CN113584085B

CN113584085B - Lentiviral vector for suspension cells and application thereof

Info

Publication number: CN113584085B
Application number: CN202110737586.XA
Authority: CN
Inventors: 黄河清涛; 王德鹏; 胡清云; 刘彩云; 许澎
Original assignee: Hunan Fenghui Biotechnology Co ltd
Current assignee: Hunan Fenghui Biotechnology Co ltd
Priority date: 2021-06-30
Filing date: 2021-06-30
Publication date: 2023-05-12
Anticipated expiration: 2041-06-30
Also published as: CN113584085A

Abstract

The invention discloses a slow virus vector for suspension cells and application thereof, and belongs to the technical field of biology. The lentiviral vector of the invention takes pLVX-EGFP-IRES-Puro as a framework, and a Ubi promoter and a Cbh promoter are inserted. The lentiviral vector is generally applicable to the expression of suspension cells, has high and stable expression efficiency, can greatly improve the over-expression effect in the suspension cells, has simple and feasible expression process, and is easy to popularize.

Description

Lentiviral vector for suspension cells and application thereof

Technical Field

The invention relates to a slow virus vector aiming at suspension cells and application thereof, belonging to the technical field of biology.

Background

Lentiviruses (LV) are now very effective tools in cell and model biological experiments, with many unique advantages in gene transfection. The research on lentiviral vector (Lentiviral vector) has progressed rapidly and is very intensive. Lentiviral vectors can efficiently integrate foreign genes into host chromosomes for persistent expression. Lentiviral vectors have a broader host range than retroviral vectors, and lentiviruses are able to effectively infect non-periodic and postmitotic cells.

Lentiviral expression vectors, known as shuttle vectors, contain the genetic information required for packaging, transfection, stable integration. Lentiviral packaging plasmids can provide all of the helper proteins required to transcribe and package RNA into a recombinant pseudoviral vector. In order to produce high titer viral particles, it is necessary to co-transfect cells with an expression vector and a packaging plasmid, package the virus in the cells, secrete the packaged pseudoviral particles into extracellular medium, centrifuge to obtain supernatant, and then directly use the supernatant for infection of host cells, and after entering the host cells, the target genes are integrated into the genome by reverse transcription, thereby expressing effector molecules at high levels.

Lentiviruses have unique advantages over other retroviruses.

(1) There are a wider host range with infectious capacity for both dividing and non-dividing cells. For some cells which are difficult to transfect, such as primary cells, stem cells, undifferentiated cells and the like, the transduction efficiency of the target gene can be greatly improved, and the probability of integrating the target gene into the genome of the host cell is greatly increased.

(2) Stable expression. The slow virus can effectively integrate exogenous genes into cell chromosomes, and the target genes have certain resistance to transcriptional silencing, so that continuous, efficient and stable expression can be obtained in target cells.

(3) The constructed lentiviral vector can carry about 5kb, even longer genes of interest. Therefore, besides small molecules such as exogenous short-hairpin RNAs (shRNAs), a plurality of cDNAs can be cloned into lentiviral vectors, and the viral titer is reduced along with the increase of the length of the target gene.

Based on the advantages of the slow virus, the conventional experimental operation of transfecting target genes or RNAi genes can be performed by using a slow virus vector system, and meanwhile, the slow virus plays an important role in the fields of gene editing, gene therapy, transgenic animals, drug research and the like.

Common hematological neoplasms mainly include various leukemias, multiple myelomas, and malignant lymphomas, with current incidences all being ranked in the first ten positions of malignancy. Blood tumors are therefore one of the current research hotspots. However, it is well known that blood-derived suspension cells generally suffer from the problem of difficulty in lentiviral infection.

Therefore, the development of a slow virus vector special for suspension cells has high clinical and market value.

Disclosure of Invention

In order to solve the technical problems, the invention provides a slow virus vector for suspension cells and application thereof, wherein the slow virus vector is suitable for expression of the suspension cells, has high and stable expression efficiency, can greatly improve the over-expression effect in the suspension cells, has simple and feasible expression process, and is easy to popularize.

The technical scheme of the invention is as follows.

The invention provides a lentiviral vector, which takes pLVX-EGFP-IRES-Puro as a framework, and inserts a Ubi promoter and a Cbh promoter.

Further, the Ubi promoter and Cbh promoter replaced the CMV promoter in pLVX-EGFP-IRES-Puro.

Further, the nucleotide sequences of the Ubi promoter and the Cbh promoter are shown in SEQ ID No. 1.

The invention also provides a recombinant lentivirus containing the lentivirus vector.

The invention also provides a preparation method of the recombinant lentivirus, which is to introduce a target gene into the lentivirus vector to obtain a target plasmid, and co-transfect the target plasmid with the psPAX2 and the pMD2.G to obtain the recombinant lentivirus.

Further, at the time of transfection, the mass ratio of psPAX2, pmd2.G, plasmid of interest was psPAX2: pMD2.G: destination plasmid = 2:1:1.

the invention also provides a recombinant cell comprising the lentiviral vector and/or the recombinant lentiviral vector.

The invention also provides a method for infecting cells by using the recombinant lentivirus, which is to co-culture the recombinant lentivirus and the cells to be infected.

Further, the cells are suspension cells.

The invention also provides a pharmaceutical composition comprising one or more of the lentiviral vector, the recombinant lentivirus and the recombinant cell.

The invention also provides application of the lentiviral vector, the recombinant lentivirus and the recombinant cell in the aspect of protein expression or medicine preparation.

Drawings

Fig. 1: the invention provides a slow virus vector schematic diagram.

Fig. 2: fluorescent quantitative PCR results.

Fig. 3: results of lentivirus infection of Jurkat cells.

Fig. 4: the virus infection effect of the common vector and the special vector for suspending cells is compared.

Detailed Description

EXAMPLE 1 construction of the circRNA overexpression loop-forming vector

1. Designing a circular carrier for overexpression of circRNA

Designing a promoter sequence suitable for suspension cells; according to the sequence information of the commercialized vector pLVX-EGFP-IRES-Puro, the complete Ubi promoter-Cbh promoter nucleotide sequence (SEQ ID NO. 1) suitable for overexpression of suspension cells was designed, and primers were designed using Primer design software Primer Premier 5.0, which is shown in Table 1, and submitted to the nucleic acid synthesis company for Primer synthesis.

TABLE 1 primer design

2. PCR amplification

The PCR system is shown in Table 2, and two DNA sequences were obtained by PCR amplification.

TABLE 2 PCR reaction System

PCR reaction conditions:

98℃5min；98℃10s，62℃5s，72℃30s，30cycles；72℃10min，4℃4min。

3. recovery of DNA fragments by agarose gel electrophoresis

10 mu L of the reaction product is taken for 1% agarose gel electrophoresis, the target gene fragment is recovered, and the gel recovery kit is purchased from the Optimaceae organism.

4. Restriction enzyme pLVX-EGFP-IRES-Puro vector

The plasmid pLVX-EGFP-IRES-Puro was digested with ClaI-EcoRI, and the digested system was as shown in Table 3.

Table 3 plasmid double enzyme cutting system

Double-enzyme cutting pLVX-EGFP-IRES-Puro vector and recovered target gene fragment.

5. Glue recovery

And (3) carrying out 1% agarose gel electrophoresis on the lentivirus blank vector subjected to double enzyme digestion, and recovering the lentivirus blank vector by gel.

6. Ligation of the Gene fragment of interest and vector

The recovered and purified target fragment was ligated to the recovered and purified vector, and the ligation product was designated pLVX-Ubi-MCS-Cbh-EGFP-IRES-Puro. The connection system is shown in Table 4.

Table 4 connection system

Connection reaction conditions: the reaction was carried out at 50℃for 30min.

7. Ligation product transformation competent cells

mu.L of ligation product was used to transform 100. Mu.L of Stbl3 competent cells: mixing the product with competent cells, ice-bathing for 30min, heat-shocking at 42 deg.C for 90s, immediately placing on ice for 2min, adding 500 μL LB medium preheated to room temperature, shaking at 180rpm and 37 deg.C for 1h, centrifuging at 5000rpm for 3min, discarding 500 μL culture supernatant, mixing the rest 100 μL with a pipettor, uniformly coating on LB plate containing 50 μg/mL ampicillin resistance, inverting, and culturing overnight in a 37 deg.C constant temperature incubator.

8. Sequencing identification

Positive single colonies were selected and sent to the biological engineering Co.Ltd for sequencing.

9. Extraction of plasmids from properly sequenced positive strains

Positive strains with correct sequencing are subjected to expansion culture, added into 20mL LB culture medium containing corresponding antibiotics, and cultured overnight at 37 ℃ for 12-16h, and plasmids are extracted.

The positive strain with correct sequence is amplified and cultured in 20mL LB culture medium containing corresponding antibiotics at 37 ℃ overnight for 12-16h, and plasmids are extracted to obtain the vector containing the over-expression frame aiming at suspension cells.

EXAMPLE 2 construction of the Gene of interest-pLVX-Ubi-MCS-Cbh-EGFP-IRES-Puro vector

1. The target gene sequence is amplified by PCR, and the PCR reaction system is shown in Table 2.

PCR reaction conditions:

98℃5min；98℃10s，60℃5s，72℃15s，30cycles；72℃10min，4℃4min。

2. the DNA fragments were recovered by agarose gel electrophoresis.

3. Restriction enzyme pLVX-Ubi-MCS-Cbh-EGFP-IRES-Puro vector

The plasmid pLVX-Ubi-MCS-Cbh-EGFP-IRES-Puro was digested with AgeI-EcoRI and the digestion system is shown in Table 5.

Table 5 enzyme digestion System

After 5h reaction at 7℃the large fragment was recovered on a 1% agarose gel.

4. Ligation of the Gene fragment of interest and vector

Ligating the recovered and purified target fragment with the recovered and purified carrier, the ligation product being designated as

pLVX-Ubi-MCS-Cbh-EGFP-IRES-Puro. The connection system is shown in Table 6.

Table 6 connection system

Connection reaction conditions: the reaction was carried out at 50℃for 30min.

5. Ligation product transformation competent cells

mu.L ligation product was used to transform 100. Mu.L DH5a competent cells: mixing the product with competent cells, ice-bathing for 30min, heat-shocking at 42 deg.C for 90s, immediately placing on ice for 2min, adding 500 μL LB medium preheated to room temperature, shaking at 180rpm and 37 deg.C for 1h, centrifuging at 5000rpm for 3min, discarding 500 μL culture supernatant, mixing the rest 100 μL with a pipettor, uniformly coating on LB plate containing 50 μg/mL ampicillin resistance, inverting, and culturing overnight in a 37 deg.C constant temperature incubator.

6. Sequencing identification

7. Extraction of plasmids from properly sequenced positive strains

And (3) performing amplification culture on the positive strain with correct sequencing (adding the positive strain into 20mL of LB culture medium containing corresponding antibiotics for culturing for 12 hours at 37 ℃), and extracting plasmids to obtain the target gene-pLVX-Ubi-MCS-Cbh-EGFP-IRES-Puro vector.

EXAMPLE 3pLVX-Ubi-MCS-Cbh-EGFP-IRES-Puro lentiviral packaging

1. Cell preparation

1) The day before transfection, 3-5 x 106 293T cells per dish were seeded in 10mm cell culture dishes, DMEM medium containing 10% foetal calf serum was added, 37℃at 5% CO ₂ Culturing in an incubator.

2) On the day of transfection, transfection was performed at a cell density of 80%. According to psPAX2: pMD2.G: destination plasmid = 2:1:1, adding the mixture into serum-free DMEM culture solution, gently mixing, and standing for 5min.

3) The transfection reagent was gently mixed with serum-free DMEM medium and allowed to stand for 5 mm

Mixing the liquids obtained in the steps 2) and 3), and standing for 20min.

4) The mixture was evenly dropped into a cell culture dish and incubated in a 5% CO2 cell incubator at 37℃for 6h.

5) Cell supernatant was collected after 48h of further culture

2. Concentrating

1) After 48h of transfection, the cell supernatants were collected in a 50mL centrifuge tube and the DMEM medium was replaced, and after 72h the cell supernatants were collected again and the two collected liquids were mixed.

2) The collected virus solution was mixed and concentrated by centrifugation.

3) The virus supernatant concentrate was dispensed into virus tubes and frozen at-80 ℃.

3. Concentrating

1) 293T cells were seeded into 96-well plates, 1.105 per well, and incubated overnight at 37 ℃.

2) The virus stock was resuspended in DMEM medium at a first stock solution of 10. Mu.L and then subjected to 10-fold gradient dilution, 100. Mu.L medium-virus mixture was added to each well, and 3 multiplex wells were made for each dilution. Culturing in 5% CO2 incubator at 37deg.C.

3) After 24 hours, the culture medium containing virus DMEM was replaced with DMEM complete medium without virus liquid.

4) After further culturing for 48 hours, the number of fluorescent cells contained in each well was observed under a fluorescent microscope and counted, and photographed to calculate the virus titer.

The sum of the total number within 3 duplicate wells was calculated and the average calculated, assuming a (average number of fluorescent cells in the penultimate visible fluorescent well) and B (average number of fluorescent cells in the penultimate visible fluorescent well). Lentivirus titer calculation formula: lentiviral titer (TU/mL) = (a+b×10) ×1000/2/a well viral load (μl).

Test example: lentiviral overexpression vectors of the invention are used for gene testing in suspension cells

Designing PCR amplification primers according to the RAB40C gene (NCBI database accession number: NM_021168) sequence, and amplifying the linear sequence of the circular RNA; the target nucleotide sequence was then ligated into the over-expression vector of the present invention via EcoRI and AgeI cleavage sites to construct the over-expression vector, which was then lentivirally packaged.

The constructed lentiviral overexpression vector was successfully expressed in suspension cells by lentiviral transfection and fluorescent quantitative PCR detection. The specific detection steps are as follows:

1. primer design for PCR amplification of RAB40C (NM_021168) gene:

RAB40C(NM_021168)-F：ACAGCAGAGATCCAGTTTATCGATCTGCAGTGCAGCGTGACCC(SEQ ID NO.4)

RAB40C(NM_021168)-R：GCCACAGACCTGGCCCGGGGAATTCCTAGGAGATCTTGCAGTTACTCCGC(SEQ ID NO.5)

2. PCR amplification of target circular RNA sequences

The PCR system is shown in Table 7.

TABLE 7 PCR System

PCR reaction conditions:

98℃5min；98℃10s，60℃5s，72℃15s，30cycles；72℃10min，4℃4min。

the PCR amplified product is recovered through rubber tapping and is connected to a vector containing the invention after enzyme cutting, and a vector of the suspended cell lentivirus over-expression RAB40C (NM_021168) gene is constructed and named as RAB40C (NM_021168) -pLVX-Ubi-MCS-Cbh-EGFP-IRES-Puro.

3. Lentivirus package

The above overexpression vector was used as psPAX2: pMD2.G: destination plasmid = 2:1:1 ratio, lentiviral packaging. Lentiviruses infect suspension cell Jurkat cells.

4. Fluorescent quantitative PCR detection of mRNA expression

1) According to RAB40C gene (accession number: NM_021168) sequence design PCR amplification primer, specific detection RAB40C (NM_021168) primer sequence is:

RAB40C-F：CGCCTACAGTAACGGGATCG(SEQ ID NO.6)

RAB40C-R：TTTCCAACCAAGATCCGGGG(SEQ ID NO.7)

2) The beta-actin gene is selected as an internal reference gene of fluorescence quantitative result data, and the sequence is as follows:

β-actin F：CATGGGTCAGAAGGATTCCT(SEQ ID NO.8)

β-actin R：TCGTCCCAGTTGGTGACGAT(SEQ ID NO.9)

3) The specific detection method comprises the following steps:

cells infected with the over-expressed lentivirus were subjected to total RNA extraction in the cells according to the Reagent (Life technologies company) protocol.

The extraction detailed steps are as follows:

(1) About 100 ten thousand cells were taken and 1mL of trizol was added.

(2) 200 mu L of chloroform is added, the mixture is vigorously oscillated for 15s and is kept stand at room temperature for 15min;

(3) Centrifuging 12000g for 15min at 4deg.C, separating the solution into three layers, dissolving RNA in the water phase, and transferring the water phase to another new RNase free EP tube;

(4) Adding 1-time volume of isopropanol, and fully and uniformly mixing by vortex;

(5) Centrifuging 12000g for 10min at 4 ℃, precipitating RNA at the bottom of the tube after centrifuging, and discarding the supernatant;

(6) 1mL of 75% ethanol was added, gently inverted by hand, centrifuged at 12000g for 5min, and the supernatant was discarded;

(7) Air-dried at room temperature, added with 25. Mu.L DEPC H2O, blown several times with a gun head to dissolve RNA sufficiently, and stored at-80 ℃.

(8) And (3) RNA concentration detection: RNA concentration was detected using a nucleic acid protein detector.

4) Reverse transcription PCR

(1) The reverse transcription reaction solution was prepared as in Table 8 and placed in an EP tube.

TABLE 8 reverse transcription reaction solution

(2) The following reactions were performed on a PCR instrument: 72℃for 5min, and then quenched on ice.

(3) The reverse transcription system in Table 9 was added to the EP tube in step (1).

TABLE 9 reverse transcription reaction system

The reverse transcription reaction was performed on a PCR instrument under the following conditions: 25 ℃ for 5min;42 ℃ for 60min;72 ℃ for 10min;4 ℃ for 2min. The cDNA obtained by the reaction was immediately subjected to an experiment or stored at 4 ℃.

5) Real-time fluorescent quantitative PCR reaction

(1) The fluorescent quantitative PCR reaction system is shown in Table 10.

Table 10 fluorescent quantitative PCR reaction System

(2) Setting reaction conditions:

as shown in Table 11, the fluorescent quantitative PCR reaction conditions were: denaturation at 95℃for 3min;95℃15s,60℃20s (fluorescence signal was collected at this step); 40 cycles, and then carrying out melting curve analysis; melting procedure: and collecting fluorescent signals at the temperature of 59-95 ℃ for 2min at the temperature of 95 ℃.

TABLE 11 fluorescent quantitative PCR reaction conditions

The fluorescent quantitative result is shown in fig. 2, and it can be seen from the graph that after cells are infected with the over-expression lentivirus, the target RAB40C (NM_021168) molecule successfully detects high expression, and compared with the untransfected group, the expression quantity is increased by 4 times, which indicates that the suspension cell over-expression vector constructed by the invention can effectively over-express mRNA in suspension cells.

RAB40C (NM-021168) -pLVX-Ubi-MCS-Cbh-EGFP-IRES-Puro vector after packaging lentiviruses, the state, growth and fluorescence of the cells were observed after infection of the target cell Jurkat, as shown in FIG. 3. After virus packaging of the ordinary vector (pLVX-EGFP-IRES-Puro), the suspension cells were infected with the virus, and after virus packaging of the suspension cell-specific vector (pLVX-Ubi-MCS-Cbh-EGFP-IRES-Puro), the suspension cells were infected with the virus, and the virus infection effect of the suspension cell-specific vector packaging was significantly better than that of the virus packaged with the ordinary vector (see FIG. 4).

In conclusion, the suspension cell over-expression lentiviral vector provided by the invention is designed based on a high-quality lentiviral packaging plasmid, and is applied to lentiviral packaging after mRNA is expressed by the vector, so that the vector is convenient for subsequent test operation, can be universally applied to the expression of suspension cells, has high and stable expression efficiency, greatly improves the over-expression effect in suspension cells, and is simple and feasible to apply and easy to popularize.

SEQUENCE LISTING

<110> Hunan Feng Hui Biotechnology Co., ltd

<120> lentiviral vector for suspension cells and use thereof

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 2871

<212> DNA

<213> artificial sequence

<400> 1

ctgcagtgca gcgtgacccg gtcgtgcccc tctctagaga taatgagcat tgcatgtcta 60

agttataaaa aattaccaca tatttttttt gtcacacttg tttgaagtgc agtttatcta 120

tctttataca tatatttaaa ctttactcta cgaataatat aatctatagt actacaataa 180

tatcagtgtt ttagagaatc atataaatga acagttagac atggtctaaa ggacaattga 240

gtattttgac aacaggactc tacagtttta tctttttagt gtgcatgtgt tctccttttt 300

ttttgcaaat agcttcacct atataatact tcatccattt tattagtaca tccatttagg 360

gtttagggtt aatggttttt atagactaat ttttttagta catctatttt attctatttt 420

agcctctaaa ttaagaaaac taaaactcta ttttagtttt tttatttaat aatttagata 480

taaaatagaa taaaataaag tgactaaaaa ttaaacaaat accctttaag aaattaaaaa 540

aactaaggaa acatttttct tgtttcgagt agataatgcc agcctgttaa acgccgtcga 600

cgagtctaac ggacaccaac cagcgaacca gcagcgtcgc gtcgggccaa gcgaagcaga 660

cggcacggca tctctgtcgc tgcctctgga cccctctcga gagttccgct ccaccgttgg 720

acttgctccg ctgtcggcat ccagaaattg cgtggcggag cggcagacgt gagccggcac 780

ggcaggcggc ctcctcctcc tctcacggca ccggcagcta cgggggattc ctttcccacc 840

gctccttcgc tttcccttcc tcgcccgccg taataaatag acaccccctc cacaccctct 900

ttccccaacc tcgtgttgtt cggagcgcac acacacacaa ccagatctcc cccaaatcca 960

cccgtcggca cctccgcttc aaggtacgcc gctcgtcctc cccccccccc cctctctacc 1020

ttctctagat cggcgttccg gtccatggtt agggcccggt agttctactt ctgttcatgt 1080

ttgtgttaga tccgtgtttg tgttagatcc gtgctgctag cgttcgtaca cggatgcgac 1140

ctgtacgtca gacacgttct gattgctaac ttgccagtgt ttctctttgg ggaatcctgg 1200

gatggctcta gccgttccgc agacgggatc gatttcatga ttttttttgt ttcgttgcat 1260

agggtttggt ttgccctttt cctttatttc aatatatgcc gtgcacttgt ttgtcgggtc 1320

atcttttcat gctttttttt gtcttggttg tgatgatgtg gtctggttgg gcggtcgttc 1380

tagatcggag tagaattaat tctgtttcaa actacctggt ggatttatta attttggatc 1440

tgtatgtgtg tgccatacat attcatagtt acgaattgaa gatgatggat ggaaatatcg 1500

atctaggata ggtatacatg ttgatgcggg ttttactgat gcatatacag agatgctttt 1560

tgttcgcttg gttgtgatga tgtggtgtgg ttgggcggtc gttcattcgt tctagatcgg 1620

agtagaatac tgtttcaaac tacctggtgt atttattaat tttggaactg tatgtgtgtg 1680

tcatacatct tcatagttac gagtttaaga tggatggaaa tatcgatcta ggataggtat 1740

acatgttgat gtgggtttta ctgatgcata tacatgatgg catatgcagc atctattcat 1800

atgctctaac cttgagtacc tatctattat aataaacaag tatgttttat aattattttg 1860

atcttgatat acttggatga tggcatatgc agcagctata tgtggatttt tttagccctg 1920

ccttcatacg ctatttattt gcttggtact gtttcttttg tcgatgctca ccctgttgtt 1980

tggtgttact tctgcagacc ggtgcggccg cgaattcccc gggccaggtc tgtggctcga 2040

gtctagagga tccgcagaca aatggctcta gaggtacccg ttacataact tacggtaaat 2100

ggcccgcctg gctgaccgcc caacgacccc cgcccattga cgtcaatagt aacgccaata 2160

gggactttcc attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta 2220

catcaagtgt atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc 2280

gcctggcatt gtgcccagta catgacctta tgggactttc ctacttggca gtacatctac 2340

gtattagtca tcgctattac catggtcgag gtgagcccca cgttctgctt cactctcccc 2400

atctcccccc cctccccacc cccaattttg tatttattta ttttttaatt attttgtgca 2460

gcgatggggg cggggggggg gggggggcgc gcgccaggcg gggcggggcg gggcgagggg 2520

cggggcgggg cgaggcggag aggtgcggcg gcagccaatc agagcggcgc gctccgaaag 2580

tttcctttta tggcgaggcg gcggcggcgg cggccctata aaaagcgaag cgcgcggcgg 2640

gcgggagtcg ctgcgcgctg ccttcgcccc gtgccccgct ccgccgccgc ctcgcgccgc 2700

ccgccccggc tctgactgac cgcgttactc ccacaggtga gcgggcggga cggcccttct 2760

cctccgggct gtaattagct gagcaagagg taagggttta agggatggtt ggttggtggg 2820

gtattaatgt ttaattacct ggagcacctg cctgaaatca ctttttttca g 2871

<210> 2

<211> 43

<212> DNA

<213> artificial sequence

<400> 2

acagcagaga tccagtttat cgatctgcag tgcagcgtga ccc 43

<210> 3

<211> 46

<212> DNA

<213> artificial sequence

<400> 3

cccttgctca ccatggtggc ctgaaaaaaa gtgatttcag gcaggt 46

<210> 4

<211> 43

<212> DNA

<213> artificial sequence

<400> 4

acagcagaga tccagtttat cgatctgcag tgcagcgtga ccc 43

<210> 5

<211> 50

<212> DNA

<213> artificial sequence

<400> 5

gccacagacc tggcccgggg aattcctagg agatcttgca gttactccgc 50

<210> 6

<211> 20

<212> DNA

<213> artificial sequence

<400> 6

cgcctacagt aacgggatcg 20

<210> 7

<211> 20

<212> DNA

<213> artificial sequence

<400> 7

tttccaacca agatccgggg 20

<210> 8

<211> 20

<212> DNA

<213> artificial sequence

<400> 8

catgggtcag aaggattcct 20

<210> 9

<211> 20

<212> DNA

<213> artificial sequence

<400> 9

tcgtcccagt tggtgacgat 20

Claims

1. A lentiviral vector is characterized in that the lentiviral vector takes pLVX-EGFP-IRES-Puro as a framework, a Ubi promoter-Cbh promoter is inserted, the Ubi promoter-Cbh promoter replaces a CMV promoter in the pLVX-EGFP-IRES-Puro, and the nucleotide sequence of the Ubi promoter-Cbh promoter is shown as SEQ ID NO. 1.

2. A recombinant lentivirus comprising the lentiviral vector of claim 1.

3. The method for preparing the recombinant lentivirus of claim 2, wherein the preparation method is to introduce a target gene into the lentivirus vector of claim 1 to obtain a target plasmid, and co-transfect the target plasmid with the psPAX2 and the pMD2.G to obtain the recombinant lentivirus.

4. The method according to claim 3, wherein the mass ratio of psPAX2, pMD2.G, and the target plasmid is psPAX2: pMD2.G: destination plasmid = 2:1:1.

5. a recombinant cell comprising the lentiviral vector of claim 1 and/or the recombinant lentiviral vector of claim 2.

6. A method of infecting a cell, wherein the method is performed by co-culturing the recombinant lentivirus of claim 2 with the cell to be infected.

7. A pharmaceutical composition comprising one or more of the lentiviral vector of claim 1, the recombinant lentiviral vector of claim 2, and the recombinant cell of claim 5.

8. Use of the lentiviral vector of claim 1, or the recombinant lentivirus of claim 2, or the recombinant cell of claim 5, for expression of a protein or for the preparation of a medicament.