CN107099544A - The PL LbCpf1 RVR genes of identification specific site and its application in paddy gene target practice - Google Patents
The PL LbCpf1 RVR genes of identification specific site and its application in paddy gene target practice Download PDFInfo
- Publication number
- CN107099544A CN107099544A CN201710505886.9A CN201710505886A CN107099544A CN 107099544 A CN107099544 A CN 107099544A CN 201710505886 A CN201710505886 A CN 201710505886A CN 107099544 A CN107099544 A CN 107099544A
- Authority
- CN
- China
- Prior art keywords
- rvr
- lbcpf1
- genes
- rice
- paddy
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Developmental Biology & Embryology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Environmental Sciences (AREA)
- Botany (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a kind of PL LbCpf1 RVR genes of identification specific site in paddy gene target practice and its application.The present invention surprisingly obtains a kind of new PL LbCpf1 RVR genes during paddy gene Targeting, finds to carry out paddy rice shearing using the PL LbCpf1 RVR genes, can recognize specific site, and can recognize more genomic locus.And the present invention provides a kind of based on the gene constructed expression cassette and a kind of expression vector, and the application of the expression cassette and expression vector in terms of paddy gene editor.The present invention utilizes obtained PL LbCpf1 RVR to build plant expression vector, build paddy rice targeting vector, cause the DNA double chain in paddy rice specific gene site to shear after Introduced into Rice cell, realize paddy gene target practice, and transgenic rice plant is obtained with high mutation efficiency.
Description
Technical field
The present invention relates to biotechnology and field of plant genetic.Specifically, the present invention relates to one kind in base
Because recognizing the PL-LbCpf1-RVR genes of specific site and its application in terms of paddy gene target practice in target practice.
Background technology
CRISPR/Cas gene editings system turns into the important means of plant function gene studies and molecular breeding.Tradition
CRISPR/Cas systems more than using Cas9 albumen as endonuclease Plant Genome target cause fixed point cut,
So as to introduce mutation site-specific.Recently, it is found that another Cas PROTEIN Cs pf1 equally has endonuclease from bacterium
Activity.Relative to Cas9 albumen, Cpf1 has Some features on shearing mechanism and edit pattern.For example：Cas9 identifications 3 ' are held
PAM (Protospacer adjacent motif) sequence rich in cytimidine, and Cpf1 then recognizes that 5 ' ends are rich in thymidine
PAM sequences；Near-ends of the Cas9 generally in PAM 5 ' upstreams causes flat end DNA to cut, and Cpf1 is in PAM far downstream end
Cause viscous end cutting；Cas9 only have DNA shear actives, and Cpf1 can both shear DNA can also processing RNA；Cas9 exists
One section longer engineered rna sequence is needed during targeting editor, and Cpf1 then only needs to shorter crRNA sequences can complete target
To.
The most commonly used Cpf1 derives from Mao Luo sections bacterium (Lachnospiraceae bacterium) in current plant
ND2006 LbCpf1.LbCpf1 can effectively recognize TTTV (V=A/C/G) sequence in genome as PAM, so as to target
Sequence downstream.It is limited relative to NGG PAM, LbCpf1 the editable gene dosages that Cas9 is recognized.
But, there is presently no a kind of general feasible raising LbCpf1 editables bit number of points and it ensure that
The method of mutation efficiency of the LbCpf1 genes in crop gene target practice, and the LbCpf1 gene numbers of existing high mutation efficiency
Amount is limited.It is people therefore, it is possible to provide more LbCpf1 genes that more editing sites are provided in crop gene target practice
Highly desirable, but such gene is often what is mayed come by something with luck, but not by searching for it, the theory or method not shaped can be people
Find such gene and theoretical foundation is provided.
The content of the invention
In view of the above-mentioned problems, the present invention is desirable to provide a kind of LbCpf1- that specific site is recognized in crop gene target practice
RVR genes.
Specifically, in the first aspect, the present invention provides a kind of PL-LbCpf1-RVR genes of new PAM identifications,
PL-LbCpf1-RVR is named as, the PL-LbCpf1-RVR genes are comprised at least as shown in SEQ ID NO.1 in sequence table
Nucleotide sequence.The PL-LbCpf1-RVR genes of the present invention can recognize more editables in Transgenic Rice cultivating process
Site.
Preferably, the gene is by SEQ ID NO:Nucleotide sequence shown in 1 is constituted.Relative to existing LbCpf1 genes
For, the editor's scope for the PL-LbCpf1-RVR genes that the present invention is obtained is wider.
In second aspect, the present invention provides a kind of plant expression vector containing the PL-LbCpf1-RVR genes.Should
The construction method of plant expression vector be utilize NotI/SacI restriction enzyme sites, with NotI/SacI digestion pHUN600 carriers and return
Receive, because the PL-LbCpf1-RVR sequences two ends of synthesis are added with NotI/SacI restriction enzyme sites, it is possible to use T4 ligases are by PL-
LbCpf1-RVR is connected to pHUN600 carriers, obtains plant expression vector pHUN-RVRPL-LbCpf1-RVR (pHUN 6b11).
On the other hand, the present invention is experimental to be actually needed on the basis of expression vector, builds corresponding gene and beats
Targeting vector.
On the other hand, the present invention provides a kind of expression cassette, it is characterised in that above-mentioned PL- is included in the expression cassette
LbCpf1-RVR genes.
On the other hand, the present invention provides the application of a kind of said gene, expression cassette or carrier, it is characterised in that described to answer
With the shearing that DNA double chain in paddy rice body is completed using the PL-LbCpf1-RVR genes, and in the work of itself repair system
Under, the genetically modified plants with mutational site or plant part are obtained.
In another aspect, the present invention provides one kind and utilizes pHUN-PL-LbCpf1-RVR (pHUN 6b11) expression vector
(it contains the PL-LbCpf1-RVR genes), simply annealing, digestion connection need to be only carried out on the basis of expression vector and is made
With the targeting vector (pHUN 6b11-DL) of specific gene can be obtained, by the method for targeting vector Introduced into Rice cell, including
Following step：
(1) rice paddy seed is shelled, sterilize after embryo is separated, be placed on callus inducing medium with produce time
Level callus；
(2) secondary callus is transferred to new callus inducing medium preculture；
(3) targeting vector (the pHUN 6b11- by the callus obtained in step (2) with carrying PL-LbCpf1-RVR
DL Agrobacterium) contacts 15 minutes；
(4) callus of step (3) is transferred into upper upper three aseptic filter papers of pad (to add 2.5-3.5mL Agrobacteriums to hang
Floating culture medium) culture dish in, 21-23 DEG C is cultivated 48 hours；
(5) cultivated 5-7 days on screening and culturing medium before the callus of step (4) is placed in；
(6) callus of step (5) is shifted on screening and culturing medium, to obtain resistant calli；
(7) resistant calli is transferred to seedling differentiation in differentiation and regeneration culture medium；And
(8) seedling of step (7) is transferred in root media and taken root.
Seed in wherein described step (1) is mature seed；Inducing culture in the step (1), (2) is explanation
Inducing culture listed by book table 1；Being contacted with Agrobacterium in the step (3) is that callus is immersed in into the agriculture bar
In bacterium suspension；Agrobacterium suspension medium in the step (4) is the suspension medium listed by specification table 1；It is described
Preceding screening and culturing medium in step (5) is the preceding screening and culturing medium listed by specification table 1；Screening training in the step (6)
Foster base is the screening and culturing medium listed by specification table 1；Differentiation and regeneration culture medium in the step (7) is the institute of specification table 1
The differentiation and regeneration culture medium listed；Root media in the step (8) is the root media listed by specification table 1.
In preferred embodiments, the paddy rice is japonica rice, it is highly preferred that the paddy rice is japonica rice Nipponbare.
The exemplary formulations of the culture medium of table 1
" N6majors " being previously mentioned in form refers in the N6majors [NO3-]/[NH4+]=40mM/10mM.
In preferred embodiments, the nucleotides sequence of the PL-LbCpf1--RVR marker gene is classified as SEQ ID NO:
Nucleotide sequence shown in 1, specifically such as：
ATGTCCAAGCTGGAGAAGTTTACAAACTGTTACAGCCTCTCCAAAACCCTCAGGTTTAAAGCGATCCCGGTGGGCAAGAC
CCAGGAGAACATCGACAACAAGAGGCTCCTGGTGGAAGACGAGAAGCGCGCCGAAGACTACAAGGGCGTGA AGAAG
CTGCTCGAT AGGTACTACCTCAGCTTTATTAACGACGTGCTGCACAGCATCAAACTCAAGAATCTCAACAACTACA
TCTCCCTCTTCCGCAA AAAGACCCGCACCGAGAAGGAGAACAAGGAGCTGGAGAACCTGGAGATCAACCTCCGCAA
GGAAATCGCCAAAGCGTTCAAGG GCAATGAAGGGTACAAGAGCCTCTTCAAGAAAGACATCATCGAAACTATCCTC
CCAGAGTTTCTCGATGACAAGGACGAGATC GCGCTGGTGAACTCCTTTAACGGGTTCACAACCGCGTTTACCGGCT
TCTTTGATAACAGGGAAAATATGTTCTCCGAGGAGGC CAAGTCCACCAGCATCGCCTTCAGGTGTATCAACGAGAA
CCTCACCCGCTACATTTCCAATATGGACATTTTCGAGAAGGTGG ATGCGATCTTCGATAAGCACGAGGTGCAGGAG
ATCAAAGAGAAGATTCTCAATTCCGATTATGACGTCGAGGATTTCTTCGAA GGGGAGTTCTTTAATTTTGTGCTCA
CACAAGAGGGCATTGACGTGTACAACGCGATTATCGGGGGCTTCGTCACAGAGTCCGG GGAGAAGATTAAGGGGCT
GAATGAGTACATCAATCTGTACAATCAGAAGACCAAGCAGAAACTGCCGAAATTCAAGCCGCTCT
ACAAGCAAGTCCTGTCCGATAGGGAAAGCCTCTCCTTCTACGGCGAGGGCTATACCAGCGACGAGGAGGTGCTGGAA
GTCTTC CGCAACACACTGAATAAGAATAGCGAGATTTTCTCCTCCATCAAGAAGCTCGAGAAGCTCTTTAAGAACT
TTGACGAGTACAG CTCCGCCGGGATTTTCGTGAAGAACGGGCCGGCGATCAGCACCATCTCCAAGGACATCTTTGG
CGAGTGGAACGTCATCAGGG ACAAGTGGAACGCCGAGTACGACGACATCCACCTGAAGAAGAAGGCGGTGGTGACC
GAGAAGTATGAGGACGATCGCAGGAAG TCCTTCAAAAAAATCGGCTCCTTCAGCCTCGAACAGCTCCAGGAGTATG
CCGATGCGGATCTGTCCGTCGTCGAGAAGCTGAA GGAAATCATCATTCAGAAGGTCGACGAGATCTATAAAGTGTA
CGGGTCCAGCGAGAAGCTGTTCGACGCCGACTTTGTGCTCG AGAAGTCCCTCAAAAAGAATGACGCCGTGGTGGCC
ATTATGAAAGACCTGCTCGACTCCGTGAAGTCCTTCGAAAATTACATT AAAGCGTTCTTTGGGGAGGGGAAGGAAA
CTAACAGGGATGAGTCCTTCTATGGCGACTTTGTCCTCGCGTACGACATCCTGCT GAAGGTCGACCACATTTACGA
CGCGATCCGCAACTACGTGACACAGAAGCCGTACTCCAAAGACAAGTTCAAGCTGTACTTCC AGAACCCGCAATTT
ATGCGCGGCTGGGACAAGGATGTCGAGACAGACAGGCGCGCGACAATTCTCCGCTATGGCTCCAAATAC
TATCTGGCCATCATGGACAAGAAGTACGCGAAGTGCCTGCAGAAGATCGACAAAGACGACGTCAATGGCAACTATGA
AAAGAT CAACTACAAGCTGCTGCCGGGCCCGAACAAGATGCTCCCGAAGGTGTTCTTCAGCAAGAAGTGGATGGCC
TACTACAATCCAA GCGAGGATATTCAGAAAATCTATAAAAACGGGACCTTCAAGAAGGGGGACATGTTTAACCTCA
ACGACTGCCACAAGCTCATT GATTTCTTCAAGGATAGCATTTCCCGCTACCCGAAATGGTCCAATGCGTACGATTT
TAACTTCTCCGAGACAGAAAAGTACAA AGACATCGCGGGCTTTTACAGGGAGGTGGAGGAGCAAGGGTATAAAGTT
TCTTTTGAATCCGCGAGCAAGAAGGAAGTCGACA AGCTCGTCGAGGAGGGCAAGCTCTACATGTTCCAAATTTATA
ACAAGGACTTTTCCGACAAGAGCCATGGGACCCCAAACCTC CACACCATGTACTTCAAACTGCTCTTTGACGAGAA
CAACCACGGGCAAATCAGGCTGAGCGGCGGCGCCGAATTATTCATGCG CAGGGCCTCCCTCAAGAAGGAAGAGCTG
GTCGTCCATCCAGCCAATTCCCCGATCGCGAACAAGAACCCGGACAATCCGAAAA AGACCACCACCCTGTCCTACG
ACGTCTACAAGGACAAACGCTTCAGCGAAGACCAGTACGAATTACACATCCCAATTGCGATT AATAAGTGCCCAAA
GAATATCTTCAAAATTAATACAGAGGTCAGGGTGCTGCTCAAACACGACGACAATCCGTATGTCATCGG
CATTGACAGGGGCGAGCGCAATCTGCTCTATATCGTGGTCGTGGATGGGAAGGGCAATATTGTGGAGCAGTACTCCC
TGAACG AGATTATCAACAACTTCAATGGGATTAGGATTAAGACCGACTATCACAGCCTGCTCGACAAGAAAGAAAA
AGAGAGGTTTGAG GCCCGCCAAAACTGGACCTCCATTGAGAATATCAAAGAATTAAAGGCCGGCTATATTTCCCAA
GTCGTCCACAAGATCTGCGA GCTGGTGGAGAAATATGACGCCGTGATTGCGCTCGAAGACTTAAATTCTGGGTTCA
AGAACTCCCGCGTGAAGGTGGAAAAAC AGGTGTATCAGAAATTCGAGAAAATGCTGATCGACAAACTCAATTATAT
GGTGGATAAGAAGTCCAACCCGTGTGCCACAGGG GGCGCGCTGAAGGGCTATCAGATCACCAACAAGTTCGAGAGC
TTCAAGAGCATGAGCACCCAGAACGGGTTTATTTTCTACAT CCCGGCGTGGCTCACCTCCAAGATTGACCCGAGCA
CCGGCTTCGTGAACCTCCTGAAGACAAAGTATACCTCCATTGCCGACA GCAAGAAGTTTATCTCCTCCTTCGACCG
CATTATGTATGTGCCGGAGGAGGACCTCTTCGAGTTCGCCCTCGACTACAAAAAC TTCAGCCGCACAGATGCGGAT
TACATCAAGAAGTGGAAGCTGTACTCCTACGGGAACAGGATCCGCATCTTCAGGAATCCAAA AAAAAATAACGTCT
TTGACTGGGAGGAAGTGTGCCTGACATCCGCCTACAAGGAACTGTTCAATAAATACGGCATCAATTACC
AGCAGGGCGACATTCGCGCCCTCCTCTGTGAGCAGTCCGACAAAGCGTTTTACTCCAGCTTCATGGCCCTCATGTCC
CTGATG CTCCAAATGAGGAATAGCATCACAGGGCGCACCGACGTCGACTTCCTCATCAGCCCGGTGAAGAACTCCG
ACGGGATCTTTTA CGACTCCCGCAACTATGAGGCGCAAGAGAATGCGATCCTCCCGAAGAACGCCGATGCGAACGG
GGCCTATAATATCGCCAGGA AAGTGCTCTGGGCCATCGGGCAGTTCAAAAAGGCGGAGGATGAGAAGCTCGACAAG
GTGAAAATTGCCATTTCCAACAAGGAG TGGCTGGAGTACGCGCAGACCTCCGTGAAGCACAAAAGGCCGGCGGCCA
CGAAAAAGGCCGGCCAGGCAAAAAAGAAAAAGGG ATCCTACCCATACGATGTTCCAGATTACGCTTATCCCTACGA
CGTGCCTGATTATGCATACCCATATGATGTCCCCGACTATG CCTAA
Brief description of the drawings
PL-LbCpf1-RVR genes and original LbCpf1-RVR nucleotide sequences that Fig. 1 to Fig. 3 is obtained for the present invention
Compare.The nucleotide sequence for the PL-LbCpf1-RVR that wherein Optimized is obtained for the present invention, Original is original
LbCpf1-RVR nucleotide sequence.
PL-LbCpf1-RVR and original LbCpf1-RVR gene coded proteins that Fig. 4 is obtained for the present invention amino acid
Sequence alignment.The amino acid sequence for the PL-LbCpf1-RVR gene codes that Optimized is obtained for the present invention, Original
The amino acid sequence encoded for original LbCpf1-RVR.
Fig. 5 is PHUN6b11 (LbCpf1-RVR) vector plasmid schematic diagram.
Fig. 6 is mutant form examples of the T0 for DL gene locis of transfer-gen plant.
Embodiment
Embodiments of the invention are described below in conjunction with accompanying drawing.It should be noted that following embodiments are only used for showing the present invention
Example property implementation is illustrated, and not carries out any limitation to the present invention.Those skilled in the art can be to present invention work
Go out some equivalent changes and conspicuously improved.
In the case where no other are illustrated, the operation in following embodiments is using generally in the art
Routine operation is carried out.Those skilled in the art easily can obtain on such routine operation from the prior art
Teaching, for example, be referred to textbook Sambrook and David Russell, Molecular Cloning:A
Laboratory Manual,3rd ed.,Vols1,2；Charles Neal Stewart,Alisher Touraev,Vitaly
Citovsky and Tzvi Tzfira, Plant Transformation Technologies etc..It is used in following embodiments
Medicinal raw material, reagent, material etc., unless otherwise specified, be commercially available products.
Embodiment 1 --- the acquisition of PL-LbCpf1-RVR genes
Present inventor is by attempting using a variety of modes to the LbCpf1-RVR bases from Escherichia coli
It is unexpected to obtain a new DNA sequence dna because being transformed, and give termination codon of this DNA sequences end plus paddy rice preference
Sub- TGA, forms a new gene, and the gene is named as PL-LbCpf1-RVR, sequence such as SEQ ID NO:Shown in 1, with
LbCpf1-RVR sequence alignments are shown in Fig. 1.
Its base composition is further analyzed, 2 are the results are shown in Table.Known by table 2：PL-LbCpf1 G/C content is up to 53.06%,
Apparently higher than the 50.09% of LbCpf1.So gene structure is more stablized, because can form 3 hydrogen bonds between GC, and 2 between AT.
Table 2PL-LbCpf1-RVR and LbCpf1-RVR gene base composition analysis.
The protein amino acid sequence of analysis-RVR LbCpf1-RVR and LbCpf1-RVR coded by said gene, comparison result is shown in
Fig. 4.As can be seen from Figure 4, the two amino acid sequence is completely the same.
Designed PL-LbCpf1-RVR genes are sent after the synthesis of Suzhou Jin Weizhi bio tech ltd, are connected to
On PUC57-AMP carriers, PUC57-AMP-PL-LbCpf1-RVR carriers are formed, and be loaded into Escherichia coli XL-blue bacterial strains
In.
Embodiment 2 --- the structure containing PL-LbCpf1-RVR gene plant targeting vectors
From the Escherichia coli XL-blue containing PUC57-AMP-PL-LbCpf1-RVR carriers above, Axygen plasmids are used
Plasmid is extracted in extracts kit, NotI/SacI digestions are used, PL-LbCpf1-RVR fragments are reclaimed.Utilize NotI/SacI simultaneously
Enzyme carries out linearization process to pHUN600, pHUN600 is reclaimed, by above-mentioned PL-LbCpf1-RVR fragments and pHUN600 fragments
It is attached with T4 ligases (being purchased from TaKaRa companies), obtains plant expression vector pHUN600-PL-LbCpf1-RVR (figures
3) pHUN 6b11, are named as.
The nucleotide sequence of 6370-6398 in selection paddy rice DL genes (LOCOs03g0215200)TATCAAAGCTGCCAAGCCAGATATCCCTCACAG, (underscore part is TATC portions in 5 ' TATV- (N) X-3 ' structures
Point), it is used as target practice site.Target site sequence is merged to form pHUN6b11-DL with pHUN6b11.Using freeze-thaw method by plant
Expression vector is transferred to (Anhui agricultural science in Agrobacterium tumefaciems (Agrobacterium tumefaciens) EHA105 bacterial strains
Institute's rice research is preserved), for genetic transformation.
Embodiment 3 --- using pHUN6b11-DL as the rice transformation of targeting vector and mutant acquisition.
1st, the induction of mature embryo callus and preculture
The mature seed of Nipponbare (Paddy Rice Inst., Anhui Agriculture Science Academy's preservation) is shelled, choose outward appearance it is normal,
The clean seed without mildew, uses 70% alcohol, rocks 90sec, outwell alcohol；Again with 50% sodium hypochlorite containing Tween20
(stoste effective chlorine density is more than 4%, and every 100 milliliters add 1 and drip Tween20) solution cleaning seed, is rocked on shaking table
45min(180r/min).Sodium hypochlorite is outwelled, sterile washing 5-10 is eventually adding sterilized water, 30 all over to without sodium hypochlorite smell
DEG C soaked overnight.Embryo is separated along aleurone with knife blade, scultellum is placed on inducing culture (composition is shown in Table 1) upward, 12
Grain/ware, 30 DEG C of light cultures are with evoked callus.
Occur spherical, coarse, lurid secondary callus after two weeks, preculture operation can be carried out, will be secondary
Callus is gone on new callus inducing medium, 30 DEG C of light culture precultures 5 days.It is after preculture terminates, state is good
Well, divide vigorous little particle to be collected into 50mL sterile centrifugation tube with spoon, infected for Agrobacterium.
2nd, the culture of agrobacterium strains and suspension prepare
By the agrobacterium strains EHA105 containing pHUN6b11-DL carriers on the LB flat boards containing 50mg/L kanamycins
Aseptic inoculation ring is used after line (composition is shown in Table 1), 28 DEG C of dark culturings, 24h by the Agrobacterium inoculation of activation to fresh 50mg/
On the LB flat boards of L kanamycins, carry out second and activate, 28 DEG C of dark culturings are stayed overnight.Added in 50mL sterile centrifugation tube
20-30mL Agrobacteriums suspension medium (composition is shown in Table 1), is scraped the Agrobacterium for activating 2 times with oese, adjusts OD660
(Optical density660nm, 660nm light absorption value) is stored at room temperature more than 30min to about 0.10-0.25.
3rd, infect and co-culture
Into ready callus (see step 1), plus agrobacterium suspension, 15min is soaked, is gently shaken frequently therebetween
It is dynamic.Liquid (as far as possible dripping liquid net) is outwelled in immersion after terminating, the unnecessary agriculture bar on callus surface is sucked with aseptic filter paper
Bacterium bacterium solution, and dried up in super-clean bench with sterile wind.Three sterile filters on 100 × 25mm disposable sterilized culture dish pad
Paper, adds 2.5mL Agrobacterium suspension mediums, the callus after blotting is dispersed on filter paper, 23 DEG C of dark culturings
48h。
4th, preceding screening and screening and culturing
After co-cultivation terminates, the callus through co-cultivation is dispersed evenly in preceding screening and culturing medium (composition is shown in Table 1),
30 DEG C of dark culturings 5 days.After preceding screening and culturing terminates, callus is gone on screening and culturing medium (composition is shown in Table 1), Mei Gepei
Foster ware connects 25 callus, 30 DEG C of dark culturings, after 2-3 weeks, and resistant calli growth is obvious, can carry out differentiation and regeneration
Operation.
5th, differentiation and regeneration
Each independent transformants select good, the fresh little particle of 2-3 growth conditions, go on differentiation and regeneration culture medium
(composition is shown in Table 1).5 independent transformants are connect per culture dish.28 DEG C of illumination cultivations, periodicity of illumination is 16h illumination 8h dark, light intensity
Spend for 3000-6000lx.
6th, take root and transplant
When the bud length that resistant calli breaks up is to about 2cm, each independent transformants only take one plant of well-grown seedling,
Move on root media (composition is shown in Table 1), 28 DEG C of illumination cultivations, periodicity of illumination is 16h illumination 8h dark, and luminous intensity is
3000-6000lx.After two weeks, the seedling of well developed root system is selected, culture medium is washed with water, transplanting is buried.
7th, Molecular Identification
Before transplanting, rice leaf sample is taken, carries out that DNA is small to be carried with CTAB methods.By resulting genomic DNA sample
Product are analyzed for PCR.For expand PL-LbCpf1-RVR PCR primers for 5 '-TTCACAACCGCGTTTACC-3 ' and 5 '-
TCACCACCGCCTTCTTCT-3 ', produces the fragment that length is 492bp.By PCR components first 95 DEG C keep 5 minutes, then
Carry out 32 circulations：94 DEG C 45 seconds, 56 DEG C 45 seconds, 72 DEG C 45 seconds, finally 72 DEG C extend 10 minutes.Selecting 8 turns base at random
It is identified because of plant, it is the positive, positive rate reaches 100%.
Leaf DNA extraction is all carried out to 48 plant obtained by transgenosis, gained genome DNA sample is used for PCR
Analysis.For expand the PCR primers of PDS genetic fragments for 5 '-CATGGATATTTTAGCGGATCA-3 ' and 5 '-
GGAGATATTGGGGATGAGTAGA -3 ', produces the fragment that length is 155bp.PCR components are kept for 5 points at 95 DEG C first
Clock, then carries out 32 circulations：94 DEG C 30 seconds, 60 DEG C 30 seconds, 72 DEG C 30 seconds, finally 72 DEG C extend 10 minutes.By PCR primer
Sequencing.Measured result is compared with wild-type sequence.There are 8 plants to there occurs point mutation in the 48 plants of transfer-gen plants surveyed；
Mutation efficiency is 16.7%.Illustrate that engineered Lbcpf1-RVR can be sheared to rice genome, fractional mutations form
See Fig. 6.
The PL-LbCpf1-RVR genes of the present invention, which can not only be applied effectively, to be realized in the transgenic culturing of paddy rice and cuts
Cut, and for existing LbCpf1 genes, in Transgenic Rice cultivation, the PL-LbCpf1- that the present invention is obtained
Editor's scope of RVR genes is wider, and experimental verification confirmation, itself and existing LbCpf1 phases are carried out through Theoretical Proof and to which part
Than, when paddy rice is sheared, editor's scope of at least more than 1.5, the site that can exactly edit more how close than Lbcpf1 two
Times, Lbcpf1 can recognize 1,500,000 sites on rice genome, and PL-Lbcpf1-RVR can recognize nearly 230 myriabit point.This hair
Bright gene can recognize TTTV sites, can also recognize TATV sites.
Sequence table
<110>Paddy Rice Inst., Anhui Agriculture Science Academy
<120>Paddy gene target practice in recognize specifically provide more editing sites PL-LbCpf1-RVR genes RVR and its
Using
<130> HCI20170170
<160> 5
<170> PatentIn version 3.3
<210> 1
<211> 3822
<212> DNA
<213> PL-LbCpf1--RVR
<400> 1:
atgtccaagc tggagaagtt tacaaactgt tacagcctct ccaaaaccct caggtttaaa 60
gcgatcccgg tgggcaagac ccaggagaac atcgacaaca agaggctcct ggtggaagac 120
gagaagcgcg ccgaagacta caagggcgtg aagaagctgc tcgataggta ctacctcagc 180
tttattaacg acgtgctgca cagcatcaaa ctcaagaatc tcaacaacta catctccctc 240
ttccgcaaaa agacccgcac cgagaaggag aacaaggagc tggagaacct ggagatcaac 300
ctccgcaagg aaatcgccaa agcgttcaag ggcaatgaag ggtacaagag cctcttcaag 360
aaagacatca tcgaaactat cctcccagag tttctcgatg acaaggacga gatcgcgctg 420
gtgaactcct ttaacgggtt cacaaccgcg tttaccggct tctttgataa cagggaaaat 480
atgttctccg aggaggccaa gtccaccagc atcgccttca ggtgtatcaa cgagaacctc 540
acccgctaca tttccaatat ggacattttc gagaaggtgg atgcgatctt cgataagcac 600
gaggtgcagg agatcaaaga gaagattctc aattccgatt atgacgtcga ggatttcttc 660
gaaggggagt tctttaattt tgtgctcaca caagagggca ttgacgtgta caacgcgatt 720
atcgggggct tcgtcacaga gtccggggag aagattaagg ggctgaatga gtacatcaat 780
ctgtacaatc agaagaccaa gcagaaactg ccgaaattca agccgctcta caagcaagtc 840
ctgtccgata gggaaagcct ctccttctac ggcgagggct ataccagcga cgaggaggtg 900
ctggaagtct tccgcaacac actgaataag aatagcgaga ttttctcctc catcaagaag 960
ctcgagaagc tctttaagaa ctttgacgag tacagctccg ccgggatttt cgtgaagaac 1020
gggccggcga tcagcaccat ctccaaggac atctttggcg agtggaacgt catcagggac 1080
aagtggaacg ccgagtacga cgacatccac ctgaagaaga aggcggtggt gaccgagaag 1140
tatgaggacg atcgcaggaa gtccttcaaa aaaatcggct ccttcagcct cgaacagctc 1200
caggagtatg ccgatgcgga tctgtccgtc gtcgagaagc tgaaggaaat catcattcag 1260
aaggtcgacg agatctataa agtgtacggg tccagcgaga agctgttcga cgccgacttt 1320
gtgctcgaga agtccctcaa aaagaatgac gccgtggtgg ccattatgaa agacctgctc 1380
gactccgtga agtccttcga aaattacatt aaagcgttct ttggggaggg gaaggaaact 1440
aacagggatg agtccttcta tggcgacttt gtcctcgcgt acgacatcct gctgaaggtc 1500
gaccacattt acgacgcgat ccgcaactac gtgacacaga agccgtactc caaagacaag 1560
ttcaagctgt acttccagaa cccgcaattt atgcgcggct gggacaagga tgtcgagaca 1620
gacaggcgcg cgacaattct ccgctatggc tccaaatact atctggccat catggacaag 1680
aagtacgcga agtgcctgca gaagatcgac aaagacgacg tcaatggcaa ctatgaaaag 1740
atcaactaca agctgctgcc gggcccgaac aagatgctcc cgaaggtgtt cttcagcaag 1800
aagtggatgg cctactacaa tccaagcgag gatattcaga aaatctataa aaacgggacc 1860
ttcaagaagg gggacatgtt taacctcaac gactgccaca agctcattga tttcttcaag 1920
gatagcattt cccgctaccc gaaatggtcc aatgcgtacg attttaactt ctccgagaca 1980
gaaaagtaca aagacatcgc gggcttttac agggaggtgg aggagcaagg gtataaagtt 2040
tcttttgaat ccgcgagcaa gaaggaagtc gacaagctcg tcgaggaggg caagctctac 2100
atgttccaaa tttataacaa ggacttttcc gacaagagcc atgggacccc aaacctccac 2160
accatgtact tcaaactgct ctttgacgag aacaaccacg ggcaaatcag gctgagcggc 2220
ggcgccgaat tattcatgcg cagggcctcc ctcaagaagg aagagctggt cgtccatcca 2280
gccaattccc cgatcgcgaa caagaacccg gacaatccga aaaagaccac caccctgtcc 2340
tacgacgtct acaaggacaa acgcttcagc gaagaccagt acgaattaca catcccaatt 2400
gcgattaata agtgcccaaa gaatatcttc aaaattaata cagaggtcag ggtgctgctc 2460
aaacacgacg acaatccgta tgtcatcggc attgacaggg gcgagcgcaa tctgctctat 2520
atcgtggtcg tggatgggaa gggcaatatt gtggagcagt actccctgaa cgagattatc 2580
aacaacttca atgggattag gattaagacc gactatcaca gcctgctcga caagaaagaa 2640
aaagagaggt ttgaggcccg ccaaaactgg acctccattg agaatatcaa agaattaaag 2700
gccggctata tttcccaagt cgtccacaag atctgcgagc tggtggagaa atatgacgcc 2760
gtgattgcgc tcgaagactt aaattctggg ttcaagaact cccgcgtgaa ggtggaaaaa 2820
caggtgtatc agaaattcga gaaaatgctg atcgacaaac tcaattatat ggtggataag 2880
aagtccaacc cgtgtgccac agggggcgcg ctgaagggct atcagatcac caacaagttc 2940
gagagcttca agagcatgag cacccagaac gggtttattt tctacatccc ggcgtggctc 3000
acctccaaga ttgacccgag caccggcttc gtgaacctcc tgaagacaaa gtatacctcc 3060
attgccgaca gcaagaagtt tatctcctcc ttcgaccgca ttatgtatgt gccggaggag 3120
gacctcttcg agttcgccct cgactacaaa aacttcagcc gcacagatgc ggattacatc 3180
aagaagtgga agctgtactc ctacgggaac aggatccgca tcttcaggaa tccaaaaaaa 3240
aataacgtct ttgactggga ggaagtgtgc ctgacatccg cctacaagga actgttcaat 3300
aaatacggca tcaattacca gcagggcgac attcgcgccc tcctctgtga gcagtccgac 3360
aaagcgtttt actccagctt catggccctc atgtccctga tgctccaaat gaggaatagc 3420
atcacagggc gcaccgacgt cgacttcctc atcagcccgg tgaagaactc cgacgggatc 3480
ttttacgact cccgcaacta tgaggcgcaa gagaatgcga tcctcccgaa gaacgccgat 3540
gcgaacgggg cctataatat cgccaggaaa gtgctctggg ccatcgggca gttcaaaaag 3600
gcggaggatg agaagctcga caaggtgaaa attgccattt ccaacaagga gtggctggag 3660
tacgcgcaga cctccgtgaa gcacaaaagg ccggcggcca cgaaaaaggc cggccaggca 3720
aaaaagaaaa agggatccta cccatacgat gttccagatt acgcttatcc ctacgacgtg 3780
cctgattatg catacccata tgatgtcccc gactatgcct aa 3822
<210> 2
<211> 18
<212> DNA
<213>Primer
<400> 2:
ttcacaaccg cgtttacc 18
<210> 3
<211> 22
<212> DNA
<213>Primer
<400> 3:
tcaccaccgc cttcttct 18
<210> 4
<211> 21
<212> DNA
<213>Primer
<400> 4:
catggatatt ttagcggatc a 21
<210> 5
<211> 22
<212> DNA
<213>Primer
<400> 5:
ggagatattg gggatgagta ga 22
Claims (9)
1. a kind of PL-LbCpf1-RVR genes that specific site is recognized in paddy gene target practice, it is characterised in that the PL-
LbCpf1-RVR genes comprise at least the nucleotide sequence as shown in SEQ ID NO.1 in sequence table.
2. a kind of RVR according to claim 1 can realize the PL-LbCpf1-RVR bases of target practice in paddy gene target practice
Cause, it is characterised in that the PL-LbCpf1-RVR genes include the nucleotide sequence shown in SEQ ID NO.1 in sequence table
Variant.
3. a kind of expression cassette, it is characterised in that the PL-LbCpf1-RVR genes described in claim 1 are included in the expression cassette.
4. a kind of expression vector, it is characterised in that the expression vector includes the PL-LbCpf1-RVR bases described in claim 1
Expression cassette described in cause or claim 3.
5. the expression cassette described in gene, claim 3 described in a kind of claim 1 or the carrier described in claim 4 should
With, it is characterised in that the shearing to rice genome is realized in the application using the PL-LbCpf1-RVR genes, is obtained
Obtain the genetically modified plants containing mutational site or plant part.
6. a kind of beaten using the expression vector establishment specific gene containing the PL-LbCpf1-RVR genes described in claim 1
Targeting vector, the method for targeting vector Introduced into Rice cell comprises the steps：
(1) rice paddy seed is shelled, sterilize after embryo is separated, be placed on callus inducing medium and be cured with producing secondary
Injured tissue；
(2) the secondary callus is transferred to new callus inducing medium and carries out preculture, obtain callus；
(3) callus obtained in step (2) is contacted 15 minutes with Agrobacterium, wherein, institute is introduced in the Agrobacterium
State and the PL-LbCpf1- that the RVR recognizes specific site in paddy gene target practice is carried in targeting vector, the targeting vector
RVR genes；
(4) callus after step (3) processing is transferred to and be lined with thereon in the culture dish of aseptic filter paper, 21-23 DEG C of culture
48 hours；
(5) cultivated 5-7 days on screening and culturing medium before the callus after step (4) processing is placed in；
(6) callus after step (5) processing is shifted on screening and culturing medium, to obtain resistant calli；
(7) resistant calli is transferred to seedling differentiation in differentiation and regeneration culture medium；With
(8) seedling obtained in step (7) is transferred in root media and taken root.
7. the expression vector establishment specific gene targeting vector of PL-LbCpf1-RVR genes according to claim 6, will beat
The method of targeting vector Introduced into Rice cell, it is characterised in that the paddy rice is japonica rice.
8. the expression vector establishment specific gene targeting vector of PL-LbCpf1-RVR genes according to claim 6, will beat
The method of targeting vector Introduced into Rice cell, it is characterised in that methods described also includes carrying out molecule mirror to obtained paddy rice sample
It is fixed.
9. the expression vector establishment specific gene targeting vector of PL-LbCpf1-RVR genes according to claim 8, will beat
The method of targeting vector Introduced into Rice cell, it is characterised in that the PCR primer that the Molecular Identification is used for 5 '-
TTCACAACCGCGTTTACC-3 ' and 5 '-TCACCACCGCCTTCTTCT-3 '.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710505886.9A CN107099544A (en) | 2017-06-28 | 2017-06-28 | The PL LbCpf1 RVR genes of identification specific site and its application in paddy gene target practice |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710505886.9A CN107099544A (en) | 2017-06-28 | 2017-06-28 | The PL LbCpf1 RVR genes of identification specific site and its application in paddy gene target practice |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107099544A true CN107099544A (en) | 2017-08-29 |
Family
ID=59664546
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710505886.9A Pending CN107099544A (en) | 2017-06-28 | 2017-06-28 | The PL LbCpf1 RVR genes of identification specific site and its application in paddy gene target practice |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107099544A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110283840A (en) * | 2019-04-11 | 2019-09-27 | 华中农业大学 | The accurate efficient edit methods of upland cotton genome |
| CN111647618A (en) * | 2020-01-15 | 2020-09-11 | 温州医科大学 | Novel genome editing tool (Lb2Cas12a-RVR) and construction method and application method thereof |
| CN112626049A (en) * | 2020-12-14 | 2021-04-09 | 安徽省农业科学院水稻研究所 | SpCas9-NRRH mutant for recognizing specific sites in rice gene targeting and application thereof |
| CN112725348A (en) * | 2019-10-28 | 2021-04-30 | 安徽省农业科学院水稻研究所 | Gene and method for improving single-base editing efficiency of rice and application of gene |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106591335A (en) * | 2016-11-08 | 2017-04-26 | 安徽省农业科学院水稻研究所 | Codon vegetalization-transformed LbCpf1 gene and application thereof |
-
2017
- 2017-06-28 CN CN201710505886.9A patent/CN107099544A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106591335A (en) * | 2016-11-08 | 2017-04-26 | 安徽省农业科学院水稻研究所 | Codon vegetalization-transformed LbCpf1 gene and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| LANQIN XIA等: "Expanding the Scope of CRISPR/Cpf1-Mediated Genome Editing in Rice", 《MOLECULAR PLANT》 * |
| LINYI GAO等: "Engineered Cpf1 variants with altered PAM specificities increase genome targeting range", 《NATURE BIOTECHNOLOGY》 * |
| RONGFANG XU等: "Enhanced genome editing in rice using single transcript unit CRISPR-LbCpf1 systems", 《PLANT BIOTECHNOLOGY JOURNAL》 * |
| SYED SHAN-E-ALI ZAIDI等: "CRISPR-Cpf1: A New Tool for Plant Genome Editing", 《TRENDS IN PLANT SCIENCE》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110283840A (en) * | 2019-04-11 | 2019-09-27 | 华中农业大学 | The accurate efficient edit methods of upland cotton genome |
| CN112725348A (en) * | 2019-10-28 | 2021-04-30 | 安徽省农业科学院水稻研究所 | Gene and method for improving single-base editing efficiency of rice and application of gene |
| CN112725348B (en) * | 2019-10-28 | 2022-04-01 | 安徽省农业科学院水稻研究所 | Gene and method for improving single-base editing efficiency of rice and application of gene |
| CN111647618A (en) * | 2020-01-15 | 2020-09-11 | 温州医科大学 | Novel genome editing tool (Lb2Cas12a-RVR) and construction method and application method thereof |
| CN112626049A (en) * | 2020-12-14 | 2021-04-09 | 安徽省农业科学院水稻研究所 | SpCas9-NRRH mutant for recognizing specific sites in rice gene targeting and application thereof |
| CN112626049B (en) * | 2020-12-14 | 2022-04-01 | 安徽省农业科学院水稻研究所 | SpCas9-NRRH mutant for recognizing specific sites in rice gene targeting and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107099544A (en) | The PL LbCpf1 RVR genes of identification specific site and its application in paddy gene target practice | |
| CN107142271A (en) | The PL LbCpf1 RR genes with high mutation efficiency and its application in gene targeting | |
| CN112538492B (en) | SpCas9n variant capable of recognizing NRTH (Polyacrylamide) as PAM (Polyacrylamide) sequence and corresponding base editing system | |
| CN110283838A (en) | A kind of high shear efficiency ScCas9 gene and its application | |
| CN109929857B (en) | High-editing-efficiency SaCas9 gene and application thereof | |
| CN107353332A (en) | A kind of rice chloroplast developmental regulation Gene A HS1 and its coding protein and application | |
| CN112662687B (en) | Method, kit and gene for delaying flowering phase of corn | |
| CN106591335A (en) | Codon vegetalization-transformed LbCpf1 gene and application thereof | |
| CN110129358B (en) | Application of rice Os01g32730 gene | |
| CN102586250A (en) | Promoter of terpene floral scent gene Hctps1 in hedychium gardneranum and application of promoter | |
| CN116732070A (en) | CGBE single base editor capable of realizing base transversion and application thereof | |
| CN109486840B (en) | Codon-plant-modified NmeCas9 gene and application thereof | |
| CN112646016B (en) | Gene and method for changing flowering period of corn | |
| CN110257406B (en) | codon-Plant-modified Plant Nme2Cas9 gene and application thereof | |
| CN107058324A (en) | Rice root specific expression promoter POsRO4 and corresponding rice cultivating method | |
| CN112430613A (en) | SpG gene with wide editing range and application thereof | |
| CN112430612A (en) | SpRY gene capable of being efficiently cut and application thereof | |
| CN112661823B (en) | Gene and method for changing flowering period of corn | |
| CN1184231C (en) | Wheat TaDREB, its code gene and method for culturing adverse-resistant plant | |
| CN112646015B (en) | Gene and method for changing flowering period of corn | |
| CN115820691B (en) | LbCPf1 variant-based rice base editing system and application | |
| CN112724215B (en) | Gene and method for changing flowering period of corn | |
| CN115927441B (en) | Application of corn gene AFB1 in regulation and control of corn plant height traits | |
| CN112724216B (en) | Gene and method for changing flowering period of corn | |
| CN112646014B (en) | Gene and method for changing flowering period of corn |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170829 |