcctaa catcgtacac tttatagtct ccgtaaacaa attcagattc aagcttggga 6840

tattttttga taagtgcagt gcctaccact gcattcaggt aggcatcatg cgcatggtgg 6900

taattgttga tctctctcac cttataaaac tgaaagtcct ttctgaaatc tgagaccagc 6960

ttagacttca gagtaataac tttcacctct cgaatcagtt tgtcattttc atcgtacttg 7020

gtgttcatgc gtgaatcgag aatttgggcc acgtgcttgg tgatctggcg tgtctcaaca 7080

agctgccttt tgatgaagcc ggctttatcc aactcagaca ggccacctcg ttcagcctta 7140

gtcagattat cgaacttccg ttgtgtgatc agtttggcgt tcagcagctg ccgccaataa 7200

tttttcattt tcttgacaac ttcttctgag gggacgttat cactcttccc tctattttta 7260

tcggatcttg tcaacacttt attatcaata gaatcatctt tgagaaaaga ctggggcacg 7320

atatgatcca cgtcgtagtc ggagagccga ttgatgtcca gttcctgatc cacgtacatg 7380

tccctgccgt tctgcaggta gtacaggtag agcttctcat tctgaagctg ggtgttttca 7440

actgggtgtt ccttaaggat ttgggacccc agttctttta taccctcttc aatcctcttc 7500

atcctttccc tactgttctt ctgtcccttc tgggtagttt ggttctctcg ggccatctcg 7560

ataacgatat tctcgggctt atgccttccc attactttga cgagttcatc cacgacctta 7620

acggtctgca gtattccctt tttgatagct gggctacctg caagattagc gatgtgctcg 7680

tgaagactgt ccccctggcc agaaacttgt gctttctgga tgtcctcctt aaaggtgaga 7740

gagtcatcat ggatcaactg catgaagttc cggttggcaa atccatcgga cttaagaaaa 7800

tccaggattg tctttccact ctgcttgtct cggatcccat tgatcagttt tcttgacagc 7860

cgcccccatc ctgtatatcg gcgcctcttg agctgtttca tgactttgtc gtcgaagaga 7920

tgagcgtaag ttttcaagcg ttcttcaatc atctccctat cttcaaacaa cgtaagggtg 7980

aggacaatgt cctcaagaat gtcctcgttc tcctcattgt ccaggaagtc cttgtcttta 8040

atgattttca ggagatcgtg atacgttccc agggatgcgt tgaagcgatc ctccactccg 8100

ctgatttcaa cagagtcgaa acattcaatc tttttgaaat agtcttcttt gagctgtttc 8160

acggtaactt tccggttcgt cttgaagagg aggtccacga tagctttctt ctgctctcca 8220

gacaggaatg ctggctttct catcccttct gtgacgtatt tgaccttggt gagctcgtta 8280

taaactgtga agtactcgta cagcagagag tgtttaggaa gcaccttttc gttaggcaga 8340

tttttatcaa agttagtcat cctttcgatg aaggactggg cagaggcccc cttatccacg 8400

acttcctcga agttccaggg agtgatggtc tcttctgatt tgcgagtcat ccacgcgaat 8460

ctggaatttc cccgggcgag ggggcctaca tagtagggta tccgaaatgt gaggattttc 8520

tcaatctttt ccctgttatc tttcaaaaag gggtagaaat cctcttgccg cctgaggata 8580

gcgtgcagtt cgcccaggtg aatctggtgg gggatgcttc cattgtcgaa agtgcgctgt 8640

ttgcgcaaca gatcttctct gttaagcttt accagcagct cctcggtgcc gtccattttt 8700

tccaagatgg gcttaataaa tttgtaaaat tcctcctggc ttgctccgcc gtcaatgtat 8760

ccggcgtagc catttttaga ctgatcgaag aaaatttcct tgtacttctc aggcagttgc 8820

tgtctgacaa gggccttcag caaagtcaag tcttggtggt gctcatcata gcgcttgatc 8880

atactagcgc tcagcggagc tttggtgatc tccgtgttca ctcgcagaat atcactcagc 8940

agaatggcgt ctgacaggtt ctttgccgcc aaaaaaaggt ctgcgtactg gtcgccgatc 9000

tgggccagca gattgtcgag atcatcatcg taggtgtctt tgctcagttg aagcttggca 9060

tcttcggcca ggtcgaagtt agatttaaag ttgggggtca gcccgagtga cagggcgata 9120

agattaccaa acaggccgtt cttcttctcc ccagggagct gtgcgatgag gttttcgagc 9180

cgccgggatt tggacagcct agcgctcagg attgctttgg cgtcaactcc ggatgcgttg 9240

atcgggttct cttcgaaaag ctgattgtaa gtctgaacca gttggataaa gagtttgtcg 9300

acatcgctgt tgtctgggtt caggtccccc tcgatgagga agtgtccccg aaatttgatc 9360

atatgcgcca gcgcgagata gatcaaccgc aagtcagcct tatcagtact gtctacaagc 9420

ttcttcctca gatgatatat ggttgggtac ttttcatggt acgccacctc gtccacgata 9480

ttgccaaaga ttgggtggcg ctcgtgcttt ttatcctcct ccaccaaaaa ggactcctcc 9540

agcctatgga agaaagagtc atccacctta gccatctcat tactaaagat ctcctgcagg 9600

tagcagatcc gattctttct gcgggtatat ctgcgccgtg ctgttctttt gagccgcgtg 9660

gcttcggccg tctccccgga gtcgaacagg agggcgccaa tgaggttctt ctttatgctg 9720

tggcgatcgg tattgcccag aactttgaat tttttgctcg gcaccttgta ctcgtccgta 9780

atgacggccc agccgacgct gtttgtgccg atatcgagcc caatggagta cttcttgtcc 9840

accttccgct ttttcttggg catgctcgag ggttgcgtgt gtatctgtgt gcagtggata 9900

ttgttaccga gtttggtgag cgtgagtccg ttagtgccct ggtggtggtg gattaggaga 9960

gtgggtgact cggtgtccat ggctttcttc gctcattata ggaggggaaa ggaatgaggg 10020

agggtgggga gaccgcgtct gttgttgacc accgatttac ttcttgcctc ccttcccctc 10080

cctcccctca atccgtacga cacaaatagt agccgagtgt ctgctgcaga gcgcatgatt 10140

agtgtggtag acaacgaggg agggaaggat gtacagggca tggcacggag aagcgatggt 10200

ggccaggaag aggagaggtc gcgagaacag gatgtgttgc gaatggataa aaacagaaag 10260

cgatggctct gggcttcgaa agcaggggac attaggacgt gtagaccatc tcgacggatc 10320

cctctgtatc tctgttgtgc gtgaatgttt tctgtgcacg tgtagtgtgt gagagtagaa 10380

cccgggaact cgaacagaga aaagcatggg tggctgtggt gtggaggctt cgttcccacc 10440

acatgccctt ctccttcgcc tcgcctctcc ctgccttctt ccacgcaccc ttgcgcccct 10500

cgttctcaat acctggctca cttccaccat tcaaacaacc atcacgatac aggcatttat 10560

ctatcgttga agacttcttc ctccggtaga tcttagccaa ggtaagaaga ggggcatgca 10620

gcaaggagaa agaaatgatg catgatgagg aatagaaggg gaggagggag ggatatgatg 10680

ggaagcgaaa gcgcatattc tggtggtctg ctgcctgatg gggacgcgtc tagctgtgac 10740

actgaggacg gtggctgctg gtggctgcgg gcgctgcctt ggtgatcaat gggagtaaag 10800

ggagggaagg aggtagcgtg aacggatgac gcggagaagt ttaggggtct ctttacgtat 10860

cgcccctgcc gcccgcctct ctgcgataaa tgtgcctgtt accctgcagc ctctattctt 10920

cactgtgttc ctgttttcca acagcctcta ttcttccctg tcttttgttg cagtggcgtc 10980

atcctctctt tgccccagtc gtcgttctct cgactcactc actccccccc tccttccctc 11040

cctccatcca cagaatcgag agtgactgat gagtccgtga ggacgaaacg agtaagctcg 11100

tctcactcca tcccaagcca ctgttttaga gctagaaata gcaagttaaa ataaggctag 11160

tccgttatca acttgaaaaa gtggcaccga gtcggtgctt ttggccggca tggtcccagc 11220

ctcctcgctg gcgccggctg ggcaacatgc ttcggcatgg cgaatgggac tcctgggtac 11280

catgggaaag aaaggatgag aaaggagaaa ggacatctag ataaccggca tatcacggtg 11340

gtgtattagt gtagaatagt gaagagaaga cttgggaaaa tgtgtaggaa aggttgtttc 11400

tgtgtatgtg ggttgggatg ggtggctgtt tgagaaggaa cagcgggcag ggcgatgtag 11460

tgctgaacgg gcacggaacc actgagactg aaggaagtag ggagagagag gggcagggga 11520

cgtgcacttt aatctttgcc tcggtagagt atacccatgc aagagtatgt ggccacctgt 11580

ggtggctttt ggccaggtct ggtgcagtgc caatcatctc ccatcaataa tacaacttca 11640

gaacaacggc gcattgatgg ggagagagaa agtaaattta agtaaggggt acgtagtaga 11700

ggattcaact gaaatatttt cgaggagcgg ttgggaagtt gaccgattga aaggagaagg 11760

gaggggagca ggtgtgatag tcatgtgtaa agtaattctt ttttgccgtc gtcacacaat 11820

ccacatcaat gataaaatat gtttaaggat caatcacacg gagtcggtca taaggcaacc 11880

gcaaacgcaa tgcaaactag caagcaagca ggaccacaac aacaaccatt accatcacag 11940

gcgacagcag cagcagctgc agcagcagca aggcaagcaa aggccatctg cgcgtggact 12000

tttccaggca ccggctttaa gcgtaatttt caatgattgt tgtccgtgta tcctctcacc 12060

ctttcaccgc ttgcgcgcac gtgagcagca caactggtaa tgcccgagga caatagacga 12120

ggaaaaagaa gaagaaaaat gaagagggag tgatgaagaa gaagagaaga ataaaagaag 12180

acagaaaaga agataaaaaa gtcaaaagac gacaaagacg gaaaaaaaag aaacgcgcaa 12240

ttttaacacc agcaacgacg acgaaaaggg cgtcagcttt gc 12282

Claims

1. A culture method capable of improving the yield of microalgae TAG is characterized by comprising the following steps: culturing the nannochloropsis genetic engineering strain into a culture solution, and applying 30-50 mu mol photons m ^-2 s ^-1 Blue light with wavelength of 445nm, and culturing for 3-4 days;

the genetic engineering strain is an industrial alga strain IMET1 of the nannochloropsis; on its genomeNobZIP77Genes have been silenced;

the saidNobZIP77The base sequence of the gene is shown as SEQ ID NO 1.

2. A method for improving the yield of microalgae TAG, which is characterized by comprising the following steps:

1) Using a nannochloropsis genetically engineered strain;

and, in addition, the method comprises the steps of,

2) The culture method comprises the following steps: culturing engineering strain to contain NaNO ₃ Applying 30-50 mu mol of photons m into 2-4g/L culture solution ^-2 s ^-1 Is cultured for 9-12 days, and then 30-50 mu mol photons m is applied ^-2 s ^-1 Blue light with wavelength of 445nm, and culturing for 3-4 days;

the saidNobZIP77The base sequence of the gene is shown as SEQ ID NO 1.