CN114107176A

CN114107176A - CHO cell line for stably expressing African swine fever CD2v protein and construction method and application thereof

Info

Publication number: CN114107176A
Application number: CN202111525599.7A
Authority: CN
Inventors: 王晓虎; 陈晶; 王艳云; 向华; 黄元; 黄忠; 王刚
Original assignee: Institute of Animal Health of Guangdong Academy of Agricultural Sciences
Current assignee: Institute of Animal Health of Guangdong Academy of Agricultural Sciences
Priority date: 2021-12-14
Filing date: 2021-12-14
Publication date: 2022-03-01

Abstract

The invention belongs to the technical field of cell recombination and protein expression, and particularly relates to a CHO cell line for stably expressing African swine fever CD2v protein, a construction method and application thereof, the invention discloses a CHO cell line for stably expressing African swine fever CD2v protein, the cell line is Chinese hamster ovary cell CHO-CD2v, and the cell line is sent to Guangdong province microbial strain collection center for preservation at 11 months and 11 days in 2021, and the preservation number is GDMCC No. 62052. The cell line of the invention integrates the exogenous gene CD2v into the known safe locus in the genome of the Chinese hamster, thereby realizing the normal expression of the transgene without influencing the normal physiological function of the cell, and the cell line has simple construction process and high cloning accuracy. The cell line can be used for high-yield CD2v protein, drug effect screening of African swine fever, vaccine production and the like, and has very important significance for diagnosis of African swine fever and vaccine production.

Description

CHO cell line for stably expressing African swine fever CD2v protein and construction method and application thereof

Technical Field

The invention belongs to the technical field of cell recombination and protein expression, and particularly relates to a CHO cell line for stably expressing African swine fever CD2v protein, and a construction method and application thereof.

Background

African Swine Fever (ASF) is a hemorrhagic, highly contagious infectious disease in pigs caused by African Swine Fever Virus (ASFV), and its clinical symptoms are very similar to those of swine fever. ASF is an emerging disease of the swine industry worldwide. The disease occurs for the first time in Shenyang city of Liaoning province in 2018, and the introduction of ASF seriously threatens the survival of the pig industry in China. One of the main reasons for the difficulty of controlling this epidemic is that there is currently no commercially available effective vaccine worldwide and the lack of knowledge about the ASF virus (ASFV) antigen has hampered the progress of the relevant research. Studies have shown that the ASFV serotype specific protein CD2v (EP402R) is a crucial role in preventing homologous ASF infection.

CD2v is the only protein present on the outer envelope of ASF virions, a characteristic protein of virus entry into or transmission between cells, and consists of a signal peptide sequence and a transmembrane region, since it possesses two immunoglobulin-like domains with amino acid sequences very similar to those of the CD2 molecule. CD2v present on the outer envelope of the virus can facilitate viral transmission by mediating the attachment of extracellular virions to erythrocytes. In addition, CD2v may also confer immunosuppressive activity on the virus in vitro by inhibiting lymphocyte proliferation.

The CHO cell, namely Chinese hamster ovary (Chinese hamster ovary), is immortal, can be passaged for more than one hundred generations, and is a cell widely used in bioengineering at present. Compared with other cell expression systems, the CHO expression system has accurate post-transcriptional modification function, the expressed protein is closest to natural protein molecules in terms of molecular structure, physicochemical properties and biological function, and simultaneously, the CHO also has the extracellular secretion function of products and rarely secretes endogenous protein of the CHO. Besides, CHO also has the advantages of high-efficiency amplification and expression of recombinant genes, stable integration of foreign proteins and the like. Thus, CHO is considered to be an ideal host for expression of complex biological macromolecules.

In conclusion, the CD2v is stably integrated into the genome of Chinese Hamster Ovary (CHO) cells by using a genetic engineering technology to construct a stably expressed CD2v cell line, and the method has very important significance for the diagnosis of African swine fever and the production of vaccines.

Disclosure of Invention

In order to overcome the defects of the prior art, the primary object of the invention is to provide a CHO cell line for stably expressing African swine fever CD2v protein.

The second purpose of the invention is to provide a construction method of the CHO cell line for stably expressing the African swine fever CD2v protein.

The third purpose of the invention is to provide the application of the CHO cell line for stably expressing the African swine fever CD2v protein.

The first object of the present invention is achieved by the following technical solutions:

a CHO cell line for stably expressing African swine fever CD2v protein is Chinese hamster ovary cell CHO-CD2v, which is delivered to Guangdong province microorganism culture collection center for preservation 11/2021, and the preservation number is GDMCC No. 62052.

The serotype-specific protein CD2v (EP402R) is the only protein present on the outer envelope of the virion and is a characteristic protein of the virus for entry into or transmission between cells. CD2v present on the outer envelope of the virus can facilitate viral transmission by mediating the attachment of extracellular virions to erythrocytes. In addition, it can also make the virus have immunosuppressive activity in vitro by inhibiting lymphocyte proliferation. Therefore, the construction of a cell line capable of stably expressing CD2v has very important significance for the diagnosis of African swine fever and the production of vaccines. And the Chinese hamster ovary cell CHO can integrate the foreign gene into a known safe site in a genome, so that the normal expression of the transgene is realized without influencing the normal physiological function of the cell.

The second object of the present invention is achieved by the following technical solutions:

the preparation method of the CHO cell line for stably expressing the African swine fever CD2v protein comprises the following steps:

s1, connecting a target gene CD2v to a DC-SH02 carrier to construct a DC-SH02-CD2v recombinant plasmid, wherein the nucleotide sequence of the DC-SH02-CD2v recombinant plasmid is shown as SEQ ID No. 3;

s2, co-transfecting recombinant plasmids DC-SH02-CD2v and pROSA26-Cas9gRNA plasmids into Chinese Hamster Ovary (CHO) cells;

s3, screening the transfected cells by a puromycin screening method and a limiting dilution method to obtain a cell line stably expressing CD2 v.

The invention firstly constructs DC-SH02-CD2v overexpression plasmid, then co-transfects the DC-SH02-CD2v and pROSA26-Cas9gRNA plasmid to Chinese hamster ovary Cells (CHO), and finally successfully obtains a monoclonal cell strain, namely a CHO cell line stably expressing African swine fever CD2v protein by utilizing a puromycin screening method and a limited dilution method, provides reference for developing African swine fever preparations, and has very important significance for the diagnosis of African swine fever and the production of vaccines.

Preferably, in step S1, the target gene is obtained by amplifying a pMD18-CD2v plasmid as a template by using primers CD2v-F and CD2v-R, the nucleotide sequence of the CD2v-F is shown as SEQ ID No.1, and the nucleotide sequence of the CD2v-R is shown as SEQ ID No. 2.

Furthermore, in the primers CD2v-F and CD2v-R, the 5' end contains an enzyme cutting site and a corresponding protection base. Specifically, the restriction sites are KpnI and BamHI.

Preferably, in step S2, the target gene CD2v is introduced into the genome of Chinese hamster at a safe site by recombinant plasmid DC-SH02-CD2 v.

Preferably, in step S2, the safe site is a ROSA26safe site.

The ROSA26 site (GenBank: NC-000072) is located on chromosome 6 of the mouse genome and was first found in a mouse strain designated ROSA β geo 26. Mice of this strain were able to detect high levels of β -galactosidase expression in all tissues because of a randomly inserted gene. This site expresses one coding transcript and two non-coding transcripts, only the sequence of the non-coding transcript being disturbed by this foreign insertion. Although both allelic regions carry exogenous inserts, the birth rate of homozygote mouse litters is slightly lower than that of heterozygote litters, but homozygote litters can develop and multiply normally. Since then, the "ROSA 26" site was used for gene transfer; the knock-in of the gene at the site has no side effect on the health of cells and mice, and can ensure the normal and stable expression of the transferred gene.

The TALEN or CRISPR-Cas9 system specifically targeting the ROSA26 site can generate DNA double strand break at the ROSA26 site on the chromosome 6 of a mouse, trigger a DNA repair mechanism of a cell, and induce Homologous Recombination (HR) between a genome and a ROSA26 donor clone, so that a DNA fragment on the donor clone is integrated into the ROSA26safe harbor site on the genome, and the possibility is provided for constructing a cell line for stably expressing CD2 v.

Preferably, in step S1, the DC-SH02 vector contains a CMV promoter sequence and ROSA26 safety site recombination arms (MRL and MRR). The MRL and the MRR are respectively shown as SEQ ID NO.4 and SEQ ID NO. 5.

Preferably, the DC-SH02 vector further comprises a PolyA signal sequence and a puromycin resistance gene sequence.

Further, the PolyA signal sequence is a bGH PolyA signal.

Preferably, in step S3, puromycin screening is performed by culturing transfected cells in puromycin-containing medium at a concentration of 7. mu.g/mL to pick out single cell colonies.

Puromycin (Puromycin) is an aminoglycoside antibiotic produced by streptomyces albus. It can disrupt peptide transport on the ribosome, causing premature chain termination during translation, thereby inhibiting protein synthesis. Puromycin is a potent translation inhibitor in both prokaryotic and eukaryotic cells. In the present invention, the constructed vector carries Puro resistance, and thus Puromycin can be used for selection of cells that have been successfully transfected.

Preferably, in step S2, the recombinant plasmids DC-SH02-CD2v and pROSA26-Cas9gRNA plasmid are added in a ratio of 1: 1.

Preferably, the recombinant plasmid DC-SH02-CD2v contains a CD2v gene sequence or fragment, a CMV promoter sequence and ROSA26 safety site recombination arms (MRL and MRR).

Further, the recombinant plasmid DC-SH02-CD2v also contains a fluorescent labeling sequence. Specifically, the fluorescent labeling sequence is a green fluorescent protein sequence.

The third object of the present invention is achieved by the following technical solutions:

the application of the CHO cell line stably expressing the African swine fever CD2v protein in preparing the CD2v protein.

The CHO cell line stably expressing the African swine fever CD2v protein is applied to drug effect screening and/or vaccine production of the African swine fever.

By adding a fluorescent marker sequence into the plasmid, the expression condition of the CD2v protein in the transfected cells can be indicated, and if the medicament or preparation applied to the transfected cells has the capacity of binding to the CD2v gene or the capacity of inhibiting the expression of the CD2v, the effectiveness of the medicament can be judged according to the fluorescence intensity. Therefore, the CHO cell line for stably expressing the African swine fever CD2v protein can be used for high-yield CD2v protein, drug effect screening and/or vaccine production of the African swine fever, and can also provide a cell model for separation of the African swine fever virus, thereby providing a platform for research on pathogenic mechanisms between the African swine fever and a host.

Compared with the prior art, the invention has the beneficial effects that:

the invention discloses a CHO cell line for stably expressing African swine fever CD2v protein, which is Chinese hamster ovary cell CHO-CD2v and is sent to Guangdong province microorganism strain collection center for collection at 11 months and 11 days in 2021, wherein the collection number is GDMCC No. 62052. The cell line of the invention integrates the exogenous gene CD2v into the known safe site in the genome of Chinese hamster, thereby realizing the normal expression of the transgene without affecting the normal physiological function of the cell. Meanwhile, the CRISPR/Cas editing technology is adopted for constructing the cell line, the construction process is simple, the repeatability is good, the efficiency is high, and the cloning accuracy is high through the identification and sequencing of the PCR of the left and right homologous arm sequences after puromycin pressure screening and fixed-point integration, so that the acquisition of correct clone is ensured. In addition, the cell line can be used for high-yield CD2v protein, drug effect screening and/or vaccine production of African swine fever, provides a cell model for separation of African swine fever virus, provides a platform for research of pathogenesis between African swine fever and a host, and has very important significance for diagnosis of African swine fever and vaccine production.

Drawings

FIG. 1 is a plasmid map of plasmid vector 1(DC-SH 02);

FIG. 2 is a plasmid map of template plasmid 2(DC-SH02-CD2 v);

FIG. 3 is a plasmid map of pROSA26-Cas9 gRNA;

FIG. 4 is a fluorescent diagram of transfected cells (A is a fluorescent diagram of transfected cells after 24h of culture, B is a fluorescent diagram after 10d of puromycin pressure screening);

FIG. 5 is a schematic fluorescence diagram of a monoclonal cell population of transfected cells;

FIG. 6 shows the results of the amplification electrophoresis of the left homology arm specific primer (a), the right homology arm specific primer (b) and the CD2v specific primer (c) (M is DNAmarker, 1-3 is DNA from CHO-CD2v cell);

FIG. 7 shows the mRNA identification of the CD2v gene in different generations of monoclonal cell lines;

FIG. 8 shows SDS-PAGE Western Blot electrophoresis bands (A is SDS-PAGE of protein expressed by CHO-CD2v cells, B is SDS-PAGE of internal reference GAPDH protein, 1 represents CHO cells, and 2 represents CHO-CD2v cells).

Detailed Description

The following further describes the embodiments of the present invention. It should be noted that the description of the embodiments is provided to help understanding of the present invention, but the present invention is not limited thereto. In addition, the technical features involved in the embodiments of the present invention described below may be combined with each other as long as they do not conflict with each other.

The experimental procedures in the following examples were carried out by conventional methods unless otherwise specified, and the test materials used in the following examples were commercially available by conventional methods unless otherwise specified.

Example 1 construction of CHO cell line CHO-CD2v stably expressing African Swine fever CD2v protein

1. Test materials

Coli competent cell DH5 α was purchased from Ongchow Biotech, Inc.; CHO cells were purchased from Wuhan Punuo race Life technologies, Inc., and subcultured in this laboratory; mouse ROSA26Safe Harbor gene knock-in vectors (including DC-SH02, pROSA26-Cas9 gRNA) were purchased from Hippocampus Biotech Co., Ltd and stored in the laboratory; fetal bovine serum, DMEM/F-12K medium, Lipofectamine (TM) 3000, puromycin, plasmid extraction kit, genomic DNA extraction, RNA extraction and other kits and Phusion Hot Start II High-Fidelity PCR Master Mix were purchased from Samier Feishell science and technology (China); restriction enzymes KpnI and BamHI and T4 DNA ligase were purchased from NEB; the pMD18-CD2v plasmid carrying the CD2v gene was gifted by Hurong professor of the military veterinary academy of sciences.

2. Design of primers

Primers were designed based on the CD2v gene sequence (database accession number: MK333180.1) and ligated to the 5' ends of the upstream and downstream primers, cleavage sites KpnI and BamHI and corresponding protective bases (the cleavage sites and corresponding protective bases are underlined).

The sequences of the primer group are specifically as follows:

upstream primer F (CD2 v-F): 5' -GGGGTACCATGTTCATAAAATGATAATACTTAT-3’(SEQ ID NO.1)；

Downstream primer R (CD2 v-R): 5' -GCGGATCCTTAAATAATTCTATCTACG-3’(SEQ ID NO.2)。

3. Construction of cell lines

(1) Amplification of target genes

The pMD18-CD2v plasmid is used as a template, and the target gene is amplified by PCR.

Wherein, the reaction system of PCR amplification is as follows:

form panel	1μL
		Mix	25μL
Upstream primer F	2μL
		Downstream primer R	2μL
ddH₂O	Make up to 50 μ L

The Mix is Phusion Hot Start II High-Fidelity PCR Master Mix.

The reaction procedure for PCR amplification was:

pretreating at 98 ℃ for 30 s; denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 30s for 30 cycles; final extension at 72 ℃ for 10 min.

The PCR product was identified by 1.5% agarose gel electrophoresis, and after confirming the correctness, the target gene was recovered by cutting the gel using a DNA purification kit (Thermo).

(2) Preparation of template plasmid 2.

The target gene recovered in the above step and plasmid vector 1(DC-SH02, the plasmid map is shown in figure 1, containing CMV promoter sequence, ROSA26safe site recombination arm, polyA signal sequence and puromycin resistance gene sequence, the polyA signal sequence is bGH polyA signal), are subjected to double digestion treatment with restriction enzymes KpnI and BamHI respectively, the digested fragments are recovered, the target gene sequence is ligated into plasmid vector 1 by ligase by the conventional method in the art to obtain template plasmid 2 (template plasmid 2: DC-SH02-CD2v, the plasmid of which is shown in figure 2, wherein MRL and MRR are ROSA26safe site recombination arms, the nucleotide sequence of template plasmid 2 is shown in SEQ ID NO.3, containing green fluorescent protein sequence), the template plasmid 2 is transformed into Escherichia coli competent cell DH5 alpha, and the positive cell clone is screened, and the cloning correctness is ensured by using restriction enzymes KpnI and BamHI for enzyme cutting and sequencing identification.

Nucleotide sequence of template plasmid 2 (SEQ ID No. 3):

Atgataatacttatttttttaatattttctaacatagttttaagtattgattattgggttagttttaataaaacaataattttagatagtaatattactaatgataataatgatataaatggagtatcatggaatttttttaataattcttttaatacactagctacatgtggaaaagcaggtaacttttgtgaatgttctaattatagtacatcaatatataatataacaaataattgtagcttaactatttttcctcataatgatgtatttgatacaacatatcaagtagtatggaatcaaataattaattatacaataaaattattaacacctgctactcccccaaatatcacatataattgtactaattttttaataacatgtaaaaaaaataatggaacaaacactaatatatatttaaatataaatgatacttttgttaaatatactaatgaaagtatacttgaatataactggaataatagtaacattaacaattttacagctacatgtataattaataatacaattagtacatctaatgaaacaacacttataaattgtacttatttaacattgtcatctaactatttttatactttttttaaattatattatattccattaagcatcataattgggataacaataagtattcttcttatatccatcataacttttttatctttacgaaaaagaaaaaaacatgttgaagaaatagaaagtccaccacctgaatctaatgaagaagaacaatgtcagcatgatgacaccacttccatacatgaaccatctcccagagaaccattacttcctaagccttacagtcgttatcagtataatacacctatttactacatgcgtccctcaacacaaccactcaacccatttcccttacctaaaccgtgtcctccacccaaaccatgtccgccacccaaaccatgtcctccacctaaaccatgtccttcagctgaatcctattctccacccaaaccactacctagtatcccgctactacccaatatcccgccattatctacccaaaatatttcgcttattcacgtagatagaattatttaa。

MRL sequence (SEQ ID NO. 4):

Gtcagttaacggcagccggagtgcgcagccgccggcagcctcgctctgcccactgggtggggcgggaggtaggtggggtgaggcgagctggacgtgcgggcgcggtcggcctctggcggggcgggggaggggagggagggtcagcgaaagtagctcgcgcgcgagcggccgcccaccctccccttcctctgggggagtcgttttacccgccgccggccgggcctcgtcgtctgattggctctcggggcccagaaaactggcccttgccattggctcgtgttcgtgcaagttgagtccatccgccggccagcgggggcggcgaggaggcgctcccaggttccggccctcccctcggccccgcgccgcagagtctggccgcgcgcccctgcgcaacgtggcaggaagcgcgcgctgggggcggggacgggcagtagggctgagcggctgcggggcgggtgcaagcacgtttccgacttgagttgcctcaagaggggcgtgctgagccagacctccatcgcgcactccggggagtggagggaaggagcgagggctcagttgggctgttttggaggcaggaagcacttgctctcccaaagtcgctctgagttgttatcagtaagggagctgcagtggagtaggcggggagaaggccgcacccttctccggaggggggaggggagtgttgcaatacctttctgggagttctctgctgcctcctggcttctgaggaccgccctgggcctgggagaatcccttccccctcttccctcgtgatctgca。

MRR sequence (SEQ ID NO. 5):

Tgggcgggagtcttctgggcaggcttaaaggctaacctggtgtgtgggcgttgtcctgcaggggaattgaacaggtgtaaaattggagggacaagacttcccacagattttcggttttgtcgggaagttttttaataggggcaaataaggaaaatgggaggataggtagtcatctggggttttatgcagcaaaactacaggttattattgcttgtgatccgcctcggagtattttccatcgaggtagattaaagacatgctcacccgagttttatactctcctgcttgagatccttactacagtatgaaattacagtgtcgcgagttagactatgtaagcagaattttaatcatttttaaagagcccagtacttcatatccatttctcccgctccttctgcagccttatcaaaaggtattttagaacactcattttagccccattttcatttattatactggcttatccaacccctagacagagcattggcattttccctttcctgatcttagaagtctgatgactcatgaaaccagacagattagttacatacaccacaaatcgaggctgtagctggggcctcaacactgcagttcttttataactccttagtacactttttgttgatcctttgccttgatccttaattttcagtgtctatcacctctcccgtcaggtggtgttccacatttgggcctattctcagtccagggagttttacaacaatagatgtattgagaatccaacctaaagcttaactttccactcccatgaatgcctctctcctttttctccattt。

(3) screening for optimal Puro (Puromycin ) screening concentrations

The CHO cells are inoculated in a 96-well plate (DMEM/F-12K culture medium), after the CHO cells are cultured to 85% -90% of cell density, the CHO cells are cultured by DMEM/F-12K culture media (0, 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10 mu g/mL respectively) containing different Puro concentrations, the culture media are changed every day, and the continuous observation is carried out for 4-7d, wherein the lowest Puro concentration in the culture medium of all cell death after the CHO cells are cultured for 3-4d is the optimal Puro screening concentration.

As a result, it was found that, after adding culture medium of different Puro concentrations to CHO cells, a small amount of cell death occurred in the drug-screened groups except for the blank control group from day 2. When the screening is carried out to 4d, 40% of cells die in the 6 mu g/mL group, 90% of cells die in the 7 mu g/mL-10 mu g/mL group, and finally the optimal Puro screening concentration of CHO cells is confirmed to be 7 mu g/mL, because the higher Puro concentration can kill the cells quickly but is not beneficial to the expression of plasmids in the cells, and the lower Puro concentration can not kill enough untransfected successful cells in a proper time and is not beneficial to the subsequent screening of monoclonal cells. Therefore, the optimal Puro screening concentration for CHO cells in this example is 7 μ g/mL, which is both sufficient to kill enough cells in a defined time to meet the needs of the experiment, and which is relatively less toxic to the cells.

(4) Transfected cells

CHO cells were cultured in DMEM/F-12K medium (containing 10% fetal bovine serum). Cells were seeded into 6-well plates (2X 10) 1d before transfection⁵One/well), overnight until the cell density reached 90% -95%. Liposomes (Lipofectamine) were then used^TM3000) The template plasmid 2 and pROSA26-Cas9gRNA (the adding ratio (mass ratio) of the template plasmid 2 and pROSA26-Cas9gRNA is 1: 1) prepared in the way are cotransfected into CHO cells, and after transfection is carried out for 48 hours, the CHO cells are replaced by the plasmid containing the plasmidPuromycin culture medium is screened.

(5) Isolation of monoclonal cell lines

1) 100 μ L of medium (DMEM/F-12K) was added to each well of the sterilized 96-well plate, leaving the top left corner A1 well empty.

2) 200 μ L of cell suspension (2X 10) was added to A1 well⁴cells/mL), 100 μ L of the culture medium was mixed with the culture medium in the well B1 to avoid air bubbles during mixing. The same 1:2 dilution to H1 wells was continued in column 1 and the volume of each well in column 1 was brought to 200. mu.L with medium.

3) The cell suspension of column 1 was mixed well and 100. mu.L of each was added to the well of column 2. And (5) lightly and uniformly mixing by using a liquid transfer device to avoid generating bubbles. This 1:2 dilution was repeated to column 12 and the volume of each well was made up to 200. mu.L with medium.

4) The plates were incubated at 37 ℃ to avoid disturbance.

5) After culturing for 7 to 10 days, the cells were observed by a microscope, the wells containing the single colony were labeled on the plate cover, the single colony cells were digested, and the cells were cultured in the same manner as described above by expanding the cells in 24-well and 6-well plates.

The results of 24h culture of the co-transfected CHO cells and 10d stress screening are shown in FIG. 4. FIG. 4 shows that 24h after transfection, about 20% of dead cells and the remaining 80% of cells were fluorescently expressed, and that after 10d of pressure screening, most of the non-fluorescent cells were dead and 70% -90% of the cells were fluorescently expressed. After the fluorescent cells screened by the pressure of 10 days are digested, the cells are transferred into a 96-well plate by a limiting dilution method, the situation that the single cells form the monoclonal cell community after 10 days of culture is shown in figure 5, and the cells in the monoclonal cell community all have fluorescence, which indicates that the cloning is correct.

The method comprises the following steps of continuously passaging a positive cell clone strain for more than 10 times by using a DMEM/F-12K culture medium, freezing and recovering the positive cell clone strain according to a conventional method, and detecting the stability of a cell line by observing the fluorescence of the positive cell clone and detecting the expression level of a CD2v gene through qPCR, wherein the identification method comprises the following specific steps:

for 3 rd generation, 5 th generation and 10 th generation in the process of culturing cell clone strains as detection objects, DNA is extracted by using a kit or a conventional method in the field, and left and right homologous arm sequences [ MRL-F: CAAAGCCCCCAGGGATGTAA (SEQ ID NO. 6); MRL-R: CGCCCATTGATGTACTGC (SEQ ID NO. 7); MRR-F: CTGCATTCTAGTTGTGGTTTGTC (SEQ ID NO. 8); MRR-R: TGTCGCCGGTATTGTTCG (SEQ ID NO.9) and specific primers (SEQ ID NO.1 and SEQ ID NO.2) for amplifying CD2v gene sequences to carry out PCR identification respectively.

The identification result is shown in FIG. 6, wherein FIG. 6a shows the left homology arm of the CD2v gene sequence, the sequence length is 1.2 kb; FIG. 6b shows the right homology arm, sequence length 1.5 kb; FIG. 6c shows the CD2v gene sequence, which has a length of 1.083 kb. The size of the product is in accordance with the expecting of the experiment, the sequencing result is verified to be correct, the integration of the target gene is determined to be correct, and finally the constructed cell line is named as CHO-CD2 v.

3 rd generation, 5 th generation and 10 th generation in the process of culturing the cell clone strain are used as detection objects, total RNA of the screened cells is extracted by a mammal cell RNA extraction kit, and after the total RNA is reversely transcribed into cDNA, the transcription level of the CD2v gene is identified by qPCR according to a reaction system of a table 1 and a reaction program of a table 2. The primers used for qPCR were: CD2 v-qF: ATGCGTCCCTCAACACAACC (SEQ ID NO.10), CD2 v-qR: GGGATATTGGGTAGTAGCGGG (SEQ ID NO.11), and the amplification curve is shown in FIG. 7, which shows the knock-in of the CD2v gene into the genome of the cell.

TABLE 1 reaction System

TABLE 2 reaction procedure

4. Detection of CD2v expression Effect of cell line

Western Blot is adopted to detect the expression effect of CD2v of the cell line, and the specific steps are as follows:

culturing CHO-CD2v and CHO cells in a 6-well cell culture plate, removing the culture medium when the cell confluency is 80-90%, washing with PBS 3 times, adding 200 μ L of Pierce IP lysine Buffer (Cat. No.: 87787, from Sammer Feishell technology (China) Co., Ltd.) and 10 μ L of protease inhibitor (Cat. No.: P005, from Biyunnan Biotechnology) into each well of the 6-well plate, standing on ice for 10min, scraping the cells with a cell scraper and transferring to a 1.5mL Eppendorf tube, centrifuging at 4 ℃, 12000g/min for 5min, sucking the supernatant, detecting the protein concentration with a microplate reader (BCA method), and storing at 20 ℃ for later use. Two samples with the same protein concentration were subjected to SDS-PAGE electrophoresis, transferred to a nitrocellulose filter (NC membrane), and placed in 5% skimmed milk powder and subjected to shaking table sealing at room temperature for 2 hours. PBST washing 3 times, placing in diluent (1: 100) containing primary antibody (CD2v mouse monoclonal antibody), shaking overnight at 4 deg.C, washing 3 times with PBST; placing in a diluent (1: 1000) containing a secondary antibody (horseradish peroxidase HRP-labeled goat anti-mouse IgG), shaking at 37 ℃ for 2h, washing with PBST for 3 times, finally developing with ECL developing solution, and after reaction bands appear, washing the NC membrane with deionized water to stop the reaction.

As shown in FIG. 9, the SDS-PAGE Western Blot shows that compared with normal CHO cells, the cell line stably expressing CD2v constructed in the above example can correctly express CD2v protein.

In conclusion, positive amplification was obtained by PCR and qPCR amplification of the CD2v gene (3 rd, 5 th and 10 th generations) in different culture generations of the positive cell clones, and specific bands were identified by Western Blot. Therefore, the CHO-CD2v cell line constructed in the above example can be proved to be capable of correctly and stably expressing CD2v protein, and can provide a good cell model for further research of ASF vaccine production.

Finally, the cell line CHO-CD2v (Chinese hamster ovary cells) prepared in the above examples was collected by Guangdong provincial microorganism culture Collection (GDMCC) No. 62052 at 11.11.2021.

The embodiments of the present invention have been described in detail, but the present invention is not limited to the described embodiments. It will be apparent to those skilled in the art that various changes, modifications, substitutions and alterations can be made in these embodiments without departing from the principles and spirit of the invention, and the scope of protection is still within the scope of the invention.

Sequence listing

<110> institute of animal health of academy of agricultural sciences of Guangdong province

<120> CHO cell line for stably expressing African swine fever CD2v protein and construction method and application thereof

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 33

<212> DNA/RNA

<213> CD2v-F (Artificial sequence)

<400> 1

ggggtaccat gttcataaaa tgataatact tat 33

<210> 2

<211> 27

<212> DNA/RNA

<213> CD2v-R (Artificial sequence)

<400> 2

gcggatcctt aaataattct atctacg 27

<210> 3

<211> 1083

<212> DNA/RNA

<213> DC-SH02-CD2v (Artificial sequence)

<400> 3

atgataatac ttattttttt aatattttct aacatagttt taagtattga ttattgggtt 60

agttttaata aaacaataat tttagatagt aatattacta atgataataa tgatataaat 120

ggagtatcat ggaatttttt taataattct tttaatacac tagctacatg tggaaaagca 180

ggtaactttt gtgaatgttc taattatagt acatcaatat ataatataac aaataattgt 240

agcttaacta tttttcctca taatgatgta tttgatacaa catatcaagt agtatggaat 300

caaataatta attatacaat aaaattatta acacctgcta ctcccccaaa tatcacatat 360

aattgtacta attttttaat aacatgtaaa aaaaataatg gaacaaacac taatatatat 420

ttaaatataa atgatacttt tgttaaatat actaatgaaa gtatacttga atataactgg 480

aataatagta acattaacaa ttttacagct acatgtataa ttaataatac aattagtaca 540

tctaatgaaa caacacttat aaattgtact tatttaacat tgtcatctaa ctatttttat 600

acttttttta aattatatta tattccatta agcatcataa ttgggataac aataagtatt 660

cttcttatat ccatcataac ttttttatct ttacgaaaaa gaaaaaaaca tgttgaagaa 720

atagaaagtc caccacctga atctaatgaa gaagaacaat gtcagcatga tgacaccact 780

tccatacatg aaccatctcc cagagaacca ttacttccta agccttacag tcgttatcag 840

tataatacac ctatttacta catgcgtccc tcaacacaac cactcaaccc atttccctta 900

cctaaaccgt gtcctccacc caaaccatgt ccgccaccca aaccatgtcc tccacctaaa 960

ccatgtcctt cagctgaatc ctattctcca cccaaaccac tacctagtat cccgctacta 1020

cccaatatcc cgccattatc tacccaaaat atttcgctta ttcacgtaga tagaattatt 1080

taa 1083

<210> 4

<211> 780

<212> DNA/RNA

<213> MRL (Artificial sequence)

<400> 4

gtcagttaac ggcagccgga gtgcgcagcc gccggcagcc tcgctctgcc cactgggtgg 60

ggcgggaggt aggtggggtg aggcgagctg gacgtgcggg cgcggtcggc ctctggcggg 120

gcgggggagg ggagggaggg tcagcgaaag tagctcgcgc gcgagcggcc gcccaccctc 180

cccttcctct gggggagtcg ttttacccgc cgccggccgg gcctcgtcgt ctgattggct 240

ctcggggccc agaaaactgg cccttgccat tggctcgtgt tcgtgcaagt tgagtccatc 300

cgccggccag cgggggcggc gaggaggcgc tcccaggttc cggccctccc ctcggccccg 360

cgccgcagag tctggccgcg cgcccctgcg caacgtggca ggaagcgcgc gctgggggcg 420

gggacgggca gtagggctga gcggctgcgg ggcgggtgca agcacgtttc cgacttgagt 480

tgcctcaaga ggggcgtgct gagccagacc tccatcgcgc actccgggga gtggagggaa 540

ggagcgaggg ctcagttggg ctgttttgga ggcaggaagc acttgctctc ccaaagtcgc 600

tctgagttgt tatcagtaag ggagctgcag tggagtaggc ggggagaagg ccgcaccctt 660

ctccggaggg gggaggggag tgttgcaata cctttctggg agttctctgc tgcctcctgg 720

cttctgagga ccgccctggg cctgggagaa tcccttcccc ctcttccctc gtgatctgca 780

<210> 5

<211> 800

<212> DNA/RNA

<213> MRR (Artificial sequence)

<400> 5

tgggcgggag tcttctgggc aggcttaaag gctaacctgg tgtgtgggcg ttgtcctgca 60

ggggaattga acaggtgtaa aattggaggg acaagacttc ccacagattt tcggttttgt 120

cgggaagttt tttaataggg gcaaataagg aaaatgggag gataggtagt catctggggt 180

tttatgcagc aaaactacag gttattattg cttgtgatcc gcctcggagt attttccatc 240

gaggtagatt aaagacatgc tcacccgagt tttatactct cctgcttgag atccttacta 300

cagtatgaaa ttacagtgtc gcgagttaga ctatgtaagc agaattttaa tcatttttaa 360

agagcccagt acttcatatc catttctccc gctccttctg cagccttatc aaaaggtatt 420

ttagaacact cattttagcc ccattttcat ttattatact ggcttatcca acccctagac 480

agagcattgg cattttccct ttcctgatct tagaagtctg atgactcatg aaaccagaca 540

gattagttac atacaccaca aatcgaggct gtagctgggg cctcaacact gcagttcttt 600

tataactcct tagtacactt tttgttgatc ctttgccttg atccttaatt ttcagtgtct 660

atcacctctc ccgtcaggtg gtgttccaca tttgggccta ttctcagtcc agggagtttt 720

acaacaatag atgtattgag aatccaacct aaagcttaac tttccactcc catgaatgcc 780

tctctccttt ttctccattt 800

<210> 6

<211> 20

<212> DNA/RNA

<213> MRL-F (Artificial sequence)

<400> 6

caaagccccc agggatgtaa 20

<210> 7

<211> 18

<212> DNA/RNA

<213> MRL-R (Artificial sequence)

<400> 7

cgcccattga tgtactgc 18

<210> 8

<211> 23

<212> DNA/RNA

<213> MRR-F (Artificial sequence)

<400> 8

ctgcattcta gttgtggttt gtc 23

<210> 9

<211> 18

<212> DNA/RNA

<213> MRR-R (Artificial sequence)

<400> 9

tgtcgccggt attgttcg 18

<210> 10

<211> 20

<212> DNA/RNA

<213> CD2v-qF (Artificial sequence)

<400> 10

atgcgtccct caacacaacc 20

<210> 11

<211> 21

<212> DNA/RNA

<213> CD2v-qR (Artificial sequence)

<400> 11

gggatattgg gtagtagcgg g 21

Claims

1. A CHO cell line for stably expressing African swine fever CD2v protein is a Chinese hamster ovary cell CHO-CD2v, which is sent to Guangdong province microorganism culture collection center for preservation 11/2021, and the preservation number is GDMCC No. 62052.

2. The method for preparing the CHO cell line stably expressing African swine fever CD2v protein of claim 1, comprising the steps of:

s1, connecting the target gene CD2v to a DC-SH02 carrier to construct a DC-SH02-CD2v recombinant plasmid;

3. The method for preparing a CHO cell line stably expressing African swine fever CD2v protein according to claim 2, wherein in step S1, the target gene is obtained by using pMD18-CD2v plasmid as a template and amplifying by using primers CD2v-F and CD2v-R, the nucleotide sequence of the CD2v-F is shown in SEQ ID NO.1, and the nucleotide sequence of the CD2v-R is shown in SEQ ID NO. 2.

4. The method of claim 2, wherein in step S2, the CD2v gene of interest is introduced into the genome of Chinese hamster at a safe site by recombinant plasmid DC-SH02-CD2 v.

5. The method for preparing the CHO cell line stably expressing African swine fever CD2v protein according to claim 4, wherein the safety site is ROSA26 safety site in step S2.

6. The method for preparing the CHO cell line stably expressing African swine fever CD2v protein according to claim 2, wherein the DC-SH02 vector comprises a CMV promoter sequence and a ROSA26 safety site recombination arm in step S1.

7. The method for preparing the CHO cell line stably expressing African swine fever CD2v protein according to claim 6, wherein the DC-SH02 vector further comprises a PolyA signal sequence and a puromycin resistance gene sequence.

8. The method of claim 2, wherein the puromycin screening step is carried out by culturing the transfected cells in a puromycin-containing medium at a concentration of 7 μ g/mL in the culture medium, and selecting single cell colonies, wherein the puromycin screening step is carried out in step S3.

9. Use of the CHO cell line stably expressing african swine fever CD2v protein according to claim 1 for preparing CD2v protein.

10. Use of the CHO cell line stably expressing African swine fever CD2v protein according to claim 1 for drug effect screening and/or vaccine production of African swine fever.