CN107502608B - Construction method and application of sgRNA and ALDH2 gene-deleted cell strain for knocking out human ALDH2 gene - Google Patents
Construction method and application of sgRNA and ALDH2 gene-deleted cell strain for knocking out human ALDH2 gene Download PDFInfo
- Publication number
- CN107502608B CN107502608B CN201710803984.0A CN201710803984A CN107502608B CN 107502608 B CN107502608 B CN 107502608B CN 201710803984 A CN201710803984 A CN 201710803984A CN 107502608 B CN107502608 B CN 107502608B
- Authority
- CN
- China
- Prior art keywords
- aldh2 gene
- sgrna
- aldh2
- gene
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/10—Applications; Uses in screening processes
- C12N2320/11—Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15041—Use of virus, viral particle or viral elements as a vector
- C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Abstract
The invention provides a sgRNA sequence for knocking out a human ALDH2 gene, wherein a target DNA sequence of the sgRNA is at least one of sequences shown in SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3. The invention also provides a method for knocking out the ALDH2 gene of the human hepatoma cell, which is used for modifying the ALDH2 gene in the human hepatoma cell by using a CRISPR/Cas system. The invention also provides two ALDH2 gene-deleted cell strain cell strains, wherein ALDH2 participates in important metabolic functions of an organism, the ALDH2 gene knockout cell strain provided by the invention provides an effective platform for in vivo metabolic research of exogenous chemicals or exogenous toxicants, and provides a powerful tool for the research of chronic diseases (such as alcoholic liver diseases and diabetes) and tumor-related diseases.
Description
Technical Field
The invention relates to the field of genetic engineering, in particular to a gRNA sequence for knocking out a human ALDH2 gene, a construction method of an ALDH2 gene deletion cell strain and application thereof.
Background
ALDH2 is a very important subtype of acetaldehyde dehydrogenase, is located on chromosome 12 (12q24.2) of human body, and is mainly used for oxidizing acetaldehyde into acetic acid, participating in the metabolism and detoxification process of acetaldehyde, a secondary metabolite of alcohol, in vivo, and promoting alcohol metabolism in liver, and is considered to be closely related to alcohol metabolism and alcohol dependence of Asians.
The slow virus system is one of the current methods for mediating a target sequence to enter a target cell, is a method developed based on HIV, overcomes the defect that part of virus systems can only infect cells in a division stage, can infect cells in the division stage and can infect cells in a non-division stage, and can integrate a target gene into a host cell genome to play a durable and stable interference effect.
The principle of the limited dilution method for selecting the monoclonal cells is to use gradient dilution, when the dilution gradient is high enough, single cells can be obtained, and cell strains with single background can be obtained after culture and proliferation. The limiting dilution method is simple to operate and can easily obtain monoclonal cell strains.
The CRISPR/Cas9 system is an acquired immune defense system used for protecting bacteria or archaea from invasion of foreign plasmids or phages, CRISPR sequences of genomes of the bacteria or archaea can express RNA recognized with genome sequences of invaders, exogenous genome DNA is cut under the action of CRISPR-associated enzyme (CAS9) to achieve the purpose of resisting invasion, and after artificial modification, the CRISPR/Cas9 system can realize highly flexible and specific genome editing in eukaryotic cells, is the most popular new-generation genome editing technology in the field of genome editing at present, and is used for constructing various gene knockout cell lines and gene knockout animal models at present.
In the existing experimental technology, the most similar to the CRISPR/Cas9 system is that siRNA-targeted gene silencing technology, siRNA, refers to a phenomenon of gene silencing induced by highly conserved double-stranded RNA in the evolution process of organisms, which affects a series of processes and functions of organisms, but under the induction action of drugs and the like, the silenced gene is subject to expression reversion. Compared with siRNA targeting ALDH2mRNA inhibition gene expression, CRISPR/Cas9 carries out gene editing at ALDH2 genome level, can completely silence gene expression, and constructs a real ALDH2 gene-deficient cell strain.
At present, it is necessary to provide an ALDH2 gene-deficient human hepatoma cell line which can not only achieve complete silencing but also can be stably cultured in vitro for a long period of time.
Disclosure of Invention
In order to solve the problems, the invention provides a sgRNA sequence for knocking out a human ALDH2 gene, a construction method of an ALDH2 gene deletion cell strain and application thereof.
In a first aspect, the invention provides a sgRNA sequence for knocking out a human ALDH2 gene, wherein a target DNA sequence of the sgRNA is at least one of sequences shown in SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3.
In a second aspect, the invention provides a method for knocking out a human embryonic kidney cell ALDH2 gene, which is used for modifying an ALDH2 gene in a human hepatoma cell by using a CRISPR/Cas system and specifically comprises the following steps:
(1) artificially synthesizing a target DNA sequence and a complementary strand thereof as described in the first aspect;
(2) inserting the synthesized nucleic acid fragment into a multiple cloning site of a sgRNA framework expression plasmid vector, converting, selecting a monoclonal strain, extracting a sgRNA recombinant plasmid, and performing sequencing identification to obtain a sgRNA recombinant plasmid with correct sequencing; wherein the sgRNA backbone expression plasmid vector further expresses Cas9 nuclease;
(3) transfecting the sgRNA recombinant plasmid to a human liver cancer cell to obtain the human embryo kidney cell with the ALDH2 gene knocked out.
Preferably, the step (2) specifically comprises: inserting the synthesized nucleic acid pairs with sequences shown in SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3 into multiple cloning sites of a sgRNA framework expression plasmid vector respectively, converting, selecting a monoclonal strain, extracting sgRNA recombinant plasmids, and performing sequencing identification to obtain sgRNA recombinant plasmids with correct sequencing; wherein the sgRNA backbone expression plasmid vector further expresses Cas9 nuclease;
the step (3) specifically comprises: co-transfecting the two sgRNA recombinant plasmids obtained in the step (2) to human liver cancer cells to obtain the human liver cancer cells with the ALDH2 gene knocked out.
In a third aspect, the invention provides two construction methods of an ALDH2 gene-deleted cell strain, which are respectively to carry out subculture screening on the ALDH2 gene-knocked human hepatoma cell obtained in the second aspect by adopting a lentivirus transfection method and a limiting dilution method to obtain the human hepatoma cell with the ALDH2 gene stably knocked out.
In a fourth aspect, the present invention provides two ALDH2 gene-deleted cell lines, which are prepared by the method for constructing the ALDH2 gene-deleted cell line of the third aspect.
In a fifth aspect, the invention provides a use of the sgRNA sequence for knocking out human ALDH2 gene according to the first aspect in knocking out ALDH2 gene.
In a sixth aspect, a kit for performing site-directed knock-in of ALDH2 gene in human genome, comprising any one of the following (1) to (3):
(1) the sgRNA sequence for knockout of the human ALDH2 gene of the first aspect;
(2) the sgRNA recombinant plasmid of the second aspect;
(3) the ALDH2 gene-deleted cell strain according to the fourth aspect.
The technical scheme provided by the invention has the following beneficial effects:
according to the technical scheme provided by the invention, the ALDH2 gene is knocked out by using a CRISPR/Cas9 technology, so that the silencing effect on the gene at the genome level is realized, and the defect that the siRNA cannot silence the gene expression completely or at the mRNA or protein level is effectively overcome.
Drawings
FIG. 1 is a flow chart of an experimental design provided by an embodiment of the present invention;
FIG. 2 is a schematic diagram of the construction of a recombinant SgRNA plasmid according to an embodiment of the present invention;
FIG. 3 shows the sequencing results of monoclonal cell limiting dilution screening of HepG2 knockout cell line provided in the examples of the present invention;
FIG. 4 shows the results of PCR fragments digested with SURVEYOR nuclease provided in the examples of the present invention;
FIG. 5 shows the sequencing result of the T-A clone of the ALDH2 gene knockout HepG2 stable strain provided by the embodiment of the invention;
FIG. 6 shows the result of detecting the mRNA expression level of the ALDH2 gene-knocked-out HepG2 cell line provided by the embodiments of the present invention;
FIG. 7 shows the results of detecting the Protein expression level of the ALDH2 gene-knocked-out HepG2 cell line provided by the embodiments of the present invention.
Detailed Description
While the following is a description of the preferred embodiments of the present invention, it will be understood by those skilled in the art that various changes and modifications may be made without departing from the spirit and scope of the invention.
In the examples of the present invention, reagents and consumables are commercially available products unless otherwise specified.
The technical scheme of the invention is realized by the following embodiments by combining the experimental design flow chart shown in figure 1:
(1) sgRNA design:
sgRNA sequences were designed for the second, fourth and fifth exons (Exon2, Exon4, Exon5) of ALDH2 gene, respectively.
The specific grouping and naming of sgRNA sequences designed and synthesized for the second, fourth and fifth exons of ALDH2 gene are shown in table 1:
TABLE 1 ALDH2sgRNA oligo sequences
(Tab.1 The sequences of ALDH2sgRNA oligo)
Enzyme cutting sites are respectively added at two ends of the sgRNA, CACC is added at the 5 'end of a sense strand of each sgRNA sequence, and AAAC is added at the 5' end of an antisense strand, so that a viscous end which is complementary to the PX461 plasmid after being cut by Fast Digest Bbs I is formed. If the first base at the 5 ' end of the sense strand is not a G, then a G is added after the 5 ' CACC and a C is added at the 3 ' end of the corresponding antisense strand. The designed sgRNA is sent to Shanghai Jirui company for primer synthesis.
The sequences shown in SEQ ID NO 1, SEQ ID NO 2 and SEQ ID NO 3 of the invention respectively correspond to the tableIn 1, SEQ ID NO. 4, SEQ ID NO. 6 and SEQ ID NO. 8 draw horizontal line portions, specifically, the sequences shown in SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3 are respectivelyCCAGTGGACGGATTGACGGT、CATAGGGCTTGCCATTGTCC、CTGAAGAAGTCTCCGTCAAT。
(2) The construction and identification of the recombinant plasmid, the construction flow pattern is shown in FIG. 2
Both PX458 and lenticip V2 are sgRNA backbone expression vectors containing a U6 promoter, expressing Cas9n with Cas9D10A nickase mutation, the PX458 plasmid carries GFP green fluorescent protein gene and ampicillin resistance, and the lenticip V2 plasmid carries ampicillin resistance. PX458 and LenticrisprV2 were digested with Fast Digest Bbs I, and the linearized vector was recovered after DNA gel electrophoresis.
Respectively phosphorylating and annealing three groups of sgRNA oligo sequences in the table 1 by using T4 PNK; linear PX458 and leticisrispr V2 plasmid vectors were ligated with T4ligase to the annealed three sgRNA double-stranded sequences for 1h at room temperature, respectively. The ligation product was transformed into competent bacteria, Trans 109, in ice bath for 30min at 42 ℃ for 45s for 2min on ice. Clones were selected on ampicillin resistant LB plates. And (4) picking positive clone, shaking and sequencing. The sequencing primer was the forward primer sequence of the U6 promoter, 5'-GAGGGCCTATTTCCCATGATTCC-3' (SEQ ID NO: 15). The correct clones were sequenced to extract recombinant plasmids.
The obtained recombinant plasmids have six groups, are named as PX458-Exon2, PX458-Exon4 and PX458-Exon5 aiming at the PX458 plasmid, and are named as Lenticrispr V2-Exon2, Lenticrispr V2-Exon4 and Lenticrispr V2-Exon5 aiming at the Lenticrispr V2 plasmid.
(3) Construction of HepG2 Stable cell Strain from Lentiviral System Virus fluid
(ii) Generation of viruses
293FT cell culture conditions: DMEM medium (containing 10% fetal bovine serum), 5% CO2And culturing at 37 ℃.
The 293FT cells were inoculated in 10cm cell culture dishes respectively, and the cell inoculation number was 2 × 106According to the core plasmid: packaging plasmid: the envelope plasmid is transfected in the ratio of 4:3:2, and the core plasmid of sgRNA groupLenticrispr V2-Exon2, Lenticrispr V2-Exon4 and Lenticrispr V2-Exon5, respectively, with Lenticrispr V2 as a control. Virus fluid was harvested 24h, 48h and 72h after transfection and the percentage of fluorescent cells was observed using an inverted fluorescence microscope to determine transfection efficiency. The collected three virus solutions were mixed well and concentrated using a Milipore 100KD concentration column. Viral dropletimetry was performed using 293FT cells.
② cell infection and HepG2 stable strain cell screening.
The HepG2 cell culture conditions were DMEM medium (containing 10% fetal calf serum), 5% CO2, and constant temperature culture at 37 ℃.
The target cell strains to be infected are planted in the 6-well plate one day in advance, and the cell infection is preferably that the cell collection rate reaches 40-50%. The medium was aspirated before infection, 120. mu.l of the virus concentrate was diluted with 2ml of fresh medium, 3.5g of polybrene was added, and the infection efficiency was observed under an inverted fluorescence microscope 48-96 h after infection. Selection was carried out 96h after infection with puromycin at a final concentration of 2. mu.g/ml for 7 days. HepG2 stable cell lines were maintained with puromycin at a final concentration of 0.5. mu.g/ml after puromycin selection.
(4) Screening HepG2 knockout cell strain by monoclonal cell limiting dilution method
Cell transfection: 24h before transfection, HepG2 cells were inoculated into 6-well plates at 5X 105/well and cultured, and the degree of cell fusion reached 60% -70% at the time of transfection. PX458-Exon2, PX458-Exon4 and PX458-Exon5 were transfected simultaneously with a well of HepG2 cells using Viafect transfection reagent, respectively, with an equal amount of PX458 plasmid as a negative control, a 6-well plate transfection volume of plasmid was typically 2 ug/well and the ratio of plasmid pre-transfection reagent was 1: 2-2.5. Transfection efficiency was observed after 24 h. The percentage of fluorescent cells was observed using an inverted fluorescence microscope to determine transfection efficiency.
② screening monoclonal cells by monoclonal cell limiting dilution method: cells were trypsinized and counted, diluted to 100ul of 0.5 cells in medium by limiting dilution, and added to 96-well plates at 100ul cell dilution per well. And observing the growth condition of the cells by using a microscope on5 to 7 days after inoculation, primarily screening the monoclonal cells, digesting the cells by using trypsin when the cells grow to the bottom of a 96-well plate, and transferring the cells to a 24-well plate. When the cells grow to the bottom of the 24-well plate, one part of the cells are used for subculturing, the other part of the cells are used for extracting genome DNA of the cells, sequencing is carried out after PCR amplification, the sequencing result is compared with the original genome, and whether targeted knockout of the ALDH2 gene is successful is detected.
Sequencing results show that compared with the wild type, the HepG2 knockout cell strain has a 4bp base deletion, as shown in FIG. 3.
(5) Extraction of cellular genomic DNA
The constructed cell line was digested with GeneJETTMGenomic DNA Purification Kit extracted Genomic DNA.
① cells were collected in centrifuge tubes, 5X10 per tube6And (3) slowly blowing and beating the cells by using a pipette, centrifuging the cells for 5min at 250g, removing supernatant, adding PBS (phosphate buffer solution) to resuspend the cells, and repeatedly centrifuging the cells again to remove residual culture medium in the cells.
② resuspend the cells by 200ul PBS, add 200ul lysis buffer and 20ul proteinase K into each tube, fully shake and mix evenly.
③ incubating for 10min at 56 ℃ by a shaking table, and shaking and mixing uniformly every 3-4 min to ensure the full cell lysis.
And fourthly, adding 20ul of RNAase A, shaking and uniformly mixing, and incubating for 10min at room temperature.
Fifthly, adding 400ul of 50% ethanol, and shaking and mixing uniformly by a gun or shaking and mixing uniformly.
Sixthly, the MiX is added into a Column provided by the kit, 6000g of the Column is centrifuged for 1min, and the DNA collecting Column is transferred into a new 2ml collecting tube.
Seventhly, 500ul of wash buffer I is added, 8000g of the mixture is centrifuged for 1min, and waste liquid is discarded. Then 500ul wash buffer II (12000 g) was added and centrifuged for 3 min.
Adding 200ul of Elution Buffer to the center of a filter membrane of the collection column, incubating at room temperature for 2min, centrifuging at 8000g, and centrifuging for 1min to obtain the required DNA sample.
(6) PCR reaction conditions and SURVEYOR assay
Designing a QRT-PCR primer according to the mRNA sequence number of the ALDH2 gene provided by NCBI; SURVEYOR primers and PCR primers for ALDH2 gene were designed by Primer 3.0, and the primers were synthesized by Shanghai Czeri Bio Inc.
TABLE 2 SURVEYOR PCR reaction primer sequences
Tab.2 PCR primer
② Phusion super fidelity DNA polymerase is used to carry out PCR amplification, referring to the 50ul system of the instruction, the genome DNA100ng, the 50ul reaction system is shown in the following table.
| Components | Quantity (uL) |
| H2O | to 50 |
| Phusion HF buffer,5X | 10 |
| dNTPs,2.5 |
4 |
| Phusion polymerase | 0.5 |
| Forward primer | 2.5 |
| Reverse primer | 2.5 |
| template | 100ng |
| Total | |
| 50 |
The procedure was as follows:
5ul of PCR product after reaction is taken to carry out agarose gel electrophoresis to detect the specificity.
The SURVEYOR analysis procedure is as follows:
1) PCR product purification was performed using QIAquick PCR purification Kit, and the recovered product was diluted to 40ng/ul and detected according to the procedure of the SURVEYOR analysis Kit.
2) DNA hybrid double strand formation (annealing reaction) system:
| components | Quantity (ul) |
| Taq PCR buffer,10× | 2 |
| Normalized PCR product,20ngμl-1 | 18 |
| Total volume | 20 |
Reaction conditions are as follows:
| number of cycles | Condition |
| 1 | 95℃, |
| 2 | 95-85℃,-2℃s-1 |
| 3 | 85℃, |
| 4 | 85-75℃,-0.3℃s-1 |
| 5 | 75℃,1min |
| 6 | 75-65℃,-0.3℃s-1 |
| 7 | 65℃,1min |
| 8 | 65-55℃,-0.3℃s-1 |
| 9 | 55℃,1min |
| 10 | 55-45℃,-0.3℃s-1 |
| 11 | 45℃,1min |
| 12 | 45-35℃,-0.3℃s-1 |
| 13 | 35℃,1min |
| 14 | 35-25℃,-0.3℃s-1 |
| 15 | 25℃,1min |
| 16 | 25-4℃,-0.3℃s-1 |
| 17 | 4℃,hold |
3) SURVEYOR nuclease digestion (on ice operations):
reaction system:
| components | Dosage (mu l) | Final concentration |
| Annealed heteroduplex | 20 | |
| MgCl2stock solution supplied with kit,0.15M | 2.5 | 15mM |
| ddH2O | 0.5 | |
| SURVEYOR nuclease S | 1 | 1× |
| SURVEYOR enhancer S | 1 | 1× |
| Total | 25 |
Reaction conditions are as follows: shaking thoroughly, mixing the above mixture uniformly, and keeping the temperature at 42 ℃ for 30min.
4) 10ul of sample was taken and analyzed on 2% agarose gel. The cutting efficiency is calculated by gel quantitative software, and the formula is
fcut(b + c)/(a + b + c) where Indel is the deletion ratio, fcutFor the cut ratio, a is the gray value of the uncut band, and b and c represent the gray value of the new band resulting from the cut.
The group of transfected 293FT cells with the highest Indel (%) was selected for further inoculation and selection.
The results of the nuclease digestion part are shown in FIG. 4, and the experimental results show that
1) Limited dilution method HepG2 knockout strain
The SgRNA designed for Exon2, Exon4 and Exon5 constructed PX458-Exon2, PX458-Exon4 and PX458-Exon5 plasmid groups are all effective, and the SURVEYOR result is positive.
2) Lentiviral transfection method HepG2 knockout strain
The PX458-Exon2 and PX458-Exon5 plasmid groups constructed by sgRNAs designed for Exon2 and Exon5 are effective, and the SURVEYOR result is positive.
(7) DNA sequencing analysis of ALDH2 gene knockout HepG2 cell line
Extracting cell genome DNA, carrying out PCR by using Phusion high-fidelity enzyme, purifying PCR products, adding A tail to the PCR products by using Taq DNA polymerase, wherein the total reaction system is 50 mu l, and the specific required component usage amount and reaction conditions of the reaction are as follows:
connecting a T carrier: and connecting the PCR product with the tail A with a T carrier, and setting a negative control by using a control carried by the T carrier kit, wherein the required component amounts for the reaction are as follows:
the control group was as follows:
in the above reaction system, 5. mu.l of Solution I (containing the enzyme required for the ligation reaction) was added to each tube, ligation was performed at 16 ℃ for 30min, and the whole reaction was carried out on a PCR apparatus.
③ the ligation products were transformed into competent bacteria, Trans 109, in ice bath for 30min, at 42 ℃ for 45s, on ice for 2 min. Clones were selected on ampicillin resistant LB plates. The positive clone was selected and shaken, and sent to Beijing Liuhe Huada Gene company for sequencing.
As shown in FIG. 5, the stable HepG2 strain has deletion mutation at the target site, and ALDH2 gene knockout is realized.
(8) Detection of mRNA and protein expression level of ALDH2 gene knockout HepG2 cell line
The total RNA of cells was extracted by Trizol method, reverse transcription was performed using a reverse transcription kit of TOYOBO to generate cDNA, and qRT-PCR was performed according to the system given in the SYBR mix reagent instruction of TOYOBO.
As shown in FIG. 6, the mRNA expression level of the HepG2 cell line successfully constructed by the ALDH2 gene knockout is obviously lower than that of the control group.
Secondly, extracting total protein of the HepG2ALDH2 gene knockout cell strain by using M-PER cell lysate, quantifying by using a BCA protein quantification kit, and carrying out Western Blot.
As shown in FIG. 7, the protein expression level of the HepG2 cell line successfully constructed by the ALDH2 gene knockout is obviously lower than that of the control group.
Compared with the traditional gene knockout method, the method has the advantages of complex flow, high technical requirement, high cost and relatively low success rate. The CRISPR-Cas9 technology adopted by the invention is a fourth-generation gene editing method, and is easy to operate, higher in efficiency and low in cost. The ALDH2 gene knockout cell model constructed by the CRISPR-Cas9 technology provides an effective platform for ALDH2 metabolism-related research. The method has the following specific beneficial effects:
(1) the ALDH2 gene is knocked out by using a CRISPR/Cas9 technology, so that the silencing effect on the gene at the genome level is realized, and the defect that the siRNA cannot silence the gene expression completely or cannot be silenced at the mRNA or protein level is effectively overcome.
(2) The ALDH2 participates in important metabolic functions of the body, and the establishment of the ALDH2 gene knockout cell strain provides an effective platform for the metabolism research of exogenous chemicals or exogenous toxicants in the body.
(3) The ALDH2 gene knockout cell strain provides a powerful tool for researching chronic diseases (such as alcoholic liver diseases and diabetes) and tumor-related diseases.
(4) The ALDH2 gene knockout cell strain can be used for researching the toxicity and carcinogenicity of exogenous chemicals related to ALDH2 metabolism and interaction among medicines.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.
Sequence listing
<110> Zhongshan university
<120> construction method and application of sgRNA for knocking out human ALDH2 gene and ALDH2 gene-deleted cell strain
<160>21
<170>SIPOSequenceListing 1.0
<210>1
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
ccagtggacg gattgacggt 20
<210>2
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
catagggctt gccattgtcc 20
<210>3
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
ctgaagaagt ctccgtcaat 20
<210>4
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
caccgccagt ggacggattg acggt 25
<210>5
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
aaacaccgtc aatccgtcca ctggc 25
<210>6
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
caccgcatag ggcttgccat tgtcc 25
<210>7
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
aaacggacaa tggcaagccc tatgc 25
<210>8
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
caccgctgaa gaagtctccg tcaat 25
<210>9
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
aaacattgac ggagacttct tcagc 25
<210>10
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
cctgtgcttt tcatttgtag gct 23
<210>11
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
cagtttcgat tggttcctac agt 23
<210>12
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>12
tcctcctccc tgcctttgga 20
<210>13
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>13
gccttctctg actcctgtga tcc 23
<210>14
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>14
acaagaaccc caggcgattc t 21
<210>15
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>15
tgcgtgtcct cccctaactc ca 22
<210>16
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>16
ttgtctgcaa ggcctgtgc 19
<210>17
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>17
ttggttccta cagtctgtac aa 22
<210>18
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>18
tttacaagaa ccccaggcga 20
<210>19
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>19
gaattcacga gtggcagtgc 20
<210>20
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>20
cttagcatgg tgtcacggac 20
<210>21
<211>18
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>21
tgggattgca ggcgtgag 18
Claims (6)
1. A sgRNA sequence for knocking out a human ALDH2 gene is characterized in that a target DNA sequence of the sgRNA is at least one of sequences shown in SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3.
2. A method for knocking out a human hepatoma cell ALDH2 gene is characterized in that in order to modify the ALDH2 gene in a human hepatoma cell by using a CRISPR/Cas system, the method specifically comprises the following steps:
(1) artificially synthesizing the target DNA sequence of claim 1 and a complementary strand thereof;
(2) inserting the synthesized nucleic acid fragment into a multiple cloning site of a sgRNA framework expression plasmid vector, converting, selecting a monoclonal strain, extracting a sgRNA recombinant plasmid, and performing sequencing identification to obtain a sgRNA recombinant plasmid with correct sequencing; wherein the sgRNA backbone expression plasmid vector further expresses Cas9 nuclease;
(3) transfecting the sgRNA recombinant plasmid to a human liver cancer cell to obtain the human liver cancer cell with the ALDH2 gene knocked out.
3. A construction method of ALDH2 gene-deleted cell strain is characterized in that a lentivirus transfection method or a limiting dilution method is adopted to carry out subculture screening on the ALDH2 gene-knocked human hepatoma cells obtained in the claim 2, and the ALDH2 stably-knocked human hepatoma cells are obtained.
4. A cell line deficient in the ALDH2 gene, which is produced by the method for producing the cell line deficient in the ALDH2 gene according to claim 3.
5. Use of the sgRNA sequence for knockout of the human ALDH2 gene according to claim 1 in knockout of the ALDH2 gene.
6. A kit for site-directed knockout of ALDH2 gene in human genome, comprising any one of the following (1) to (3):
(1) the sgRNA sequence of claim 1 for knockout of the human ALDH2 gene;
(2) the sgRNA recombinant plasmid of claim 2;
(3) the ALDH2 gene-deleted cell line of claim 4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710803984.0A CN107502608B (en) | 2017-09-08 | 2017-09-08 | Construction method and application of sgRNA and ALDH2 gene-deleted cell strain for knocking out human ALDH2 gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710803984.0A CN107502608B (en) | 2017-09-08 | 2017-09-08 | Construction method and application of sgRNA and ALDH2 gene-deleted cell strain for knocking out human ALDH2 gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107502608A CN107502608A (en) | 2017-12-22 |
| CN107502608B true CN107502608B (en) | 2020-10-16 |
Family
ID=60695284
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710803984.0A Active CN107502608B (en) | 2017-09-08 | 2017-09-08 | Construction method and application of sgRNA and ALDH2 gene-deleted cell strain for knocking out human ALDH2 gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107502608B (en) |
Families Citing this family (26)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP6261500B2 (en) | 2011-07-22 | 2018-01-17 | プレジデント アンド フェローズ オブ ハーバード カレッジ | Evaluation and improvement of nuclease cleavage specificity |
| US20150044192A1 (en) | 2013-08-09 | 2015-02-12 | President And Fellows Of Harvard College | Methods for identifying a target site of a cas9 nuclease |
| US9359599B2 (en) | 2013-08-22 | 2016-06-07 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US9388430B2 (en) | 2013-09-06 | 2016-07-12 | President And Fellows Of Harvard College | Cas9-recombinase fusion proteins and uses thereof |
| US9340799B2 (en) | 2013-09-06 | 2016-05-17 | President And Fellows Of Harvard College | MRNA-sensing switchable gRNAs |
| US9526784B2 (en) | 2013-09-06 | 2016-12-27 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US9840699B2 (en) | 2013-12-12 | 2017-12-12 | President And Fellows Of Harvard College | Methods for nucleic acid editing |
| WO2016022363A2 (en) | 2014-07-30 | 2016-02-11 | President And Fellows Of Harvard College | Cas9 proteins including ligand-dependent inteins |
| US20190225955A1 (en) | 2015-10-23 | 2019-07-25 | President And Fellows Of Harvard College | Evolved cas9 proteins for gene editing |
| KR102547316B1 (en) | 2016-08-03 | 2023-06-23 | 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 | Adenosine nucleobase editing agents and uses thereof |
| AU2017308889B2 (en) | 2016-08-09 | 2023-11-09 | President And Fellows Of Harvard College | Programmable Cas9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| KR20240007715A (en) | 2016-10-14 | 2024-01-16 | 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 | Aav delivery of nucleobase editors |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| EP3592777A1 (en) | 2017-03-10 | 2020-01-15 | President and Fellows of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| WO2019023680A1 (en) | 2017-07-28 | 2019-01-31 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (pace) |
| WO2019139645A2 (en) | 2017-08-30 | 2019-07-18 | President And Fellows Of Harvard College | High efficiency base editors comprising gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| CN108277223A (en) * | 2018-01-30 | 2018-07-13 | 中国人民解放军南京军区疾病预防控制中心 | The structure of sgRNA, SOSSB1 gene delection cell strain for knocking out people's SOSSB1 genes and application |
| WO2019237373A1 (en) * | 2018-06-16 | 2019-12-19 | 深圳市博奥康生物科技有限公司 | Method for constructing 293t cell strain with site-directed insertion of btdc gene and use thereof |
| CN111254164A (en) * | 2018-11-30 | 2020-06-09 | 中国科学院大连化学物理研究所 | Method for rapidly establishing CRISPR gene editing liver cancer cell strain and cell strain |
| CA3130488A1 (en) | 2019-03-19 | 2020-09-24 | David R. Liu | Methods and compositions for editing nucleotide sequences |
| GB2614813A (en) | 2020-05-08 | 2023-07-19 | Harvard College | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106434752A (en) * | 2016-06-14 | 2017-02-22 | 南通大学附属医院 | Process of knocking out Wnt3a gene and verification method thereof |
-
2017
- 2017-09-08 CN CN201710803984.0A patent/CN107502608B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106434752A (en) * | 2016-06-14 | 2017-02-22 | 南通大学附属医院 | Process of knocking out Wnt3a gene and verification method thereof |
Non-Patent Citations (2)
| Title |
|---|
| A comparison of CRISPR/Cas9 and siRNA-mediated ALDH2 gene silencing in human cell lines;Fei Wang et al.;《 Molecular Genetics and Genomics》;20181231(第293期);769–783 * |
| 利用CRISPR/Cas9系统构建ALDH2基因敲除的HepG2细胞株;郭涛 等;《2017（第三届）毒性测试替代方法与转化毒理学（国际）学术研讨会会议论文集》;20170709;33-34 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107502608A (en) | 2017-12-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107502608B (en) | Construction method and application of sgRNA and ALDH2 gene-deleted cell strain for knocking out human ALDH2 gene | |
| CN105518138B (en) | Method for specifically knocking out pig GFRA1 gene by CRISPR-Cas9 and sgRNA for specifically targeting GFRA1 gene | |
| CN105492608B (en) | Method for specifically knocking out pig PDX1 gene by CRISPR-Cas9 and sgRNA for specifically targeting PDX1 gene | |
| CN106191057B (en) | A kind of sgRNA sequence for knocking out people's CYP2E1 gene, the construction method of CYP2E1 gene deleted cell strains and its application | |
| CN105518137B (en) | Method for specifically knocking out pig SALL1 gene by CRISPR-Cas9 and sgRNA for specifically targeting SALL1 gene | |
| CN105518135B (en) | Method for specifically knocking out pig CMAH gene by CRISPR-Cas9 and sgRNA for specifically targeting CMAH gene | |
| CN105518139B (en) | Method for specifically knocking out pig FGL2 gene by CRISPR-Cas9 and sgRNA for specifically targeting FGL2 gene | |
| WO2016187904A1 (en) | Method for pig cmah gene specific knockout by means of crispr-cas9 and sgrna for specially targeting cmah gene | |
| US11898270B2 (en) | Pig genome-wide specific sgRNA library, preparation method therefor and application thereof | |
| CN109750035B (en) | sgRNA for targeting and guiding Cas9 protein to efficiently cleave TCR and B2M gene locus | |
| CN107893073B (en) | Method for screening glutamine synthetase defect type HEK293 cell strain | |
| WO2019227640A1 (en) | Reagent and method for repairing fbn1t7498c mutation using base editing | |
| CN108148866B (en) | HCBP6 gene knockout cell line and construction method thereof | |
| CN110885823B (en) | Long-chain non-coding RNA pig Lnc-000649 and application thereof | |
| CN111613272B (en) | Programmable framework gRNA and application thereof | |
| CN114836418A (en) | CRISPR-Cas13d system for knocking down porcine epidemic diarrhea virus | |
| CN111662907A (en) | Method for knocking out NANS gene of induced pluripotent stem cell and application | |
| CN110229816B (en) | Construction method and application of sgRNA (ribonucleic acid) for knocking out RBP4 gene and RBP4 gene deletion cell strain | |
| CN110564743B (en) | CircR-UQCC1 gene of Lianshan cattle, over-expression vector, construction method and application thereof | |
| CN108486115B (en) | Transfection method for freshwater crayfish cell exogenous gene expression and application thereof | |
| CN114891786B (en) | Dog Rosa26 gene and application thereof | |
| CN111254161A (en) | Method for establishing CRISPR-based gene-knocked-down lung cancer cell strain and cell strain | |
| CN114891791B (en) | sgRNA of specific targeting canine Rosa26 gene and application thereof | |
| CN113584085B (en) | Lentiviral vector for suspension cells and application thereof | |
| CN110804626B (en) | Method for constructing high-efficiency expression vector by combining high CG segment and low CG promoter |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Wang Qing Inventor after: Wang Fei Inventor after: Guo Tao Inventor after: Li Ruobi Inventor after: Jiang Hongmei Inventor after: Wang Ting Inventor after: Zeng Ni Inventor before: Wang Qing Inventor before: Wang Fei Inventor before: Guo Tao Inventor before: Li Ruobi Inventor before: Wang Hongmei Inventor before: Wang Ting Inventor before: Zeng Ni |
|
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |