CN111647618A - Novel genome editing tool (Lb2Cas12a-RVR) and construction method and application method thereof - Google Patents
Novel genome editing tool (Lb2Cas12a-RVR) and construction method and application method thereof Download PDFInfo
- Publication number
- CN111647618A CN111647618A CN202010042406.1A CN202010042406A CN111647618A CN 111647618 A CN111647618 A CN 111647618A CN 202010042406 A CN202010042406 A CN 202010042406A CN 111647618 A CN111647618 A CN 111647618A
- Authority
- CN
- China
- Prior art keywords
- rvr
- lb2cas12a
- seq
- sequence
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a novel genome editing tool (Lb2Cas12a-RVR) and a construction method and an application method thereof, and the technical scheme is characterized by comprising a mutant protein coding plasmid pcDNA3.1-hLb2Cas12a-RVR for coding and expressing Lb2Cas12a-RVR, wherein the DNA sequence of the coding protein is shown as SEQ ID NO. 1.
Description
Technical Field
The invention relates to a novel genome editing tool (Lb2Cas12a-RVR) and a construction method and an application method thereof.
Background
As a novel genome editing tool, the new member of CRISPR family Cas12a has received extensive attention in recent years and has exposed its corners in the field of gene therapy of human cell and animal and plant models. Cas12 a-mediated targeted genome engineering techniques have achieved a wide range of research and medical applications. However, existing studies mostly focus on FnCas12a, assas 12a and LbCas12a, and limited to this, mammalian-related genome editing studies also mostly spread around assas 12a and LbCas12a, however, for broad application in precise site-specific human genome editing, the limited target selection spectrum and low activity, low fidelity would still be bottlenecks in its mediated application. Therefore, there is an urgent need to develop new Cas12a nucleases with improved characteristics for manipulating the human genome.
In addition, the genome of a cell is affected by various endogenous or exogenous factors during the self-replication of the chromosome, and thus various forms of damage exist, thereby initiating a series of cytological reactions. The types of DNA damage are many, with Double Strand Break (DSB) being the most severe. And repair of DNA DSBs is more difficult than other types of DNA damage, with unrepaired repair potentially leading to chromosome breakage and cell death, and mis-repair potentially leading to chromosome deletions, rearrangements, translocations, inversions, and the like. Incomplete repair of DNA damage can lead to genomic instability, and in order to combat damage, body cells evolve multiple repair systems to ensure genomic integrity, with homologous recombination repair (HDR) being the primary means of DNA DSB damage repair. HDR occurs primarily at the S phase of mitosis and at the G2 checkpoint, where DNA DSBs cause broken DNA ends to bind to sister chromatids and repair.
Based on applicants ' previous studies (Tu, M.et al.A ' new release of life ': FnCpf1 stress DNAs cleavage activity for genome editing in human cells.nucleic acids research.2017; 45(19): 11295-. Therefore, the Lb2Cas12a mutant is developed into a more efficient human genome editing tool, the application of an applicant to a gene editor can be greatly expanded, the Lb2Cas12a mutant has extensive application in basic research, clinical treatment, microbial breeding, plant breeding and the like, and a powerful research tool is particularly provided for clinical disease treatment.
Disclosure of Invention
Aiming at the defects in the prior art, the invention aims to provide a novel modified genome editing tool and a construction method and an application method thereof, and the novel modified genome editing tool and the construction method and the application method thereof are used for solving the problems of low activity and low fidelity of specific gene editing at an accurate site, and are beneficial to the screening of clinical tumor treatment targets, the development of medicines, the correction of pathogenic mutation and the like for deep research. It has genome editing activity in human cells, and has better PAM flexibility, high fidelity, and a special cleavage pattern.
In order to achieve the purpose, the invention provides the following technical scheme: a novel modified genome editing tool comprises a coding expression Lb2Cas12a-RVR mutant protein coding plasmid pcDNA3.1-hLb2Cas12a-RVR, and the DNA sequence of the coding protein is shown as SEQ ID NO. 1.
A method for constructing a gene editing tool comprises the following steps:
step 21: comprises a primer, wherein the primer is provided with corresponding mutation, and the sequence of the primer is shown as SEQ ID NO. 7;
step 22: amplifying a fragment 1 with a sequence shown as SEQ ID NO.2 and an amplified fragment 2 with a sequence shown as SEQ ID NO.3 from a pY011(pcDNA3.1-hLb2Cpf1) vector;
step 23: the amplified fragment and the backbone were subjected to Clonexpress II One Step Cloning Kit to obtain the mutated vector pcDNA3.1-hLb2Cas12 a-RVR.
An application method of an Lb2Cas12a-RVR gene editing tool comprises the following steps:
step 33: comprises the steps of constructing crRNA aiming at a DNA target point of a certain pathogenic gene, and introducing the crRNA and an Lb2Cas12a-RVR expression vector in a eukaryotic cell together to repair the target site in situ;
step 34: constructing a GFP (green fluorescent protein) reporting system for evaluating the editing activity, efficiency and fidelity of Lb2Cas12a-RVR, wherein the sequence of a GFP gene is SEQ ID NO. 4;
step 35: constructing an Lb2Cas12a-RVR gene repair template RS1-GFP cell line, wherein the sequence of the utilized RS1-GFP gene is SEQ ID NO. 5;
step 36: extracting the processed eukaryotic cell genome DNA, performing PCR amplification by using a specific primer aiming at a target spot, constructing a high-throughput sequencing DNA library by using a PCR product of the genome DNA, and performing high-throughput sequencing.
The invention has the beneficial effects that: by passing
Drawings
FIG. 1 is a schematic diagram of pcDNA3.1-hLb2Cas12a-RVR plasmid;
FIG. 2 is a schematic diagram of the pSin-GFP plasmid;
FIG. 3 is a schematic diagram of the pSin-RS1-GFP plasmid;
FIG. 4 shows the result of HDR repair of pcDNA3.1-hLb2Cas12a-RVR in RS1 gene.
Detailed Description
The present invention will be described in further detail with reference to the accompanying drawings and examples. In which like parts are designated by like reference numerals. It should be noted that the terms "front," "back," "left," "right," "upper" and "lower" used in the following description refer to directions in the drawings, and the terms "bottom" and "top," "inner" and "outer" refer to directions toward and away from, respectively, the geometric center of a particular component.
Referring to fig. 1 to 4, the novel genome editing tool for modification in this example includes a plasmid pcdna3.1-hLb2Cas12a-RVR encoding mutant protein expressing Lb2Cas12a-RVR, and the DNA sequence of the encoded protein is shown as seq id No. 1.
The improvement is as follows: SEQ ID NO.1 Lb2Cas12a-RVR gene sequence (artificially synthesized)
atgtactatgagtccctgaccaagcagtaccccgtgtctaagacaatccggaatgagctgatccctatcggcaagacactggataacatccgccagaacaatatcctggagagcgacgtgaagcggaagcagaactacgagcacgtgaagggcatcctggatgagtatcacaagcagctgatcaacgaggccctggacaattgcaccctgccatccctgaagatcgccgccgagatctacctgaagaatcagaaggaggtgtctgacagagaggatttcaacaagacacaggacctgctgaggaaggaggtggtggagaagctgaaggcccacgagaactttaccaagatcggcaagaaggacatcctggatctgctggagaagctgccttccatctctgaggacgattacaatgccctggagagcttccgcaacttttacacctatttcacatcctacaacaaggtgcgggagaatctgtattctgataaggagaagagctccacagtggcctacagactgatcaacgagaatttcccaaagtttctggacaatgtgaagagctataggtttgtgaaaaccgcaggcatcctggcagatggcctgggagaggaggagcaggactccctgttcatcgtggagacattcaacaagaccctgacacaggacggcatcgatacctacaattctcaagtgggcaagatcaactctagcatcaatctgtataaccagaagaatcagaaggccaatggcttcagaaagatccccaagatgaagatgctgtataagcagatcctgtccgatagggaggagtctttcatcgacgagtttcagagcgatgaggtgctgatcgacaacgtggagtcttatggcagcgtgctgatcgagtctctgaagtcctctaaggtgagcgccttctttgatgccctgagagagtctaagggcaagaacgtgtacgtgaagaatgacctggccaagacagccatgagcaacatcgtgttcgagaattggaggacctttgacgatctgctgaaccaggagtacgacctggccaacgagaacaagaagaaggacgataagtatttcgagaagcgccagaaggagctgaagaagaataagagctactccctggagcacctgtgcaacctgtccgaggattcttgtaacctgatcgagaattatatccaccagatctccgacgatatcgagaatatcatcatcaacaatgagacattcctgcgcatcgtgatcaatgagcacgacaggtcccgcaagctggccaagaaccggaaggccgtgaaggccatcaaggactttctggattctatcaaggtgctggagcgggagctgaagctgatcaacagctccggccaggagctggagaaggatctgatcgtgtactctgcccacgaggagctgctggtggagctgaagcaggtggacagcctgtataacatgaccagaaattatctgacaaagaagcctttctctaccgagaaggtgaagctgaactttaatcgcagcacactgctgCGcggctgggatcggaatGTggagacagacCGcctgggcgtgctgctgctgaaggacggcaagtactatctgggcatcatgaacacaagcgccaataaggccttcgtgaatccccctgtggccaagaccgagaaggtgtttaagaaggtggattacaagctgctgccagtgcccaaccagatgctgccaaaggtgttctttgccaagagcaatatcgacttctataacccctctagcgagatctactccaattataagaagggcacccacaagaagggcaatatgttttccctggaggattgtcacaacctgatcgacttctttaaggagtctatcagcaagcacgaggactggagcaagttcggctttaagttcagcgatacagcctcctacaacgacatctccgagttctatcgcgaggtggagaagcagggctacaagctgacctatacagacatcgatgagacatacatcaatgatctgatcgagcggaacgagctgtacctgttccagatctataataaggactttagcatgtactccaagggcaagctgaacctgcacacactgtatttcatgatgctgtttgatcagcgcaatatcgacgacgtggtgtataagctgaacggagaggcagaggtgttctataggccagcctccatctctgaggacgagctgatcatccacaaggccggcgaggagatcaagaacaagaatcctaaccgggccagaaccaaggagacaagcaccttcagctacgacatcgtgaaggataagcggtatagcaaggataagtttaccctgcacatccccatcacaatgaacttcggcgtggatgaggtgaagcggttcaacgacgccgtgaacagcgccatccggatcgatgagaatgtgaacgtgatcggcatcgaccggggcgagagaaatctgctgtacgtggtggtcatcgactctaagggcaacatcctggagcagatctccctgaactctatcatcaataaggagtacgacatcgagacagattatcacgcactgctggatgagagggagggcggcagagataaggcccggaaggactggaacaccgtggagaatatcagggacctgaaggccggctacctgagccaggtggtgaacgtggtggccaagctggtgctgaagtataatgccatcatctgcctggaggacctgaactttggcttcaagaggggccgccagaaggtggagaagcaggtgtaccagaagttcgagaagatgctgatcgataagctgaattacctggtcatcgacaagagccgcgagcagacatcccctaaggagctgggaggcgccctgaacgcactgcagctgacctctaagttcaagagctttaaggagctgggcaagcagtccggcgtgatctactatgtgcctgcctacctgacctctaagatcgatccaaccacaggcttcgccaatctgttttatatgaagtgtgagaacgtggagaagtccaagagattctttgacggctttgatttcatcaggttcaacgccctggagaacgtgttcgagttcggctttgactaccggagcttcacccagagggcctgcggcatcaattccaagtggaccgtgtgcaccaacggcgagcgcatcatcaagtatcggaatccagataagaacaatatgttcgacgagaaggtggtggtggtgaccgatgagatgaagaacctgtttgagcagtacaagatcccctatgaggatggcagaaatgtgaaggacatgatcatcagcaacgaggaggccgagttctaccggagactgtataggctgctgcagcagaccctgcagatgagaaacagcacctccgacggcacaagggattacatcatctcccctgtgaagaataagagagaggcctacttcaacagcgagctgtccgacggctctgtgccaaaggacgccgatgccaacggcgcctacaatatcgccagaaagggcctgtgggtgctggagcagatcaggcagaagagcgagggcgagaagatcaatctggccatgaccaacgccgagtggctggagtatgcccagacacacctgctgaaaaggccggcggccacgaaaaaggccggccaggcaaaaaagaaaaagggatcctacccatacgatgttccagattacgcttatccctacgacgtgcctgattatgcatacccatatgatgtccccgactatgcctaa
The method for constructing a gene editing tool of the embodiment comprises the following steps:
step 21: comprises a primer, wherein the primer is provided with corresponding mutation, and the sequence of the primer is shown as SEQ ID NO. 7;
step 22: amplifying a fragment 1 with a sequence shown as SEQ ID NO.2 and an amplified fragment 2 with a sequence shown as SEQ ID NO.3 from a pY011(pcDNA3.1-hLb2Cpf1) vector;
step 23: the amplified fragment and the backbone were subjected to Clonexpress II One Step Cloning Kit to obtain the mutated vector pcDNA3.1-hLb2Cas12 a-RVR.
The improvement is as follows: SEQ ID NO.2 amplified fragment 1 sequence (Artificial Synthesis)
atgtactatgagtccctgaccaagcagtaccccgtgtctaagacaatccggaatgagctgatccctatcggcaagacactggataacatccgccagaacaatatcctggagagcgacgtgaagcggaagcagaactacgagcacgtgaagggcatcctggatgagtatcacaagcagctgatcaacgaggccctggacaattgcaccctgccatccctgaagatcgccgccgagatctacctgaagaatcagaaggaggtgtctgacagagaggatttcaacaagacacaggacctgctgaggaaggaggtggtggagaagctgaaggcccacgagaactttaccaagatcggcaagaaggacatcctggatctgctggagaagctgccttccatctctgaggacgattacaatgccctggagagcttccgcaacttttacacctatttcacatcctacaacaaggtgcgggagaatctgtattctgataaggagaagagctccacagtggcctacagactgatcaacgagaatttcccaaagtttctggacaatgtgaagagctataggtttgtgaaaaccgcaggcatcctggcagatggcctgggagaggaggagcaggactccctgttcatcgtggagacattcaacaagaccctgacacaggacggcatcgatacctacaattctcaagtgggcaagatcaactctagcatcaatctgtataaccagaagaatcagaaggccaatggcttcagaaagatccccaagatgaagatgctgtataagcagatcctgtccgatagggaggagtctttcatcgacgagtttcagagcgatgaggtgctgatcgacaacgtggagtcttatggcagcgtgctgatcgagtctctgaagtcctctaaggtgagcgccttctttgatgccctgagagagtctaagggcaagaacgtgtacgtgaagaatgacctggccaagacagccatgagcaacatcgtgttcgagaattggaggacctttgacgatctgctgaaccaggagtacgacctggccaacgagaacaagaagaaggacgataagtatttcgagaagcgccagaaggagctgaagaagaataagagctactccctggagcacctgtgcaacctgtccgaggattcttgtaacctgatcgagaattatatccaccagatctccgacgatatcgagaatatcatcatcaacaatgagacattcctgcgcatcgtgatcaatgagcacgacaggtcccgcaagctggccaagaaccggaaggccgtgaaggccatcaaggactttctggattctatcaaggtgctggagcgggagctgaagctgatcaacagctccggccaggagctggagaaggatctgatcgtgtactctgcccacgaggagctgctggtggagctgaagcaggtggacagcctgtataacatgaccagaaattatctgacaaagaagcctttctctaccgagaaggtgaagctgaactttaatcgcagcacactgctgCGcggctgggatcggaatGTggagacagacCGcctg
SEQ ID NO.3 amplified fragment 2 sequence (Artificial Synthesis)
ggcgtgctgctgctgaaggacggcaagtactatctgggcatcatgaacacaagcgccaataaggccttcgtgaatccccctgtggccaagaccgagaaggtgtttaagaaggtggattacaagctgctgccagtgcccaaccagatgctgccaaaggtgttctttgccaagagcaatatcgacttctataacccctctagcgagatctactccaattataagaagggcacccacaagaagggcaatatgttttccctggaggattgtcacaacctgatcgacttctttaaggagtctatcagcaagcacgaggactggagcaagttcggctttaagttcagcgatacagcctcctacaacgacatctccgagttctatcgcgaggtggagaagcagggctacaagctgacctatacagacatcgatgagacatacatcaatgatctgatcgagcggaacgagctgtacctgttccagatctataataaggactttagcatgtactccaagggcaagctgaacctgcacacactgtatttcatgatgctgtttgatcagcgcaatatcgacgacgtggtgtataagctgaacggagaggcagaggtgttctataggccagcctccatctctgaggacgagctgatcatccacaaggccggcgaggagatcaagaacaagaatcctaaccgggccagaaccaaggagacaagcaccttcagctacgacatcgtgaaggataagcggtatagcaaggataagtttaccctgcacatccccatcacaatgaacttcggcgtggatgaggtgaagcggttcaacgacgccgtgaacagcgccatccggatcgatgagaatgtgaacgtgatcggcatcgaccggggcgagagaaatctgctgtacgtggtggtcatcgactctaagggcaacatcctggagcagatctccctgaactctatcatcaataaggagtacgacatcgagacagattatcacgcactgctggatgagagggagggcggcagagataaggcccggaaggactggaacaccgtggagaatatcagggacctgaaggccggctacctgagccaggtggtgaacgtggtggccaagctggtgctgaagtataatgccatcatctgcctggaggacctgaactttggcttcaagaggggccgccagaaggtggagaagcaggtgtaccagaagttcgagaagatgctgatcgataagctgaattacctggtcatcgacaagagccgcgagcagacatcccctaaggagctgggaggcgccctgaacgcactgcagctgacctctaagttcaagagctttaaggagctgggcaagcagtccggcgtgatctactatgtgcctgcctacctgacctctaagatcgatccaaccacaggcttcgccaatctgttttatatgaagtgtgagaacgtggagaagtccaagagattctttgacggctttgatttcatcaggttcaacgccctggagaacgtgttcgagttcggctttgactaccggagcttcacccagagggcctgcggcatcaattccaagtggaccgtgtgcaccaacggcgagcgcatcatcaagtatcggaatccagataagaacaatatgttcgacgagaaggtggtggtggtgaccgatgagatgaagaacctgtttgagcagtacaagatcccctatgaggatggcagaaatgtgaaggacatgatcatcagcaacgaggaggccgagttctaccggagactgtataggctgctgcagcagaccctgcagatgagaaacagcacctccgacggcacaagggattacatcatctcccctgtgaagaataagagagaggcctacttcaacagcgagctgtccgacggctctgtgccaaaggacgccgatgccaacggcgcctacaatatcgccagaaagggcctgtgggtgctggagcagatcaggcagaagagcgagggcgagaagatcaatctggccatgaccaacgccgagtggctggagtatgcccagacacacctgctgaaaaggccggcggccacgaaaaaggccggccaggcaaaaaagaaaaagggatcctacccatacgatgttccagattacgcttatccctacgacgtgcctgattatgcatacccatatgatgtccccgactatgcctaa
SEQ ID NO.6 crRNA sequence (Artificial Synthesis)
Primer sequence of SEQ ID NO.7 (Artificial Synthesis)
Example 1: pcDNA3.1-hLb2Cas12a-RVR plasmid construction
(1) By utilizing a PCR method, a sequence containing an RVR mutation site is amplified on a vector of corresponding mutation N512R + K518V + N522R and pY011(pcDNA3.1-hLb2Cas12a) arranged on a primer, and the amplified fragment and a framework are subjected to Clon ExpressII One Step Cloning Kit to obtain a mutated vector pcDNA3.1-hLb2Cas12 a-RVR.
(2) The PCR system used in the plasmid construction experiments was as follows:
Template:10ng；Forward Primer:(10μM)1μl；Reverse Primer:(10μM)1μl；
0.5. mu.l of dNTP; 0.5. mu.l of DNA polymerase (Vazyme, P501); 10. mu.l of 5x Buffer; RNase-Water was filled to 50. mu.l.
The PCR procedure was as follows:
95℃，3min；95℃，15sec,60℃，15sec,72℃，1min；35cycles；72℃，3min。
an application method of the Lb2Cas12a-RVR gene editing tool of this embodiment:
step 33: comprises the steps of constructing crRNA aiming at a DNA target point of a certain pathogenic gene, and introducing the crRNA and an Lb2Cas12a-RVR expression vector in a eukaryotic cell together to repair the target site in situ;
step 34: constructing a GFP (green fluorescent protein) reporting system for evaluating the editing activity, efficiency and fidelity of Lb2Cas12a-RVR, wherein the sequence of a GFP gene is SEQ ID NO. 4;
step 35: constructing an Lb2Cas12a-RVR gene repair template RS1-GFP cell line, wherein the sequence of the utilized RS1-GFP gene is SEQ ID NO. 5;
step 36: extracting the processed eukaryotic cell genome DNA, performing PCR amplification by using a specific primer aiming at a target spot, constructing a high-throughput sequencing DNA library by using a PCR product of the genome DNA, and performing high-throughput sequencing.
The improvement is as follows: SEQ ID NO.4 GFP sequence (Artificial Synthesis)
ctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtccggactcagatctcgataa
SEQ ID NO.5 RS1-GFP sequence (Artificial Synthesis)
atgtctgctggagctacctccttagactgtattccagaatgcccttagcacaagcccctgggtttcgagtcaggggaggtcgtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtccggactcagatctcgataa
Example 2: establishment of GFP report system for testing activity of pcDNA3.1-hLb2Cas12a-RVR
(1) A pSin-GFP lentiviral vector was constructed comprising the GFP gene (shown in SEQ ID NO. 4), IRES and Puromycin (Puromycin) resistance gene. HEK-293T cells were cotransformed with pSin-GFP and helper plasmid, the viral supernatant was collected, filtered through a 0.45 μm filter membrane, and stored at-80 ℃ for future use after being split charged.
(2) And (3) recovering HEK-293 cells: taking out the tube in which the HEK-293 cells are frozen from liquid nitrogen, immediately putting the tube into a water bath kettle at 37 ℃, slightly shaking the tube until the liquid is completely melted (about 1-1.5 min), taking out the tube, wiping the tube with 75% alcohol for disinfection, and placing the tube on a clean bench; transferring the cell suspension into a 15ml centrifuge tube filled with 5ml of culture medium, and centrifuging at 1500rpm for 5 min; the supernatant was discarded and 1ml of medium was added to resuspend the cells. Transferring the cells to a 10cm culture dish filled with 10ml of culture medium, and slightly shaking the cells back and forth, left and right to uniformly distribute the cells in the culture dish;
marking the cell types and dates, the names of cultured people and the like, putting the cells into a 5% CO2 incubator at 37 ℃ for culture, and replacing the culture medium after the cells adhere to the wall. Preparation of complete culture medium: DMEM (high glucose) + 10% FBS (fetal bovine serum) + 1% pen./Strep. (penicillin 100U/ml, streptomycin 100 μ g/ml)
(3) Digesting HEK-293 cells in a logarithmic growth phase by using trypsin, counting the cells, inoculating the cells into a 6-hole plate, and adjusting the cell density to be 3.0 multiplied by 105 cells/hole; according to the result of lentivirus titer determination, infecting proper amount of lentivirus pSin-GFP and adding polybrene with the final concentration of 4 mug/ml; changing the solution after infecting lentivirus for 12h, passaging to a 10cm dish after 48h, and screening by using the antibiotic Puromycin with the concentration of 1 mu g/ml; after 10d, monoclonal cells were picked under a microscope to obtain a monoclonal HEK-293-GFP cell line with the RS1-GFP gene integrated.
(4) And (3) carrying out amplification culture on the HEK-293-GFP cell, wherein the copy number of the GFP gene in the clone is determined to be single copy through qPCR detection, namely the HEK-293-SC1 cell.
Helper plasmids were pvsg and psPAX2 (applicant's laboratory preservation).
Lentiviral pSin-GFP, stored at-80 ℃.
Example 3: determination of efficiency of pcDNA3.1-hLb2Cas12a-RVR at specific sites
(1) pJET-U6-sgRNA design: designing crRNA at different sites of a GFP gene sequence according to subsequent evaluation requirements;
(2) HEK-293-SC1 cells were counted and plated in 12-well plates at a cell density of 1.8X 105 cells/well;
(3) after the cells were grown for 24h, pcDNA3.1-hLb2Cas12a-RVR (750ng) and pJET-U6-crRNA (250ng) were transfected by the transfection reagent TurboFect (Thermo Fisher, # R0531);
(4) the eukaryotic cell transfection method comprises the following steps: after mixing the plasmids to be transfected in a certain proportion, 50. mu.l DMEM containing 1.5. mu.l of the transfection reagent Turbofect was mixed, the mixture was blown and mixed, and after leaving at room temperature for 15min, the mixture was transfected in 12-well plates containing 1ml DMEM (Gibco, C11995500CP) + 10% FBS (Gibco, 16000044) medium and 1.8X 105 cells/well of HEK-293-SC1 cells.
(5) Fresh medium was changed 24h after transfection, cells were harvested 48h later, the ratio of green fluorescent cells was examined by flow cytometry, and the availability of Lb2Cas12a-RVR at a specific site was judged from the ratio.
Example 4: establishment of Lb2Cas12a-RVR gene repair template RS1-GFP cell line
1. The construction method of the recombinant vector pSin-RS1-GFP comprises the following steps:
the RS1-GFP gene (shown as SEQ ID NO. 5) is amplified through PCR and cloned to pSin-EF2-LIN28-Pur vector to obtain recombinant pSin-RS1-GFP vector.
The pSin-EF2-LIN28-Pur vector can be prepared by the method disclosed in http:// www.addgene.org/16580, which is known technology.
2. The method for obtaining the monoclonal HEK-293 cell line integrated with the RS1-GFP gene comprises the following steps:
(1) HEK-293 cells were counted and plated in 6-well plates at a cell density of 3.0X 105 cells/well;
(2) after the cells grew for 24h, a proper amount of lentivirus pSin-RS1-GFP was added to the 6-well plate, and polybrene (polybrene) was added to the final concentration of 4. mu.g/ml;
(3) HEK-293 cells are infected with lentivirus pSin-RS1-GFP for 12h, then liquid is changed, passage is carried out after 48h, diluted solution is inoculated to a 10cm dish, and the cell is screened by Puromycin (Puromycin) with the antibiotic concentration of 1 mug/ml;
(4) after 10 days, monoclonal cells were selected under a microscope to obtain a monoclonal HEK-293-RS1-GFP cell line with the RS1-GFP gene integrated therein.
Example 5: in-situ homologous recombination repair of pcDNA3.1-hLb2Cas12a-RVR in X-linked retinoschisis disease causing genes (a.Sanger sequencing test result b.HDR repair ratio c. monoclonal Sanger sequencing test result);
(1) a homologous recombination repair template plasmid pSin-EGFP-iires-Puro-RS1 is constructed, which contains GFP (green fluorescent protein) and Puro genes without promoters and an X-linked retinoschisis pathogenic gene RS 1. Wherein, the 3' end of the RS1 gene contains a stop codon;
(2) digesting HEK-293-RS1-GFP cells in a logarithmic growth phase by trypsin, counting the cells, inoculating the cells into a 12-hole plate, adjusting the cell density to be 0.5 multiplied by 105 cells/hole, and culturing in a 5% CO2 incubator at 37 ℃; transferring crRNA and Lb2Cas12a-RVR expression vectors aiming at RS1 pathogenic gene DNA targets into HEK-293 cells after 24h, and slightly shaking and uniformly mixing; culturing at 37 deg.C in 5% CO2 incubator for 24h, changing fresh culture medium, and observing cell RS1 gene repaired and recovered green fluorescent cell after 48 h; and collecting cells on day 3, extracting genomic DNA of the cells, performing PCR amplification by using specific primers aiming at the target spots, constructing a high-throughput sequencing DNA library by using PCR products of the genomic DNA, and performing high-throughput sequencing. Simultaneously, the PCR product of the genomic DNA was ligated to pJET vector by T4 ligase (NEB) and transformed, and about 20 single clones were picked the next day and subjected to Sanger sequencing.
The above description is only a preferred embodiment of the present invention, and the protection scope of the present invention is not limited to the above embodiments, and all technical solutions belonging to the idea of the present invention belong to the protection scope of the present invention. It should be noted that modifications and embellishments within the scope of the invention may occur to those skilled in the art without departing from the principle of the invention, and are considered to be within the scope of the invention.
Sequence listing
<110> Wenzhou university of medical science
<120> novel genome editing tool (Lb2Cas12a-RVR) and construction method and application method thereof
<130>2019-7-10
<140>2020100424061
<141>2020-04-23
<160>7
<170>SIPOSequenceListing 1.0
<210>1
<211>3756
<212>DNA
<213> Artificial Synthesis (Artificial Sequence)
<400>1
atgtactatg agtccctgac caagcagtac cccgtgtcta agacaatccg gaatgagctg 60
atccctatcg gcaagacact ggataacatc cgccagaaca atatcctgga gagcgacgtg 120
aagcggaagc agaactacga gcacgtgaag ggcatcctgg atgagtatca caagcagctg 180
atcaacgagg ccctggacaa ttgcaccctg ccatccctga agatcgccgc cgagatctac 240
ctgaagaatc agaaggaggt gtctgacaga gaggatttca acaagacaca ggacctgctg 300
aggaaggagg tggtggagaa gctgaaggcc cacgagaact ttaccaagat cggcaagaag 360
gacatcctgg atctgctgga gaagctgcct tccatctctg aggacgatta caatgccctg 420
gagagcttcc gcaactttta cacctatttc acatcctaca acaaggtgcg ggagaatctg 480
tattctgata aggagaagag ctccacagtg gcctacagac tgatcaacga gaatttccca 540
aagtttctgg acaatgtgaa gagctatagg tttgtgaaaa ccgcaggcat cctggcagat 600
ggcctgggag aggaggagca ggactccctg ttcatcgtgg agacattcaa caagaccctg 660
acacaggacg gcatcgatac ctacaattct caagtgggca agatcaactc tagcatcaat 720
ctgtataacc agaagaatca gaaggccaat ggcttcagaa agatccccaa gatgaagatg 780
ctgtataagc agatcctgtc cgatagggag gagtctttca tcgacgagtt tcagagcgat 840
gaggtgctga tcgacaacgt ggagtcttat ggcagcgtgc tgatcgagtc tctgaagtcc 900
tctaaggtga gcgccttctt tgatgccctg agagagtcta agggcaagaa cgtgtacgtg 960
aagaatgacc tggccaagac agccatgagc aacatcgtgt tcgagaattg gaggaccttt 1020
gacgatctgc tgaaccagga gtacgacctg gccaacgaga acaagaagaa ggacgataag 1080
tatttcgaga agcgccagaa ggagctgaag aagaataaga gctactccct ggagcacctg 1140
tgcaacctgt ccgaggattc ttgtaacctg atcgagaatt atatccacca gatctccgac 1200
gatatcgaga atatcatcat caacaatgag acattcctgc gcatcgtgat caatgagcac 1260
gacaggtccc gcaagctggc caagaaccgg aaggccgtga aggccatcaa ggactttctg 1320
gattctatca aggtgctgga gcgggagctg aagctgatca acagctccgg ccaggagctg 1380
gagaaggatc tgatcgtgta ctctgcccac gaggagctgc tggtggagct gaagcaggtg 1440
gacagcctgt ataacatgac cagaaattat ctgacaaaga agcctttctc taccgagaag 1500
gtgaagctga actttaatcg cagcacactg ctgcgcggct gggatcggaa tgtggagaca 1560
gaccgcctgg gcgtgctgct gctgaaggac ggcaagtact atctgggcat catgaacaca 1620
agcgccaata aggccttcgt gaatccccct gtggccaaga ccgagaaggt gtttaagaag 1680
gtggattaca agctgctgcc agtgcccaac cagatgctgc caaaggtgtt ctttgccaag 1740
agcaatatcg acttctataa cccctctagc gagatctact ccaattataa gaagggcacc 1800
cacaagaagg gcaatatgtt ttccctggag gattgtcaca acctgatcga cttctttaag 1860
gagtctatca gcaagcacga ggactggagc aagttcggct ttaagttcag cgatacagcc 1920
tcctacaacg acatctccga gttctatcgc gaggtggaga agcagggcta caagctgacc 1980
tatacagaca tcgatgagac atacatcaat gatctgatcg agcggaacga gctgtacctg 2040
ttccagatct ataataagga ctttagcatg tactccaagg gcaagctgaa cctgcacaca 2100
ctgtatttca tgatgctgtt tgatcagcgc aatatcgacg acgtggtgta taagctgaac 2160
ggagaggcag aggtgttcta taggccagcc tccatctctg aggacgagct gatcatccac 2220
aaggccggcg aggagatcaa gaacaagaat cctaaccggg ccagaaccaa ggagacaagc 2280
accttcagct acgacatcgt gaaggataag cggtatagca aggataagtt taccctgcac 2340
atccccatca caatgaactt cggcgtggat gaggtgaagc ggttcaacga cgccgtgaac 2400
agcgccatcc ggatcgatga gaatgtgaac gtgatcggca tcgaccgggg cgagagaaat 2460
ctgctgtacg tggtggtcat cgactctaag ggcaacatcc tggagcagat ctccctgaac 2520
tctatcatca ataaggagta cgacatcgag acagattatc acgcactgct ggatgagagg 2580
gagggcggca gagataaggc ccggaaggac tggaacaccg tggagaatat cagggacctg 2640
aaggccggctacctgagcca ggtggtgaac gtggtggcca agctggtgct gaagtataat 2700
gccatcatct gcctggagga cctgaacttt ggcttcaaga ggggccgcca gaaggtggag 2760
aagcaggtgt accagaagtt cgagaagatg ctgatcgata agctgaatta cctggtcatc 2820
gacaagagcc gcgagcagac atcccctaag gagctgggag gcgccctgaa cgcactgcag 2880
ctgacctcta agttcaagag ctttaaggag ctgggcaagc agtccggcgt gatctactat 2940
gtgcctgcct acctgacctc taagatcgat ccaaccacag gcttcgccaa tctgttttat 3000
atgaagtgtg agaacgtgga gaagtccaag agattctttg acggctttga tttcatcagg 3060
ttcaacgccc tggagaacgt gttcgagttc ggctttgact accggagctt cacccagagg 3120
gcctgcggca tcaattccaa gtggaccgtg tgcaccaacg gcgagcgcat catcaagtat 3180
cggaatccag ataagaacaa tatgttcgac gagaaggtgg tggtggtgac cgatgagatg 3240
aagaacctgt ttgagcagta caagatcccc tatgaggatg gcagaaatgt gaaggacatg 3300
atcatcagca acgaggaggc cgagttctac cggagactgt ataggctgct gcagcagacc 3360
ctgcagatga gaaacagcac ctccgacggc acaagggatt acatcatctc ccctgtgaag 3420
aataagagag aggcctactt caacagcgag ctgtccgacg gctctgtgcc aaaggacgcc 3480
gatgccaacg gcgcctacaa tatcgccaga aagggcctgt gggtgctgga gcagatcagg 3540
cagaagagcg agggcgagaa gatcaatctg gccatgacca acgccgagtg gctggagtat 3600
gcccagacac acctgctgaa aaggccggcg gccacgaaaa aggccggcca ggcaaaaaag 3660
aaaaagggat cctacccata cgatgttcca gattacgctt atccctacga cgtgcctgat 3720
tatgcatacc catatgatgt ccccgactat gcctaa 3756
<210>2
<211>1569
<212>DNA
<213> Artificial Synthesis (Artificial Sequence)
<400>2
atgtactatg agtccctgac caagcagtac cccgtgtcta agacaatccg gaatgagctg 60
atccctatcg gcaagacact ggataacatc cgccagaaca atatcctgga gagcgacgtg 120
aagcggaagc agaactacga gcacgtgaag ggcatcctgg atgagtatca caagcagctg 180
atcaacgagg ccctggacaa ttgcaccctg ccatccctga agatcgccgc cgagatctac 240
ctgaagaatc agaaggaggt gtctgacaga gaggatttca acaagacaca ggacctgctg 300
aggaaggagg tggtggagaa gctgaaggcc cacgagaact ttaccaagat cggcaagaag 360
gacatcctgg atctgctgga gaagctgcct tccatctctg aggacgatta caatgccctg 420
gagagcttcc gcaactttta cacctatttc acatcctaca acaaggtgcg ggagaatctg 480
tattctgata aggagaagag ctccacagtg gcctacagac tgatcaacga gaatttccca 540
aagtttctgg acaatgtgaa gagctatagg tttgtgaaaa ccgcaggcat cctggcagat 600
ggcctgggag aggaggagca ggactccctg ttcatcgtgg agacattcaa caagaccctg 660
acacaggacg gcatcgatac ctacaattct caagtgggca agatcaactc tagcatcaat 720
ctgtataacc agaagaatca gaaggccaat ggcttcagaa agatccccaa gatgaagatg 780
ctgtataagc agatcctgtc cgatagggag gagtctttca tcgacgagtt tcagagcgat 840
gaggtgctga tcgacaacgt ggagtcttat ggcagcgtgc tgatcgagtc tctgaagtcc 900
tctaaggtga gcgccttctt tgatgccctg agagagtcta agggcaagaa cgtgtacgtg 960
aagaatgacc tggccaagac agccatgagc aacatcgtgt tcgagaattg gaggaccttt 1020
gacgatctgc tgaaccagga gtacgacctg gccaacgaga acaagaagaa ggacgataag 1080
tatttcgaga agcgccagaa ggagctgaag aagaataaga gctactccct ggagcacctg 1140
tgcaacctgt ccgaggattc ttgtaacctg atcgagaatt atatccacca gatctccgac 1200
gatatcgaga atatcatcat caacaatgag acattcctgc gcatcgtgat caatgagcac 1260
gacaggtccc gcaagctggc caagaaccgg aaggccgtga aggccatcaa ggactttctg 1320
gattctatca aggtgctgga gcgggagctg aagctgatca acagctccgg ccaggagctg 1380
gagaaggatc tgatcgtgta ctctgcccac gaggagctgc tggtggagct gaagcaggtg 1440
gacagcctgt ataacatgac cagaaattat ctgacaaaga agcctttctc taccgagaag 1500
gtgaagctga actttaatcg cagcacactg ctgcgcggct gggatcggaa tgtggagaca 1560
gaccgcctg 1569
<210>3
<211>2187
<212>DNA
<213> Artificial Synthesis (Artificial Sequence)
<400>3
ggcgtgctgc tgctgaagga cggcaagtac tatctgggca tcatgaacac aagcgccaat 60
aaggccttcg tgaatccccc tgtggccaag accgagaagg tgtttaagaa ggtggattac 120
aagctgctgc cagtgcccaa ccagatgctg ccaaaggtgt tctttgccaa gagcaatatc 180
gacttctata acccctctag cgagatctac tccaattata agaagggcac ccacaagaag 240
ggcaatatgt tttccctgga ggattgtcac aacctgatcg acttctttaa ggagtctatc 300
agcaagcacg aggactggag caagttcggc tttaagttca gcgatacagc ctcctacaac 360
gacatctccg agttctatcg cgaggtggag aagcagggct acaagctgac ctatacagac 420
atcgatgaga catacatcaa tgatctgatc gagcggaacg agctgtacct gttccagatc 480
tataataagg actttagcat gtactccaag ggcaagctga acctgcacac actgtatttc 540
atgatgctgt ttgatcagcg caatatcgac gacgtggtgt ataagctgaa cggagaggca 600
gaggtgttct ataggccagc ctccatctct gaggacgagc tgatcatcca caaggccggc 660
gaggagatca agaacaagaa tcctaaccgg gccagaacca aggagacaag caccttcagc 720
tacgacatcg tgaaggataa gcggtatagc aaggataagt ttaccctgca catccccatc 780
acaatgaact tcggcgtgga tgaggtgaag cggttcaacg acgccgtgaa cagcgccatc 840
cggatcgatg agaatgtgaa cgtgatcggc atcgaccggg gcgagagaaa tctgctgtac 900
gtggtggtca tcgactctaa gggcaacatc ctggagcaga tctccctgaa ctctatcatc 960
aataaggagt acgacatcga gacagattat cacgcactgc tggatgagag ggagggcggc 1020
agagataagg cccggaagga ctggaacacc gtggagaata tcagggacct gaaggccggc 1080
tacctgagcc aggtggtgaa cgtggtggcc aagctggtgc tgaagtataa tgccatcatc 1140
tgcctggagg acctgaactt tggcttcaag aggggccgcc agaaggtgga gaagcaggtg 1200
taccagaagt tcgagaagat gctgatcgat aagctgaatt acctggtcat cgacaagagc 1260
cgcgagcaga catcccctaa ggagctggga ggcgccctga acgcactgca gctgacctct 1320
aagttcaaga gctttaagga gctgggcaag cagtccggcg tgatctacta tgtgcctgcc 1380
tacctgacct ctaagatcga tccaaccaca ggcttcgcca atctgtttta tatgaagtgt 1440
gagaacgtgg agaagtccaa gagattcttt gacggctttg atttcatcag gttcaacgcc 1500
ctggagaacg tgttcgagtt cggctttgac taccggagct tcacccagag ggcctgcggc 1560
atcaattcca agtggaccgt gtgcaccaac ggcgagcgca tcatcaagta tcggaatcca 1620
gataagaaca atatgttcga cgagaaggtg gtggtggtga ccgatgagat gaagaacctg 1680
tttgagcagt acaagatccc ctatgaggat ggcagaaatg tgaaggacat gatcatcagc 1740
aacgaggagg ccgagttcta ccggagactg tataggctgc tgcagcagac cctgcagatg 1800
agaaacagca cctccgacgg cacaagggat tacatcatct cccctgtgaa gaataagaga 1860
gaggcctact tcaacagcga gctgtccgac ggctctgtgc caaaggacgc cgatgccaac 1920
ggcgcctaca atatcgccag aaagggcctg tgggtgctgg agcagatcag gcagaagagc 1980
gagggcgaga agatcaatct ggccatgacc aacgccgagt ggctggagta tgcccagaca 2040
cacctgctga aaaggccggc ggccacgaaa aaggccggcc aggcaaaaaa gaaaaaggga 2100
tcctacccat acgatgttcc agattacgct tatccctacg acgtgcctga ttatgcatac 2160
ccatatgatg tccccgacta tgcctaa 2187
<210>4
<211>717
<212>DNA
<213> Artificial Synthesis (Artificial Sequence)
<400>4
ctgttcaccg gggtggtgcc catcctggtc gagctggacg gcgacgtaaa cggccacaag 60
ttcagcgtgt ccggcgaggg cgagggcgat gccacctacg gcaagctgac cctgaagttc 120
atctgcacca ccggcaagct gcccgtgccc tggcccaccc tcgtgaccac cctgacctac 180
ggcgtgcagt gcttcagccg ctaccccgac cacatgaagc agcacgactt cttcaagtcc 240
gccatgcccg aaggctacgt ccaggagcgc accatcttct tcaaggacga cggcaactac 300
aagacccgcg ccgaggtgaa gttcgagggc gacaccctgg tgaaccgcat cgagctgaag 360
ggcatcgact tcaaggagga cggcaacatc ctggggcaca agctggagta caactacaac 420
agccacaacg tctatatcat ggccgacaag cagaagaacg gcatcaaggt gaacttcaag 480
atccgccaca acatcgagga cggcagcgtg cagctcgccg accactacca gcagaacacc 540
cccatcggcg acggccccgt gctgctgccc gacaaccact acctgagcac ccagtccgcc 600
ctgagcaaag accccaacga gaagcgcgat cacatggtcc tgctggagtt cgtgaccgcc 660
gccgggatca ctctcggcat ggacgagctg tacaagtccg gactcagatc tcgataa 717
<210>5
<211>816
<212>DNA
<213> Artificial Synthesis (Artificial Sequence)
<400>5
atgtctgctg gagctacctc cttagactgt attccagaat gcccttagca caagcccctg 60
ggtttcgagt caggggaggt cgtgagcaag ggcgaggagc tgttcaccgg ggtggtgccc 120
atcctggtcg agctggacgg cgacgtaaac ggccacaagt tcagcgtgtc cggcgagggc 180
gagggcgatg ccacctacgg caagctgacc ctgaagttca tctgcaccac cggcaagctg 240
cccgtgccct ggcccaccct cgtgaccacc ctgacctacg gcgtgcagtg cttcagccgc 300
taccccgacc acatgaagca gcacgacttc ttcaagtccg ccatgcccga aggctacgtc 360
caggagcgca ccatcttctt caaggacgac ggcaactaca agacccgcgc cgaggtgaag 420
ttcgagggcg acaccctggt gaaccgcatc gagctgaagg gcatcgactt caaggaggac 480
ggcaacatcc tggggcacaa gctggagtac aactacaaca gccacaacgt ctatatcatg 540
gccgacaagc agaagaacgg catcaaggtg aacttcaaga tccgccacaa catcgaggac 600
ggcagcgtgc agctcgccga ccactaccag cagaacaccc ccatcggcga cggccccgtg 660
ctgctgcccg acaaccacta cctgagcacc cagtccgccc tgagcaaaga ccccaacgag 720
aagcgcgatc acatggtcct gctggagttc gtgaccgccg ccgggatcac tctcggcatg 780
gacgagctgt acaagtccgg actcagatct cgataa 816
<210>6
<211>3812
<212>DNA
<213> Artificial Synthesis (Artificial Sequence)
<400>6
caaaaaacct ggtcgagctg gacggcgacg atctacaata gtagaaattc ggtgcaaaaa 60
actgagcacc cagtccgccc tgagatctac aatagtagaa attcggtgca aaaaatgccc 120
atcctggtcg agctggacgg cgacgatcta caatagtaga aattcggtgc aaaaaaatcc 180
tggtcgagct ggacggcgac gatctacaat agtagaaatt cggtgcaaaa aatcctggtc 240
gagctggacg gcgacgatct acaatagtag aaattcggtg caaaaaactg gtcgagctgg 300
acggcgacga tctacaatag tagaaattcg gtgcaaaaaa tggtcgagct ggacggcgac 360
gatctacaat agtagaaatt cggtgcaaaa aaggtcgagc tggacggcga cgatctacaa 420
tagtagaaat tcggtgcaaa aaacgagctg gacggcgacg atctacaata gtagaaattc 480
ggtgcaaaaa agctggacgg cgacgatcta caatagtaga aattcggtgc aaaaaactcg 540
atgcggttca ccagggtgtc gccctcatct acaatagtag aaattcggtg caaaaaatgc 600
ggttcaccag ggtgtcgccc tcatctacaa tagtagaaat tcggtgcaaa aaacggttca 660
ccagggtgtc gccctcatct acaatagtag aaattcggtg caaaaaaggt tcaccagggt 720
gtcgccctca tctacaatag tagaaattcg gtgcaaaaaa gttcaccagg gtgtcgccct 780
catctacaat agtagaaatt cggtgcaaaa aattcaccag ggtgtcgccc tcatctacaa 840
tagtagaaat tcggtgcaaa aaaaccaggg tgtcgccctc atctacaata gtagaaattc 900
ggtgcaaaaa aagggtgtcg ccctcatcta caatagtaga aattcggtgc aaaaaacctg 960
gtcgagctgg acggcgacga tctacaatag tagaaattcc ggtgcaaaaa acggcatcaa 1020
ggtgaacttc aaatctacaa tagtagaaat tcggtgcaaa aaagtttacg tcgccgtcca 1080
gctcatctac aatagtagaa attcggtgca aaaaaggggt ggtgcccatc ctggtcatct 1140
acaatagtag aaattcggtg caaaaaacgg cgacgtaaac ggccacaaat ctacaatagt 1200
agaaattcgg tgcaaaaaag gtgaacagct cctcgccctt atctacaata gtagaaattc 1260
ggtgcaaaaa aggtggtgca gatgaacttc agatctacaa tagtagaaat tcggtgcaaa 1320
aaactacaac agccacaacg tctaatctac aatagtagaa attcggtgca aaaaagctgt 1380
tcaccggggt ggtgccatct acaatagtag aaattcggtg caaaaaactt gaagaagtcg 1440
tgctgcttat ctacaatagt agaaattcgg tgcaaaaaag ttcttctgct tgtcggccat 1500
atctacaata gtagaaattc ggtgcaaaaa agtcgccgtc cagctcgacc agatctacaa 1560
tagtagaaat tcggtgcaaa aaagacgttg tggctgttgt agttatctac aatagtagaa 1620
attcggtgca aaaaaggtgc ccatcctggt cgagctatct acaatagtag aaattcggtg 1680
caaaaaacgt ccagctcgac caggatggat ctacaatagt agaaattcgg tgcaaaaaag 1740
gtcgagctgg acggcgacgt atctacaata gtagaaattc ggtgcaaaaa acatcttctt 1800
caaggacgac ggatctacaa tagtagaaat tcggtgcaaa aaacaggatg ttgccgtcct 1860
ccttatctac aatagtagaa attcggtgca aaaaacgtcg ccgtccagct cgaccaatct 1920
acaatagtag aaattcggtg caaaaaacat gcccgaaggc tacgtccaat ctacaatagt 1980
agaaattcgg tgcaaaaaac ttgtggccgt ttacgtcgcc atctacaata gtagaaattc 2040
ggtgcaaaaa aggagctgtt caccggggtg gtatctacaa tagtagaaat tcggtgcaaa 2100
aaagagctgg acggcgacgt aaacatctac aatagtagaa attcggtgca aaaaagtgag 2160
caagggcgag gagctgatct acaatagtag aaattcggtg caaaaaactg ttcaccgggg 2220
tggtgcccat ctacaatagt agaaattcgg tgcaaaaaag ggcaccaccc cggtgaacag 2280
atctacaata gtagaaattc ggtgcaaaaa atcgaacttc acctcggcgc ggatctacaa 2340
tagtagaaat tcggtgcaaa aaagtggtgc agatgaactt caggatctac aatagtagaa 2400
attcggtgca aaaaaaccgg ggtggtgccc atcctgatct acaatagtag aaattcggtg 2460
caaaaaaggc gtgcagtgct tcagccgcat ctacaatagt agaaattcgg tgcaaaaaat 2520
tcgagggcga caccctggtgatctacaata gtagaaattc ggtgcaaaaa agaacagctc 2580
ctcgcccttg ctatctacaa tagtagaaat tcggtgcaaa aaaaggagct gttcaccggg 2640
gtggatctac aatagtagaa attcggtgca aaaaaaccta cggcgtgcag tgcttcatct 2700
acaatagtag aaattcggtg caaaaaagct tcatgtggtc ggggtagcat ctacaatagt 2760
agaaattcgg tgcaaaaaac cgtccagctc gaccaggatg atctacaata gtagaaattc 2820
ggtgcaaaaa acccatcctg gtcgagctgg acatctacaa tagtagaaat tcggtgcaaa 2880
aaagaggagc tgttcaccgg ggtgatctac aatagtagaa attcggtgca aaaaagcccg 2940
aaggctacgt ccaggaatct acaatagtag aaattcggtg caaaaaagcc gtccagctcg 3000
accaggatat ctacaatagt agaaattcgg tgcaaaaaat gctgcttcat gtggtcgggg 3060
atctacaata gtagaaattc ggtgcaaaaa agagggcgat gccacctacg gcatctacaa 3120
tagtagaaat tcggtgcaaa aaagtggccg tttacgtcgc cgtcatctac aatagtagaa 3180
attcggtgca aaaaacgcga tcacatggtc ctgctgatct acaatagtag aaattcggtg 3240
caaaaaagcc ctgagcaaag accccaacat ctacaatagt agaaattcgg tgcaaaaaat 3300
tcagcgtgtc cggcgagggc atctacaata gtagaaattc ggtgcaaaaa atcgccggac 3360
acgctgaact tgatctacaa tagtagaaat tcggtgcaaa aaacttcaag tccgccatgc 3420
ccgaatctac aatagtagaa attcggtgca aaaaagccca tcctggtcga gctggaatct 3480
acaatagtag aaattcggtg caaaaaaagg gcgaggagct gttcaccgat ctacaatagt 3540
agaaattcgg tgcaaaaaac tggagttcgt gaccgccgcc atctacaata gtagaaattc 3600
ggtgcaaaaa aaagggcgag gagctgttca ccatctacaa tagtagaaat tcggtgcaaa 3660
aaaaaattca ccgagcagga gtgaggatct acaatagtag aaattcggtg caaaaaactt 3720
gtgctaaggg cattctgatc tacaatagta gaaattcggt gcaaaaaact tgtgctaagg 3780
gcattctgat ctacaatagt agaaattcgg tg 3812
<210>7
<211>177
<212>DNA
<213> Artificial Synthesis (Artificial Sequence)
<400>7
caacaagaca caggacctgc tgaggaagga ggtggtggag aagctggaac atcgtatggg 60
taggatccct ttttcttttt tgcctggctg ctgcgcggct gggatcggaa tgtggagaca 120
gaccgcctgg gcgcccaggc ggtctgtctc cacattccga tcccagccgc gcagcag 177
Claims (3)
1. A novel genome editing tool (Lb2Cas12a-RVR), characterized by: comprises encoding and expressing Lb2Cas12a-RVR mutant protein encoding plasmid pcDNA3.1-hLb2Cas12a-RVR, and the DNA sequence of the encoding protein is shown as SEQ ID NO. 1.
2. A method of construction of the gene editing tool (Lb2Cas12a-RVR) according to claim 1, characterized in that: the method comprises the following steps:
step 21: comprises a primer, wherein the primer is provided with corresponding mutation, and the sequence of the primer is shown as SEQ ID NO. 7;
step 22: amplifying a fragment 1 with a sequence shown as SEQ ID NO.2 and an amplified fragment 2 with a sequence shown as SEQ ID NO.3 from a pY011(pcDNA3.1-hLb2Cpf1) vector;
step 23: the amplified fragment and the backbone were passed through Clon ExpressIIOne Step Cloning Kit to obtain the mutated vector pcDNA3.1-hLb2Cas12 a-RVR.
3. A method of application of a novel genome editing tool (Lb2Cas12a-RVR) according to claim 1, characterized in that: the method comprises the following steps:
step 33: comprises the steps of constructing crRNA aiming at a DNA target point of a certain pathogenic gene, and introducing the crRNA and an Lb2Cas12a-RVR expression vector in a eukaryotic cell together to repair the target site in situ;
step 34: constructing a GFP (green fluorescent protein) reporting system for evaluating the editing activity, efficiency and fidelity of Lb2Cas12a-RVR, wherein the sequence of a GFP gene is SEQ ID NO. 4;
step 35: constructing an Lb2Cas12a-RVR gene repair template RS1-GFP cell line, wherein the sequence of the utilized RS1-GFP gene is SEQ ID NO. 5;
step 36: extracting the processed eukaryotic cell genome DNA, performing PCR amplification by using a specific primer aiming at a target spot, constructing a high-throughput sequencing DNA library by using a PCR product of the genome DNA, and performing high-throughput sequencing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010042406.1A CN111647618A (en) | 2020-01-15 | 2020-01-15 | Novel genome editing tool (Lb2Cas12a-RVR) and construction method and application method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010042406.1A CN111647618A (en) | 2020-01-15 | 2020-01-15 | Novel genome editing tool (Lb2Cas12a-RVR) and construction method and application method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111647618A true CN111647618A (en) | 2020-09-11 |
Family
ID=72349231
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010042406.1A Pending CN111647618A (en) | 2020-01-15 | 2020-01-15 | Novel genome editing tool (Lb2Cas12a-RVR) and construction method and application method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111647618A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113215193A (en) * | 2021-03-18 | 2021-08-06 | 温州医科大学 | Method for improving gene knockout and base editing system activity by using small molecular compound and application method thereof |
| CN115968834A (en) * | 2023-01-20 | 2023-04-18 | 北京因诺惟康医药科技有限公司 | Preparation method and application of RS1 point mutation mouse model |
Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105907785A (en) * | 2016-05-05 | 2016-08-31 | 苏州吉玛基因股份有限公司 | Application of CRISPR (clustered regularly interspaced short palindromic repeats)/Cpf1 system with compounded crRNA in gene editing |
| CN106834350A (en) * | 2016-12-22 | 2017-06-13 | 温州医科大学 | A kind of homologous recombination recovery report system and method for building up |
| CN107099544A (en) * | 2017-06-28 | 2017-08-29 | 安徽省农业科学院水稻研究所 | The PL LbCpf1 RVR genes of identification specific site and its application in paddy gene target practice |
| CN107287243A (en) * | 2017-06-20 | 2017-10-24 | 温州医科大学 | A kind of humanized's retinoschisis transgene mouse model and its construction method |
| CN108277231A (en) * | 2017-01-06 | 2018-07-13 | 中国科学院上海生命科学研究院 | A kind of CRISPR systems for genes of corynebacteria group editor |
| CA3085338A1 (en) * | 2017-12-11 | 2019-06-20 | Editas Medicine, Inc. | Cpf1-related methods and compositions for gene editing |
| CA3088052A1 (en) * | 2018-01-11 | 2019-07-18 | KWS SAAT SE & Co. KGaA | Optimized plant crispr/cpf1 systems |
| CN111394337A (en) * | 2019-11-15 | 2020-07-10 | 武汉大学 | Class II V-type CRISPR protein L b2Cas12a and application thereof in gene editing |
| CN113005141A (en) * | 2021-01-05 | 2021-06-22 | 温州医科大学 | Gene editing tool composed of high-activity mutant, preparation method and method for repairing congenital retinoschisis disease pathogenic gene |
-
2020
- 2020-01-15 CN CN202010042406.1A patent/CN111647618A/en active Pending
Patent Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105907785A (en) * | 2016-05-05 | 2016-08-31 | 苏州吉玛基因股份有限公司 | Application of CRISPR (clustered regularly interspaced short palindromic repeats)/Cpf1 system with compounded crRNA in gene editing |
| CN106834350A (en) * | 2016-12-22 | 2017-06-13 | 温州医科大学 | A kind of homologous recombination recovery report system and method for building up |
| CN108277231A (en) * | 2017-01-06 | 2018-07-13 | 中国科学院上海生命科学研究院 | A kind of CRISPR systems for genes of corynebacteria group editor |
| CN107287243A (en) * | 2017-06-20 | 2017-10-24 | 温州医科大学 | A kind of humanized's retinoschisis transgene mouse model and its construction method |
| CN107099544A (en) * | 2017-06-28 | 2017-08-29 | 安徽省农业科学院水稻研究所 | The PL LbCpf1 RVR genes of identification specific site and its application in paddy gene target practice |
| CA3085338A1 (en) * | 2017-12-11 | 2019-06-20 | Editas Medicine, Inc. | Cpf1-related methods and compositions for gene editing |
| CA3088052A1 (en) * | 2018-01-11 | 2019-07-18 | KWS SAAT SE & Co. KGaA | Optimized plant crispr/cpf1 systems |
| CN111394337A (en) * | 2019-11-15 | 2020-07-10 | 武汉大学 | Class II V-type CRISPR protein L b2Cas12a and application thereof in gene editing |
| CN113005141A (en) * | 2021-01-05 | 2021-06-22 | 温州医科大学 | Gene editing tool composed of high-activity mutant, preparation method and method for repairing congenital retinoschisis disease pathogenic gene |
Non-Patent Citations (6)
| Title |
|---|
| CHEN,H.等: "Synthetic construct Cas9 gene, complete cds", 《GENBANK DATABASE》 * |
| LINYI GAO等: "Engineered Cpf1 variants with altered PAM specificities", 《NATURE BIOTECHNOLOGY》 * |
| MENGJUN TU等: "A new lease of life: FnCpf1 possesses DNA cleavage activity for genome editing in human cells", 《NUCLEIC ACIDS RESEARCH》 * |
| XIAOYU LIU等: "Lb2Cas12a and its engineered variants mediate genome editing in human cells", 《THE FASEB JOURNAL》 * |
| XIUBIN HE等: "Boosting activity of high-fidelity CRISPR/Cas9 variants using a tRNAGln-processing system in human cells", 《JOURNAL OF BIOLOGICAL CHEMISTRY》 * |
| 周晨晨等: "CRISPR家族新成员:CRISPR-Cpf1", 《生物化学与生物物理进展》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113215193A (en) * | 2021-03-18 | 2021-08-06 | 温州医科大学 | Method for improving gene knockout and base editing system activity by using small molecular compound and application method thereof |
| CN113215193B (en) * | 2021-03-18 | 2023-07-18 | 温州医科大学 | Method for improving activity of gene knockout and base editing system by small molecule compound and application method thereof |
| CN115968834A (en) * | 2023-01-20 | 2023-04-18 | 北京因诺惟康医药科技有限公司 | Preparation method and application of RS1 point mutation mouse model |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107502608B (en) | Construction method and application of sgRNA and ALDH2 gene-deleted cell strain for knocking out human ALDH2 gene | |
| CN105518138B (en) | Method for specifically knocking out pig GFRA1 gene by CRISPR-Cas9 and sgRNA for specifically targeting GFRA1 gene | |
| JP6053923B2 (en) | Site-specific integration | |
| CN108624622A (en) | A kind of genetically engineered cell strain that can secrete mouse interleukin -6 based on CRISPR-Cas9 systems structure | |
| CN108342480A (en) | A kind of genetic mutation detection Quality Control object and preparation method thereof | |
| CN109306361B (en) | Novel gene editing system for base fixed-point conversion from A/T to G/C | |
| CN107893073B (en) | Method for screening glutamine synthetase defect type HEK293 cell strain | |
| JP2009017884A (en) | Chromosome-based platform | |
| CN109266680B (en) | Method for preparing CKO/KI animal model by using Cas9 technology | |
| US20130171731A1 (en) | Reversibly immortalized cells as well as methods relating hereto | |
| CN109750035B (en) | sgRNA for targeting and guiding Cas9 protein to efficiently cleave TCR and B2M gene locus | |
| CN110066852B (en) | Method and system for detecting CRISPR/Cas PAM sequence in mammalian cell | |
| CN111647618A (en) | Novel genome editing tool (Lb2Cas12a-RVR) and construction method and application method thereof | |
| CN114058625B (en) | Site for stably expressing protein in CHO cell gene NW _003613781.1 and application thereof | |
| CN109182562B (en) | miRNA apla-mir-25-42 related to follicular development of laying ducks as well as detection primer, inhibitor and application thereof | |
| JP2019193659A (en) | Expression cassette | |
| CN113278635B (en) | Sequence combination for promoting cyclic RNA (ribonucleic acid) to form ring and application thereof | |
| CN113544257A (en) | Characterization and inactivation of endogenous retroviruses in chinese hamster ovary cells | |
| CN112852819A (en) | Establishment method of PTCH1 gene deletion mesenchymal stem cells | |
| CN111154801B (en) | Method for improving gene editing efficiency | |
| Shi et al. | Efficient and rapid fluorescent protein knock-in with universal donors in mouse embryonic stem cells | |
| CN112226460B (en) | Screening and breeding method of cell line for stably expressing porcine host restriction factor A3Z2 molecule and application thereof | |
| CN114934066A (en) | Gene editing system for osteolithiasis and application thereof | |
| CN105695509B (en) | Method for obtaining high-purity myocardial cells | |
| CN113549650A (en) | CRISPR-SaCas9 gene editing system and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200911 |