Detailed Description
The present invention will be further described with reference to the accompanying drawings and examples, which are only for illustrating the technical solutions of the present invention and are not to be construed as limiting the present invention.
The strains, plasmids and reagents used in the examples of the present invention are all commercially available products.
The sources of the reagent and the medicine of the invention are listed as follows:
the CHO-K1 cells are derived from cell banks of China academy of sciences type culture Collection cell banks, shanghai Life sciences research institute of China academy of sciences;
cell culture medium and serum were purchased from gibco, usa;
the eukaryotic expression vector pEE12.4 is purchased from Shanghai Linyuan Biotech, inc.;
lipofectamine LTX was purchased from Thermo Fisher, USA;
methionine sulfoxide ammonium sulfite (MSX) was purchased from Sigma;
BCA protein quantification kit was purchased from Thermo Fisher, USA.
Example 1gB protein expression and preparation
1.1 selection of porcine pseudorabies gB protein
The porcine pseudorabies virus surface glycoprotein gB is a segment of polypeptide coded by UL27 gene, amino acids 1-800 are predicted to be the extracellular region of gB protein, a transmembrane region is arranged at amino acids 801-821, and amino acids 822-916 are the intracellular regions. The extracellular domain of the gB protein has stable structure and good immunogenicity, and is the main antigen for producing gB subunit vaccines. At present, the protein can be expressed and purified in a large scale in a mammalian system, which is an important technical problem to be solved by the invention.
1.2 codon optimization of gB protein of porcine pseudorabies virus
The gB protein is the most conserved protein on the surface of the porcine pseudorabies virus, the homology is high, the classical strain Bartha strain (GenBank: JF 797217.1) is taken as a template in the laboratory, the gB gene is optimally synthesized, the gB expression vector is constructed, and the gB protein is expressed and purified. Therefore, gB proteins from other strains can also be prepared by this method. Combining the experience of the previous research on the envelope protein of the expressed virus, through the research on the protein structure prediction and the structure of the amino acid, the partial sequence of the N-terminal extracellular region and the C-terminal transmembrane region and intracellular region which are not beneficial to recombinant expression are removed, and the extracellular region with stable structure of the porcine pseudorabies virus protein is selected as the immunogenic protein, namely the amino acid of 41V-754N. Since the amino acids encoded by the start codon of eukaryotes are all methionine (M), we add one methionine (M) before 41V in designing expression, i.e., designing the amino acid sequence of the recombinant expression gB protein 40M-754N. In order to facilitate the better stable and efficient expression of the porcine pseudorabies virus gB gene in a CHO system, the nucleotide sequence for coding the gB protein is subjected to codon optimization as shown in SEQ ID NO.2 to obtain an OPTI-gB sequence as shown in SEQ ID NO.1, and the sequence synthesis work is entrusted to Nanjing Kinsry Biotechnology Co., ltd. As shown in FIG. 2, the nucleotide sequences differed by 19.3% before and after the optimization.
Example 2: construction of pEE12.4-OPTI-gB recombinant plasmid
2.1PCR amplification of the fragment of interest OPTI-gB
2.1.1PCR reaction
(1) Primer design and Synthesis
Upstream primer of 5' cgaagCTTGCCGCCACCATGGCTC-3
Downstream primer of 5' cgAATTCTCAATGGTGATGGGTGATGGTGATTATGATCCACCTT-3
(2) Sample loading system 50 μ L, as shown in the following table:
PCR amplification procedure:
2.1.2PCR products for gel recovery
(1) Marking a sample collection EP tube, an adsorption column and a collection tube;
(2) Weighing the weight of the marked empty EP pipe, and recording the numerical value;
(3) A single DNA band of interest was carefully excised from the agarose gel on a gel cutter with a scalpel and placed into a clean 1.5mL centrifuge tube;
(4) Adding 600 mu L of PC buffer into the 1.5mL centrifuge tube in the step (3), placing in a water bath at 50 ℃ for about 5min, and turning the centrifuge tube up and down continuously and gently to ensure that the gel block is fully dissolved;
(5) Column balancing: adding 500 μ L of balance liquid BL into adsorption column CB2 (the adsorption column is placed into the collection tube in advance), centrifuging at 12,000rpm/min for 1min, pouring off waste liquid in the collection tube, and placing the adsorption column back into the collection tube;
(6) Adding the solution obtained in the step (5) into an adsorption column CB2, standing for 2min, standing for 10,000rpm/min, centrifuging for 30s, pouring out waste liquid in a collecting pipe, and then putting the adsorption column CB2 into the collecting pipe;
(7) Adding 600 mu L of rinsing liquid PW buffer into the adsorption column, standing for 3min, centrifuging at 10,000rpm/min for 30s, pouring out waste liquid in the collecting pipe, and putting the adsorption column CB2 into the collecting pipe;
(8) Repeating the step (7);
(9) Centrifuging with air adsorption column at 12,000rpm/min for 2min, removing rinsing liquid as much as possible, standing the adsorption column at room temperature for 10min, and air drying completely;
(10) Placing adsorption column CB2 into a collecting pipe, suspending and dropwise adding 50 μ L of precipitation buffer (preheated at 65 ℃) to the middle position of an adsorption film, standing for 3min, centrifuging for 12,000rpm/min, and centrifuging for 2min;
(11) Taking out the centrifuge tube in the step (10) from the centrifuge, discarding the middle adsorption column CB2, covering the centrifuge tube with a cover, and keeping the DNA sample in the centrifuge tube;
(12) And (3) storing the DNA sample in the step 11 at 4 ℃, and preparing an agarose gel electrophoresis identification gel to recover the DNA fragment.
2.2 double digestion of PCR products and vectors
(1) The 1.5mL EP tubes needed were labeled and loaded and mixed in the 1.5mL EP tubes according to the following table: 50 μ L reaction System
(2) And (3) placing the 1.5mL EP tube in the step (1) into a corresponding enzyme constant-temperature water bath kettle with the optimal temperature, and carrying out water bath for 2-3h.
Recovering the double enzyme digestion product glue: taking out the double enzyme digestion system, and carrying out agarose gel electrophoresis to recover the DNA fragment in the double enzyme digestion system, wherein the method is the same as that for recovering the PCR product gel in 1.2.1.
2.3 ligation reaction
(1) A plurality of clean 1.5mL EP tubes are prepared, marked and placed on an EP tube frame for standby.
(2) The sample was loaded and mixed in a 1.5mL EP tube as described in the following table.
(3) After the sample is added according to the table in the step (2), putting each 10 mu l reaction system into a low-temperature cooling liquid circulator at the temperature of 16 ℃ for water bath for 10-16h;
(4) Taking out the EP tube in the step (3), placing the EP tube in a water bath kettle at 65 ℃, and carrying out water bath for 15min;
(5) Taking out the EP tube in the step (4), and storing at 4 ℃.
2.4 conversion reaction
(1) Quickly adding 10 μ L of the ligation reaction solution into 100 μ L of competent cells, uniformly mixing by blowing, and carrying out ice bath for 30min;
(2) Taking out the sample tube, placing in water bath at 42 ℃ for 100s, and immediately carrying out ice bath for 2min;
(3) Taking out the sample tube, adding 600 mu L of liquid LB culture medium into the sample tube in a super-clean workbench, then placing the sample tube in a constant temperature shaking table at 37 ℃, and culturing for 1h at 220 rpm/min;
(4) Coating a plate: and (4) taking out the sample tube in the step (3), centrifuging at room temperature for 8,000rpm/min for 2min, removing 600 mu L of supernatant liquid, re-suspending thalli at the bottom of the tube by the residual supernatant liquid, putting the re-suspended bacterial liquid into the center of a corresponding transformation plate, and uniformly spreading the bacterial liquid in the center of the transformation plate by using a bacteria coating rod.
(5) The flat plate in the transformation step (4) is placed in a biochemical constant-temperature incubator, and is cultured for 1h at 37 ℃, and then the transformation flat plate is inverted and cultured for 15h;
(6) The transformation results were observed.
2.5 plasmid extraction and double digestion identification
2.5.1 plasmid extraction
(1) Picking the monoclonal from the transformation plate by using a 10 mu L pipette tip into 5mL LB liquid culture medium containing benzyl amine resistance, shaking the bacteria at 37 ℃ and 220rpm/min overnight;
(2) Transferring the bacterial liquid into a 1.5mL EP tube, centrifuging at room temperature for 2min at 12,000rpm, and discarding the supernatant;
(3) Adding 250 mu L of plasmid extraction reagent P1buffer into the EP tube in the step (2) to completely suspend the thalli;
(4) Adding 250 mu L of P2buffer into the solution in the step (3), immediately and gently inverting the centrifuge tube for 5-10 times, uniformly mixing, and standing at room temperature for 2-4min;
(5) Adding 350 mu L of P3buffer into the solution in the step (4), immediately and gently reversing the centrifuge tube for 5-10 times, and uniformly mixing; standing at room temperature for 2-4min;
(6) Centrifuging the solution in the step (5) at room temperature for 10min at 14,000rpm;
(7) Transferring the supernatant solution in the step (6) to the center of an adsorption column, centrifuging at room temperature for 12,000rpm/min for 30s, and pouring out liquid in a collecting pipe;
(8) Adding 500 μ L Buffer DW1 into the center of the adsorption column, centrifuging at room temperature for 12,000rpm/min for 30s, and pouring out the liquid in the collection tube;
(9) Adding 500 mu L wash solution into the center of the adsorption column, centrifuging at room temperature for 12,000rpm/min for 30s, pouring out liquid in the collection tube, and repeating the steps once;
(10) Empty adsorption column, centrifuge at room temperature, 12,000rpm,2min.
(11) The adsorption column was placed in a clean 1.5mL centrifuge tube, 30. Mu.L of Elutionbuffer was added to the center of the adsorption membrane, allowed to stand at room temperature for 5min, centrifuged at room temperature, 12,000rpm,2min. The DNA solution in the tube was stored.
2.5.2 double restriction enzyme identification
(1) The 1.5mL EP tubes were labeled for use and loaded as follows: 20 μ L reaction System
(2) And (2) putting the EP tube 20 mu L of reaction system in the step (1) into a constant-temperature water bath kettle at 37 ℃ for water bath for 2h.
(3) Carrying out agarose gel electrophoresis on the double enzyme digestion system sample in the step (2), and checking whether the size of the inserted fragment is correct; the results of the experiment are shown in FIG. 2: the enzyme digestion identification construction is correct.
(4) Clones with correct inserts were selected for sequencing by the sequencing company. And (4) storing the plasmid with the correct sequencing result for later use.
Example 3: establishment of pEE12.4-OPTI-gB recombinant plasmid transfection CHO-K1 cell and monoclonal screening
3.1CHO-K1 cell transfection
(1) Preparing: sterilizing the biological safety cabinet for 30min by ultraviolet; DMEM/F12 (containing 10% serum and 1% double antibody), DMEM/F12 and PBS were preheated to 37 ℃ in a 37 ℃ water bath.
(2) The cells (10 cm cell culture dish) were removed from the 37 ℃ incubator, the supernatant medium was discarded, the cells were washed once with pre-warmed 8mL PBS, and the PBS was discarded.
(3) Adding 0.25% of trypsin-EDTA per 10cm cell culture dish, digesting at room temperature for about 2min, observing under microscope that the cells shrink and become round and present as single cells.
(4) The digestion reaction was stopped by adding 4mL of DMEM/F12 (10% serum, 1% double antibody) and the cells were pipetted off.
(5) The digested cells were transferred to a 15mL centrifuge tube and centrifuged at room temperature for 200g,5min.
(6) The cells were resuspended in DMEM/F12 (10% serum, 1% double antibody) and counted.
(7) Dilute cells to 2 × 10 5 cell/mL, 2mL of the mixed cells were added to a six-well plate, the six-well plate was set to 37 ℃,5% 2 Incubate overnight in a cell incubator.
(8) Taking out the cell culture dish in the step (7), and observing the cell state: transfection was initiated when cell confluence reached 80% -90%, and the medium was changed to antibiotic-free and serum-free DMEM/F12,2 mL/well before transfection.
(9) Plasmid dilution: the plasmid was diluted with OPTI-MEM, and 2.5. Mu.g of the plasmid was added to 125. Mu.L of OPTI-MEM, followed by 2.5. Mu.L of plus, followed by mixing, and the mixture was allowed to stand at room temperature for 5min.
(10) Dilution of Lipofectamine LTX: mu.L of OPTI-MEM was added with 9. Mu.L of Lipofectamine LTX, followed by 2.5. Mu.L of plus, gently mixed, and allowed to stand at room temperature for 5min.
(11) And (4) lightly mixing the mixture obtained in the step (10) and the step (11). Standing at room temperature for 5min, and then dropwise adding into a six-hole plate for uniform distribution.
(12) Placing the six well plates at 37 ℃ 5% CO 2 Culturing in a cell culture box for 4-6h.
(13) Liquid changing: the supernatant medium was discarded, 2mL of DMEM/F12 (containing 10% serum and 1% double antibody) was added, and the six-well plate was set at 37℃,5%CO 2 Culturing in a cell culture box.
3.2 pressure screening
Pressurization was started 24h after transfection: the six-well plate cells were removed from the 37 ℃ incubator, the supernatant medium was discarded, 2mL of DMEM/F12 (containing 10% serum + 25. Mu.M MSX) was added, the pressure was increased for 7days, the cells were observed in the middle, and the dead cells were changed.
3.3 monoclonal screening
(1) The monoclonal selection was initiated at approximately 7days when the negative control cells were essentially dead by pressure selection.
(2) The six well plate was removed, the medium was discarded, PBS was washed once, then 300. Mu.L of 0.25% trypsin-EDTA was added, the mixture was digested at room temperature for about 2min, 2mL of DMEM/F12 (containing 10% serum + 25. Mu.M MSX) was added to terminate the digestion reaction, and the cells were blown off by a pipette.
(3) The digested cells were transferred to a 15mL centrifuge tube and centrifuged at room temperature for 200g,5min.
(4) Cells were resuspended in DMEM/F12 (containing 10% serum + 25. Mu.M MSX) and counted.
(5) Plate paving: diluting the cells to 5/mL, adding 200. Mu.L of the mixed cells to a 96-well plate, standing to 37 ℃,5% 2 And incubating for 4-6h in the cell incubator.
(6) Wells of individual cells were recorded.
(7) When the wells of the individual cells in the 96-well plate were grown up, the medium was discarded, PBS was washed once, 100. Mu.L of 0.25% trypsin-EDTA was added, digestion was carried out at room temperature for about 2min, digestion was terminated by adding 2mL of DMEM/F12 (containing 10% serum + 25. Mu.M MSX), and the cells were blown off by a pipette. And transferring the cell sap to a 12-pore plate, taking the supernatant when the 12-pore plate is full, detecting whether the clone is positive by dot-blot, and continuously performing amplification culture and freezing storage on the high-efficiency expression positive clone.
Example 4: CHO-K1 cell strain domesticated into suspension culture
(1) Preparing: sterilizing the biological safety cabinet for 30min by ultraviolet; DMEM/F12 (containing 10% serum, 25. Mu.M MSX) was preheated to 37 ℃ in a 37 ℃ water bath.
(2) The cells (10 cm cell culture dish) were removed from the 37 ℃ incubator, the supernatant medium was discarded, the cells were washed once with pre-warmed 8mL PBS, and the PBS was discarded.
(3) Adding 0.25% of trypsin-EDTA per 10cm cell culture dish, digesting at room temperature for about 2min, observing under microscope that the cells shrink and become round and present as single cells.
(4) Digestion was stopped by adding 4mL of DMEM/F12 (containing 10% serum, 25. Mu.M MSX) and the cells were blown off with a pipette.
(5) The digested cells were transferred to a 15mL centrifuge tube and centrifuged at room temperature for 200g,5min.
(6) Cells were suspended in 100% DMEM/F12 (containing 10% serum, 25. Mu.M MSX) and counted.
(7) Dilute cells to 5 × 10 5 One cell/mL was inoculated into a 30mL culture medium in a 125mL shake flask. The cell culture flask was left at 37 ℃ and 5% CO 2 Incubate overnight on an orbital shaker in a cell incubator at 120 rpm/min.
(8) Wiping the biological safety cabinet table top with 75% alcohol for sterilization, and irradiating with ultraviolet for 30min.
(9) Cell density and viability were counted every 24 h.
(10) And performing second-generation culture when the cell survival rate reaches 94-97% after the first-generation cell culture is performed once.
(11) Preparing: sterilizing the biological safety cabinet for 30min by ultraviolet; 100% DMEM/F12 (containing 10% serum, 25. Mu.M MSX), EX-CELL 302 in CO 2 The cell incubator was preheated to 37 ℃.
(12) The cells were removed from the 37 ℃ incubator, transferred to a 50mL centrifuge tube, and centrifuged at 200g for 5min at room temperature.
(13) DMEM/F12 (containing 10% serum, 25. Mu.M MSX) and EX-CELL 302 were mixed as 1:1 mixing, resuspending the cells, and counting.
(14) Dilute cells to 5 × 10 5 cells/mL were inoculated in 30mL culture medium in a 125mL shake flask. Placing the cell culture flask at 37 deg.C, 5% 2 Incubate overnight on an orbital shaker in a cell incubator at 120 rpm/min.
(15) Wiping the biological safety cabinet table top with 75% alcohol for sterilization, and irradiating with ultraviolet for 30min.
(16) Cell density and viability were counted every 24 h.
(17) The survival rate of the cells obtained after the second-generation culture is more than 95 percent; the cell survival rate obtained after three times of culture of the third generation to the sixth generation is more than 95 percent. After 7 weeks, the cells were seeded for 3 days and propagated for three generations with a density of 1X 10 6 Individual cells/mL with a cell viability of 95%, which cells are considered to have been adapted to suspension culture. The inoculation density is reduced to 3 x 10 5 one/mL.
(18) After domestication, the monoclonal cell strains of 32E2, 37A4, 39A12, 40B10, 4C2 and 6A3 all meet the requirements, which indicates successful domestication.
Example 5: cell shake flask fermentation
(1) Preparation of a subculture medium: 60% CD-CHO +40% Ex-cell 302 was preheated to 37 ℃ in a 37 ℃ water bath.
(2) From CO 2 Taking out the shake flask cells by a constant temperature shaking table, and counting.
(3) The 32E2 and 40B10 cells obtained in example 4 were diluted to 2.5-3.5X 10 5 One cell/mL was inoculated into a 30mL culture medium in a 125mL shake flask. The cell culture flask was left at 37 ℃ and 5% CO 2 Incubate overnight in a constant temperature shaker at 100 rpm/min.
(4) Counting the cell density and the cell activity every 24 hours, measuring glucose, and adding the glucose to 4g/L when the blood sugar is lower than 2 g/L; 1mL of sample was taken daily and the supernatant was used to examine protein expression.
(5) Feeding (about day four): 70g/L CB5 was supplemented, and 10% of the basal medium was added.
(6) Beginning on day 5, CO was added 2 The incubator temperature was adjusted to 32 ℃.
(7) On day nine, 70g/L CB5 was supplemented and 10% of the basal medium was added.
(8) On the fourteenth day, cell supernatants were harvested.
Example 6 construction and acclimatization of recombinant CHO-S cell line stably expressing gB protein
The present inventors also easily constructed a stable cell line expressing recombinant gB protein according to the procedures of examples 1-5, and thus, it is expected that a stable cell line expressing recombinant gB protein can be easily constructed using the method for a commonly-used engineered mammalian cell line, thereby producing the protein on a large scale. Therefore, the present invention is also within the scope of protection.
Example 7: protein purification
The cell culture solution of example 5 (about 100mL per batch) was collected, centrifuged at 4 ℃ for 30min at 8,000g, the supernatant was filtered through a 0.8 μm filter, and 80 μ L of the supernatant was added to 20 μ L of 5 XSDS-sample buffer for SDS-PAGE detection.
Column balancing: balancing 2-3 CV (column volume) with ultrapure water, and discharging ethanol preservation solution; then using BufferA (20 mM NaH) 2 PO 4 (pH 7.4), 500mM NaCl) was equilibrated at 2 to 3CV,4 to 7mL/min.
Loading: if one is used for 5mL pre-packed columns, loading is carried out at 1mL/min (the loading Flow rate is adjusted according to the volume of the pre-packed column, the retention time is 5 min), flow Through (FT) is collected, and 80. Mu.L of sample is added to 20. Mu.L of 5 XSDS-sample buffer for SDS-PAGE detection.
Washing: by 4% of bufferb (20 mM NaH) 2 PO 4 (pH 7.4), 500mM NaCl,20mM imidazole) washing the column at the flow rate of 4mL/min, and washing proteins which are not combined with the column and hybrid proteins with weak combination capacity to be clean until OD280nm base line is stable.
And (3) elution: 50% of buffer B (20 mM NaH) 2 PO 4 (pH 7.4), 500mM NaCl,250mM imidazole) to baseline flush, 2mL/min, collect: 10 mL/tube; after sample mixing (Elutethregh-ET), 80. Mu.L of the sample was added to 20. Mu.L of 5 XSDS-sample buffer for SDS-PAGE detection.
Washing: 100% buffer B (20mM NaH2PO4 (pH 7.4), 500mM NaCl,500mM imidazole), 4mL/min, no collection, 2-3 column volumes washed, until UV baseline wash-out. The ultrapure water is balanced for 2 to 3CV. HisTrap excel columns can be stored with 2-3 CV equilibrium using 20% ethanol storage solution.
And (3) dialysis liquid change: the imidazole eluate containing the target protein was poured into a dialysis bag, dialyzed with 1 XPBS for at least 1,000 times, and 80. Mu.l of the eluate was detected.
And (3) degerming and filtering: in a biosafety cabinet, a 0.22 μm low protein binding needle filter, or Nalgene filter with a 0.22 μm filter sterilized with a large volume of protein solution, was passed through and the filtered protein solution sample was stored in a freezer at-80 ℃.
Protein concentration determination: protein concentration is measured by adopting a BCA method, the protein concentration of the batch is respectively 1.6mg/mL and 2.4mg/mL, and the volume is about 50mL; by calculation (protein yield = protein concentration protein volume/volume of fermentation supernatant taken), the 32E2 and 40B10 strains each had a protein yield of about 0.8-1.2g/L.
Example 8: identification of gB proteins
8.1SDS-PAGE electrophoretic detection
The protein purified in example 6 was subjected to SDS-PAGE, and the gB protein concentration in the sample was 2. Mu.g/well, and the results are shown in FIG. 4: from the figure, it can be calculated that the purified gB protein has an SDS-PAGE purity of 94% and the glycosylated protein has a molecular weight of about 130kD.
8.2Western-blot detection
The purified protein of example 6 was subjected to western-blot assay with a membrane transfer time of 1h, the antibody used was the positive serum of a swine inoculated with pseudorabies attenuated vaccine, the dilution ratio was 1: as can be seen from the results in the figure, the purified gB protein was able to bind to the antibody efficiently.
8.3ELISA detection
(1) Coating: diluting purified gB protein to 0.5 μ g/ml with coating solution (50 mM carbonate buffer, pH 9.5), coating each antigen with 8 wells (4 wells plus PRV positive serum sample, 4 wells plus PRV negative serum as control), adding each antigen with 100 μ l/well, sealing with sealing film, and standing in refrigerator at 4 deg.C overnight;
(2) Washing: after the ELISA plate was removed from the refrigerator, the plate was washed 5 times with PBST;
(3) And (3) sealing: adding 200 μ l of sealing liquid (5% skimmed milk) into each well, sealing with sealing film, and incubating at 37 deg.C for 2 hr;
(4) Serum dilution: diluting the positive serum (14 days after immunization) of PRV (porcine PRV) attenuated vaccine immunized pig by 500 times with blocking solution (such as adding 1 μ l serum into 499 μ l diluent, mixing uniformly), and diluting the negative serum by 500 times;
(5) Washing: the same (2);
(6) Sample adding: adding diluted positive serum and negative serum, and incubating at 37 deg.C for 1h;
(7) Washing: the same as (2);
(8) Adding a secondary antibody: mu.l of a diluted (dilution ratio of 1 to 5000) HRP-labeled rabbit anti-pig IgG secondary antibody was added to each well, and incubated at 37 ℃ for 0.5h;
(9) Washing: the same (2);
(10) Color development: adding 100 mul of TMB color development solution into each hole under the condition of keeping out of the sun, and incubating for 10min at 37 ℃;
(11) And (4) terminating: add 50. Mu.l of stop solution (2M H) to each well 2 SO 4 ) Terminating the reaction;
(12) And (3) detection: measuring OD value of the sample at the wavelength of 450nm, and analyzing data;
(13) The results are shown in the following table: the coated gB protein can be specifically combined with positive serum, and the OD450 mean value is 1.867; neither the coated gB protein specifically bound to negative sera, with an OD450 mean of 0.171. The gB protein can be used as an antigen of an Elisa kit, and a diagnostic kit for detecting the infection and the immunity of the porcine pseudorabies virus can be developed after the appropriate coating concentration and serum dilution ratio are searched.
Example 9 preparation of a gB subunit vaccine
9.1 vaccine preparation
Preparing a water phase: according to the gB protein content in the vaccine, PBS (or normal saline) is used for diluting gB protein to proper concentration, and the gB protein is water phase;
preparing an oil phase: according to the total amount of the prepared vaccine, a proper amount of ISA 201VG adjuvant is measured according to the following weight ratio of an antigen phase to the adjuvant of 1 and the volume ratio of 46;
emulsification: preheating the water phase and oil phase to 33 deg.C, slowly adding the water phase into the oil phase, stirring at 200-500rpm for 20-30min, standing at 20 deg.C for 1h, and standing at 4 deg.C overnight;
subpackaging and storing: subpackaging as required, and storing at 4 deg.C for use after qualified inspection.
9.2 vaccine detection
Physical properties are observed by adopting an eye-watching method to see whether the emulsion is milky white emulsion or not;
sucking a small amount of vaccine by using a clean straw and dripping the vaccine into cold water, observing (except for the 1 st drop), wherein the vaccine is dispersed in a cloud form and is judged to be a water-in-oil-in-water dosage form;
adding 10mL of vaccine into a centrifuge tube, centrifuging for 15min at 3000r/min, and judging the vaccine to be stable if the water separated out from the tube bottom is less than or equal to 0.5 mL;
and (4) performing viscosity detection on the vaccine by using a viscometer, wherein the viscosity detection is required to be within 20-50cp, and the vaccine is judged to be qualified.
9.3gB subunit vaccine for mouse safety experiment
A safety experiment was performed by randomly dividing 16 healthy SPF female mice (purchased from Zhejiang university of traditional Chinese medicine) into 4 groups of 4 mice each, and performing the following procedure.
Single dose one-time immunization group: each group was inoculated with 100. Mu.L (30. Mu.g/mouse) of 4 mice intramuscularly, and observed for 2 weeks continuously.
Single dose secondary immunization group: each group was inoculated with 100. Mu.L (30. Mu.g/mouse) of 4 mice intramuscularly and continuously observed for 2 weeks. After 2 weeks, the cells were inoculated again at the same dose and observed for 2 weeks.
Overdose one-time immunization group: each group was inoculated intramuscularly with 100. Mu.L (300. Mu.g/mouse, 10-fold normal immunization dose) of 4 mice per group, and observed for 2 weeks.
Control group: each group was inoculated intramuscularly with 100. Mu.L of 4 mice (vaccine in PBS) and observed for 2 weeks. During the experiment, the animal's spirit, clinical changes such as feeding, activity, drinking, inflammation change of injection site and excretion condition were observed every day, and abnormal conditions of the animal were recorded.
Through continuous observation, clinical symptoms of mice injected with gB protein are compared, and a single dose, a secondary immunization dose, an overdose immunization group and a control group are normal in diet, free of adverse changes in spirit and normal in excretion, free of inflammation at an injection part, free of dead mice and free of any adverse reaction of inoculated animals. The vaccine protein prepared by the invention has no obvious side effect even if injected at high dose (300 mu g), and is a safe immune protein.
The invention is illustrated by the above examples, but it should be understood that the invention is not limited to the particular examples and embodiments described herein. These specific examples and embodiments are included to assist those skilled in the art in practicing the present invention. Further modifications and improvements will readily occur to those skilled in the art without departing from the spirit and scope of the invention and, accordingly, it is intended that the invention be limited only by the terms of the appended claims, along with the full scope of equivalents to which such terms are entitled.
<110> Zhejiang Hilon Biotechnology Ltd
<120> construction and preparation method of porcine pseudorabies virus gB protein recombinant expression vector
<160>4
<170>PatentIn version 3.3
<210>4
<211>2145
<212>DNA
<213> codon optimized gB protein nucleotide sequence
<400>1
ATGGTGGCTCTGGCCCTGCTGCTGCTGGCTCTGGCTGCTGCTCCACCTTGCGGAGCTGCTGCTGTGACCAGGGCTGCTTCCGCCAGCCCAACACCAGTGCCTGGATCCCCAGGACTGACCCCAAACGACGTGTCCGCTGAGGCCAGCCTGGAGGAGATCGAGGCTTTCACCCCAGGACCATCTGAGGCTCCAGACGGAGAGTACGGCGACCTGGATGCTAGGACAGCCGTGCGGGCTGCTGCTACCGAGAGAGATAGGTTCTACGTGTGCCCCCCTCCATCTGGCTCCACAGTGGTGAGGCTGGAGCCTGAGCAGGCTTGTCCAGAGTACTCCCAGGGCCGGAACTTCACCGAGGGCATCGCCGTGCTGTTTAAGGAGAATATCGCCCCCCACAAGTTCAAGGCTCATATCTACTATAAGAACGTGATCGTGACCACAGTGTGGAGCGGCTCTACATACGCTGCCATCACAAATAGGTTCACCGACCGCGTGCCTGTGCCAGTGCAGGAGATCACCGACGTGATCGATAGGCGGGGCAAGTGCGTGTCCAAGGCTGAGTATGTGAGGAACAATCACAAGGTGACAGCCTTCGACCGGGATGAGAACCCCGTGGAGGTGGACCTGAGACCTAGCCGCCTGAACGCTCTGGGAACCAGGGGATGGCACACCACAAATGATACCCATACAAAGATCGGCGCTGCCGGCTTTTACCATACCGGCACAAGCGTGAATTGTATCGTGGAGGAGGTGGAGGCTAGGTCCGTGTACCCTTATGACTCTTTCGCCCTGTCCACCGGCGATATCGTGTACATGAGCCCCTTCTACGGACTGAGAGAGGGAGCTCACGGAGAGCATATCGGATATGCTCCAGGCCGCTTCCAGCAGGTGGAGCACTACTATCCTATCGACCTGGATTCTAGGCTGCGGGCCTCCGAGAGCGTGACAAGGAACTTCCTGCGGACACCACACTTCACCGTGGCCTGGGACTGGGCTCCCAAGACCAGACGCGTGTGCTCCCTGGCCAAGTGGAGAGAGGCTGAGGAGATGATCAGAGACGAGACACGCGATGGCAGCTTCAGGTTTACCTCTCGGGCTCTGGGAGCCTCCTTCGTGTCCGACGTGACACAGCTGGATCTGCAGAGAGTGCACCTGGGCGACTGCGTGCTGAGGGAGGCTTCTGAGGCCATCGATGCTATCTACCAGAGGCGGTATAACAATACCCATGTGCTGGCCGGCGATAGACCAGAGGTGTACCTGGCTAGGGGAGGATTCGTGGTGGCTTTTCGCCCCCTGATCAGCAATGAGCTGGCCCAGCTGTATGCTAGAGAGCTGGAGCGCCTGGGACTGGCTGGAGTGGTGGGACCAGCTTCTCCTGCTGCTGCTAGAAGGGCTAGGAGGGCTGCTGGACAGGCTGGAACACCTGAGCCACCTGCTGTGAACGGAACCGGACACCTGAGAATCACCACAGGATCCGCCGAGTTCGCTAGGCTGCAGTTTACCTACGACCACATCCAGGCCCATGTGAATGATATGCTGGGAAGGATCGCTGCTGCTTGGTGCGAGCTGCAGAACAAGGACAGGACACTGTGGAGCGAGATGTCTCGGCTGAATCCATCCGCCGTGGCTACCGCTGCCCTGGGACAGAGGGTGTCTGCTCGGATGCTGGGCGATGTGATGGCCATCTCCAGATGCGTGGAGGTGCGCGGAGGCGTGTACGTGCAGAACTCCATGAGGGTGCCTGGAGAGAGGGGAACATGTTATAGCAGACCACTGGTGACATTCGAGCACAACGGAACCGGCGTGATCGAGGGACAGCTGGGCGACGATAATGAGCTGCTGATCTCCCGCGACCTGATCGAGCCTTGTACCGGCAACCATAGACGCTACTTTAAGCTGGGCTCCGGCTACGTGTACTATGAGGATTACAGCTATGTGAGAATGGTCGAGGTGCCCGAGACCATCAGCACACGCGTGACCCTGAATCTGACCCTGCTGGAGGACAGGGAGTTCCTGCCTCTGGAGGTGTACACAAGGGAGGAGCTGGCTGACACCGGACTGCTGGATTATTCTGAGATCCAGAGGCGGAACCAGCTGCACGCCCTGAAGTTTTACGACATCGATAGGGTGGTGAAGGTGGATCATAAT
<210>4
<211>2145
<212>DNA
<213> nucleotide sequence of gB protein before codon optimization
<400>2
ATGGTCGCGCTAGCGCTGCTGCTGCTGGCGCTCGCCGCGGCCCCGCCGTGCGGCGCGGCGGCCGTGACGCGGGCCGCCTCGGCCTCGCCGACGCCCGTCCCGGGCAGCCCCGGCCTCACCCCCAACGACGTCTCCGCGGAGGCGTCCCTCGAGGAGATCGAGGCGTTCACCCCCGGCCCCTCGGAGGCCCCCGACGGCGAGTACGGCGACCTGGACGCGCGCACGGCCGTGCGCGCGGCCGCGACCGAGCGGGACCGCTTCTACGTCTGCCCGCCGCCGTCCGGCTCCACGGTGGTGCGCCTGGAGCCCGAGCAGGCCTGCCCCGAGTACTCGCAGGGGCGCAACTTCACGGAGGGGATCGCCGTGCTCTTCAAGGAGAACATCGCCCCGCACAAGTTCAAGGCCCACATCTACTACAAGAACGTCATCGTCACGACCGTGTGGTCCGGGAGCACGTACGCGGCCATCACGAACCGCTTCACGGACCGCGTGCCCGTCCCCGTGCAGGAGATCACGGACGTGATCGACCGCCGCGGCAAGTGCGTCTCCAAGGCCGAGTACGTGCGCAACAACCACAAGGTGACCGCCTTCGACCGCGACGAGAACCCCGTCGAGGTGGACCTGCGCCCCTCGCGCCTGAACGCGCTCGGCACCCGCGGCTGGCACACCACCAACGACACCCACACCAAGATCGGCGCCGCGGGCTTCTACCACACGGGCACCTCCGTCAACTGCATCGTCGAGGAGGTGGAGGCGCGCTCCGTGTACCCCTACGACTCCTTCGCCCTGTCCACGGGGGACATTGTGTACATGTCCCCCTTCTACGGCCTGCGCGAGGGGGCCCACGGGGAGCACATCGGCTACGCGCCCGGGCGCTTCCAGCAGGTGGAGCACTACTACCCCATCGACCTGGACTCGCGCCTCCGCGCCTCCGAGAGCGTGACGCGCAACTTTCTGCGCACGCCGCACTTCACGGTGGCCTGGGACTGGGCCCCCAAGACGCGGCGCGTGTGCAGCCTGGCCAAGTGGCGCGAGGCCGAGGAGATGATCCGCGACGAGACGCGCGACGGGTCCTTCCGCTTCACGTCGCGGGCCCTGGGCGCCTCCTTCGTCAGCGACGTCACGCAGCTGGACCTGCAGCGCGTGCACCTGGGCGACTGCGTCCTCCGCGAGGCCTCGGAGGCCATCGACGCCATCTACCAGCGGCGCTACAACAACACGCACGTGCTGGCCGGCGACAGGCCCGAGGTGTACCTCGCCCGCGGGGGCTTCGTGGTGGCCTTCCGCCCGCTGATCTCGAACGAGCTGGCGCAGCTGTACGCGCGCGAGCTCGAGCGCCTCGGCCTCGCCGGCGTCGTGGGCCCCGCGTCCCCCGCGGCGGCCCGGCGGGCCCGGCGCGCCGCCGGACAGGCGGGGACGCCCGAGCCGCCGGCCGTCAACGGCACGGGGCACCTGCGCATCACCACGGGCTCGGCGGAGTTTGCGCGCCTGCAGTTCACCTACGACCACATCCAGGCGCACGTGAACGACATGCTGGGCCGCATCGCGGCCGCCTGGTGCGAGCTGCAGAACAAGGACCGCACCCTGTGGAGCGAGATGTCGCGCCTGAACCCCAGCGCCGTGGCCACGGCCGCGCTCGGCCAGCGCGTCTCGGCGCGCATGCTCGGCGACGTGATGGCCATCTCGCGGTGCGTGGAGGTGCGCGGCGGCGTGTACGTGCAGAACTCCATGCGCGTGCCCGGCGAGCGCGGCACGTGCTACAGCCGCCCGCTGGTCACCTTCGAGCACAACGGCACGGGCGTGATCGAGGGCCAGCTCGGCGACGACAACGAGCTCCTCATCTCGCGCGACCTCATCGAGCCCTGCACCGGCAACCACCGGCGCTACTTTAAGCTGGGGAGCGGGTACGTGTACTACGAGGACTACAGCTACGTGCGCATGGTGGAGGTGCCCGAGACGATCAGCACGCGGGTGACCCTGAACCTGACGCTGCTGGAGGACCGCGAGTTCCTGCCCCTCGAGGTGTACACGCGCGAGGAGCTCGCCGACACGGGCCTCCTGGACTACAGCGAGATCCAGCGCCGCAACCAGCTGCACGCGCTCAAGTTCTACGACATCGACCGCGTGGTCAAGGTGGACCACAAC
<210>4
<211>715
<212>PRT
<213> amino acid sequence of gB protein
<400>3
MVALALLLLALAAAPPCGAAAVTRAASASPTPVPGSPGLTPNDVSAEASLEEIEAFTPGPSEAPDGEYGDLDARTAVRAAATERDRFYVCPPPSGSTVVRLEPEQACPEYSQGRNFTEGIAVLFKENIAPHKFKAHIYYKNVIVTTVWSGSTYAAITNRFTDRVPVPVQEITDVIDRRGKCVSKAEYVRNNHKVTAFDRDENPVEVDLRPSRLNALGTRGWHTTNDTHTKIGAAGFYHTGTSVNCIVEEVEARSVYPYDSFALSTGDIVYMSPFYGLREGAHGEHIGYAPGRFQQVEHYYPIDLDSRLRASESVTRNFLRTPHFTVAWDWAPKTRRVCSLAKWREAEEMIRDETRDGSFRFTSRALGASFVSDVTQLDLQRVHLGDCVLREASEAIDAIYQRRYNNTHVLAGDRPEVYLARGGFVVAFRPLISNELAQLYARELERLGLAGVVGPASPAAARRARRAAGQAGTPEPPAVNGTGHLRITTGSAEFARLQFTYDHIQAHVNDMLGRIAAAWCELQNKDRTLWSEMSRLNPSAVATAALGQRVSARMLGDVMAISRCVEVRGGVYVQNSMRVPGERGTCYSRPLVTFEHNGTGVIEGQLGDDNELLISRDLIEPCTGNHRRYFKLGSGYVYYEDYSYVRMVEVPETISTRVTLNLTLLEDREFLPLEVYTREELADTGLLDYSEIQRRNQLHALKFYDIDRVVKVDHN
Sequence listing
<110> Zhejiang Hailong Biotechnology Ltd
<120> gB subunit recombinant protein of porcine pseudorabies virus, and preparation method and application thereof
<160> 4
<170> PatentIn version 3.3
<210> 4
<211> 2145
<212> DNA
<213> codon-optimized nucleotide sequence (DNA) of gB protein
<400> 1
ATGGTGGCTCTGGCCCTGCTGCTGCTGGCTCTGGCTGCTGCTCCACCTTGCGGAGCTGCTGCTGTGACCAGGGCTGCTTCCGCCAGCCCAACACCAGTGCCTGGATCCCCAGGACTGACCCCAAACGACGTGTCCGCTGAGGCCAGCCTGGAGGAGATCGAGGCTTTCACCCCAGGACCATCTGAGGCTCCAGACGGAGAGTACGGCGACCTGGATGCTAGGACAGCCGTGCGGGCTGCTGCTACCGAGAGAGATAGGTTCTACGTGTGCCCCCCTCCATCTGGCTCCACAGTGGTGAGGCTGGAGCCTGAGCAGGCTTGTCCAGAGTACTCCCAGGGCCGGAACTTCACCGAGGGCATCGCCGTGCTGTTTAAGGAGAATATCGCCCCCCACAAGTTCAAGGCTCATATCTACTATAAGAACGTGATCGTGACCACAGTGTGGAGCGGCTCTACATACGCTGCCATCACAAATAGGTTCACCGACCGCGTGCCTGTGCCAGTGCAGGAGATCACCGACGTGATCGATAGGCGGGGCAAGTGCGTGTCCAAGGCTGAGTATGTGAGGAACAATCACAAGGTGACAGCCTTCGACCGGGATGAGAACCCCGTGGAGGTGGACCTGAGACCTAGCCGCCTGAACGCTCTGGGAACCAGGGGATGGCACACCACAAATGATACCCATACAAAGATCGGCGCTGCCGGCTTTTACCATACCGGCACAAGCGTGAATTGTATCGTGGAGGAGGTGGAGGCTAGGTCCGTGTACCCTTATGACTCTTTCGCCCTGTCCACCGGCGATATCGTGTACATGAGCCCCTTCTACGGACTGAGAGAGGGAGCTCACGGAGAGCATATCGGATATGCTCCAGGCCGCTTCCAGCAGGTGGAGCACTACTATCCTATCGACCTGGATTCTAGGCTGCGGGCCTCCGAGAGCGTGACAAGGAACTTCCTGCGGACACCACACTTCACCGTGGCCTGGGACTGGGCTCCCAAGACCAGACGCGTGTGCTCCCTGGCCAAGTGGAGAGAGGCTGAGGAGATGATCAGAGACGAGACACGCGATGGCAGCTTCAGGTTTACCTCTCGGGCTCTGGGAGCCTCCTTCGTGTCCGACGTGACACAGCTGGATCTGCAGAGAGTGCACCTGGGCGACTGCGTGCTGAGGGAGGCTTCTGAGGCCATCGATGCTATCTACCAGAGGCGGTATAACAATACCCATGTGCTGGCCGGCGATAGACCAGAGGTGTACCTGGCTAGGGGAGGATTCGTGGTGGCTTTTCGCCCCCTGATCAGCAATGAGCTGGCCCAGCTGTATGCTAGAGAGCTGGAGCGCCTGGGACTGGCTGGAGTGGTGGGACCAGCTTCTCCTGCTGCTGCTAGAAGGGCTAGGAGGGCTGCTGGACAGGCTGGAACACCTGAGCCACCTGCTGTGAACGGAACCGGACACCTGAGAATCACCACAGGATCCGCCGAGTTCGCTAGGCTGCAGTTTACCTACGACCACATCCAGGCCCATGTGAATGATATGCTGGGAAGGATCGCTGCTGCTTGGTGCGAGCTGCAGAACAAGGACAGGACACTGTGGAGCGAGATGTCTCGGCTGAATCCATCCGCCGTGGCTACCGCTGCCCTGGGACAGAGGGTGTCTGCTCGGATGCTGGGCGATGTGATGGCCATCTCCAGATGCGTGGAGGTGCGCGGAGGCGTGTACGTGCAGAACTCCATGAGGGTGCCTGGAGAGAGGGGAACATGTTATAGCAGACCACTGGTGACATTCGAGCACAACGGAACCGGCGTGATCGAGGGACAGCTGGGCGACGATAATGAGCTGCTGATCTCCCGCGACCTGATCGAGCCTTGTACCGGCAACCATAGACGCTACTTTAAGCTGGGCTCCGGCTACGTGTACTATGAGGATTACAGCTATGTGAGAATGGTCGAGGTGCCCGAGACCATCAGCACACGCGTGACCCTGAATCTGACCCTGCTGGAGGACAGGGAGTTCCTGCCTCTGGAGGTGTACACAAGGGAGGAGCTGGCTGACACCGGACTGCTGGATTATTCTGAGATCCAGAGGCGGAACCAGCTGCACGCCCTGAAGTTTTACGACATCGATAGGGTGGTGAAGGTGGATCATAAT
<210> 4
<211> 2145
<212> DNA
<213> nucleotide sequence (DNA) of gB protein before codon optimization
<400> 2
ATGGTCGCGCTAGCGCTGCTGCTGCTGGCGCTCGCCGCGGCCCCGCCGTGCGGCGCGGCGGCCGTGACGCGGGCCGCCTCGGCCTCGCCGACGCCCGTCCCGGGCAGCCCCGGCCTCACCCCCAACGACGTCTCCGCGGAGGCGTCCCTCGAGGAGATCGAGGCGTTCACCCCCGGCCCCTCGGAGGCCCCCGACGGCGAGTACGGCGACCTGGACGCGCGCACGGCCGTGCGCGCGGCCGCGACCGAGCGGGACCGCTTCTACGTCTGCCCGCCGCCGTCCGGCTCCACGGTGGTGCGCCTGGAGCCCGAGCAGGCCTGCCCCGAGTACTCGCAGGGGCGCAACTTCACGGAGGGGATCGCCGTGCTCTTCAAGGAGAACATCGCCCCGCACAAGTTCAAGGCCCACATCTACTACAAGAACGTCATCGTCACGACCGTGTGGTCCGGGAGCACGTACGCGGCCATCACGAACCGCTTCACGGACCGCGTGCCCGTCCCCGTGCAGGAGATCACGGACGTGATCGACCGCCGCGGCAAGTGCGTCTCCAAGGCCGAGTACGTGCGCAACAACCACAAGGTGACCGCCTTCGACCGCGACGAGAACCCCGTCGAGGTGGACCTGCGCCCCTCGCGCCTGAACGCGCTCGGCACCCGCGGCTGGCACACCACCAACGACACCCACACCAAGATCGGCGCCGCGGGCTTCTACCACACGGGCACCTCCGTCAACTGCATCGTCGAGGAGGTGGAGGCGCGCTCCGTGTACCCCTACGACTCCTTCGCCCTGTCCACGGGGGACATTGTGTACATGTCCCCCTTCTACGGCCTGCGCGAGGGGGCCCACGGGGAGCACATCGGCTACGCGCCCGGGCGCTTCCAGCAGGTGGAGCACTACTACCCCATCGACCTGGACTCGCGCCTCCGCGCCTCCGAGAGCGTGACGCGCAACTTTCTGCGCACGCCGCACTTCACGGTGGCCTGGGACTGGGCCCCCAAGACGCGGCGCGTGTGCAGCCTGGCCAAGTGGCGCGAGGCCGAGGAGATGATCCGCGACGAGACGCGCGACGGGTCCTTCCGCTTCACGTCGCGGGCCCTGGGCGCCTCCTTCGTCAGCGACGTCACGCAGCTGGACCTGCAGCGCGTGCACCTGGGCGACTGCGTCCTCCGCGAGGCCTCGGAGGCCATCGACGCCATCTACCAGCGGCGCTACAACAACACGCACGTGCTGGCCGGCGACAGGCCCGAGGTGTACCTCGCCCGCGGGGGCTTCGTGGTGGCCTTCCGCCCGCTGATCTCGAACGAGCTGGCGCAGCTGTACGCGCGCGAGCTCGAGCGCCTCGGCCTCGCCGGCGTCGTGGGCCCCGCGTCCCCCGCGGCGGCCCGGCGGGCCCGGCGCGCCGCCGGACAGGCGGGGACGCCCGAGCCGCCGGCCGTCAACGGCACGGGGCACCTGCGCATCACCACGGGCTCGGCGGAGTTTGCGCGCCTGCAGTTCACCTACGACCACATCCAGGCGCACGTGAACGACATGCTGGGCCGCATCGCGGCCGCCTGGTGCGAGCTGCAGAACAAGGACCGCACCCTGTGGAGCGAGATGTCGCGCCTGAACCCCAGCGCCGTGGCCACGGCCGCGCTCGGCCAGCGCGTCTCGGCGCGCATGCTCGGCGACGTGATGGCCATCTCGCGGTGCGTGGAGGTGCGCGGCGGCGTGTACGTGCAGAACTCCATGCGCGTGCCCGGCGAGCGCGGCACGTGCTACAGCCGCCCGCTGGTCACCTTCGAGCACAACGGCACGGGCGTGATCGAGGGCCAGCTCGGCGACGACAACGAGCTCCTCATCTCGCGCGACCTCATCGAGCCCTGCACCGGCAACCACCGGCGCTACTTTAAGCTGGGGAGCGGGTACGTGTACTACGAGGACTACAGCTACGTGCGCATGGTGGAGGTGCCCGAGACGATCAGCACGCGGGTGACCCTGAACCTGACGCTGCTGGAGGACCGCGAGTTCCTGCCCCTCGAGGTGTACACGCGCGAGGAGCTCGCCGACACGGGCCTCCTGGACTACAGCGAGATCCAGCGCCGCAACCAGCTGCACGCGCTCAAGTTCTACGACATCGACCGCGTGGTCAAGGTGGACCACAAC
<210> 4
<211> 715
<212> PRT
<213> amino acid sequence (PRT) of gB protein
<400> 3
MVALALLLLALAAAPPCGAAAVTRAASASPTPVPGSPGLTPNDVSAEASLEEIEAFTPGPSEAPDGEYGDLDARTAVRAAATERDRFYVCPPPSGSTVVRLEPEQACPEYSQGRNFTEGIAVLFKENIAPHKFKAHIYYKNVIVTTVWSGSTYAAITNRFTDRVPVPVQEITDVIDRRGKCVSKAEYVRNNHKVTAFDRDENPVEVDLRPSRLNALGTRGWHTTNDTHTKIGAAGFYHTGTSVNCIVEEVEARSVYPYDSFALSTGDIVYMSPFYGLREGAHGEHIGYAPGRFQQVEHYYPIDLDSRLRASESVTRNFLRTPHFTVAWDWAPKTRRVCSLAKWREAEEMIRDETRDGSFRFTSRALGASFVSDVTQLDLQRVHLGDCVLREASEAIDAIYQRRYNNTHVLAGDRPEVYLARGGFVVAFRPLISNELAQLYARELERLGLAGVVGPASPAAARRARRAAGQAGTPEPPAVNGTGHLRITTGSAEFARLQFTYDHIQAHVNDMLGRIAAAWCELQNKDRTLWSEMSRLNPSAVATAALGQRVSARMLGDVMAISRCVEVRGGVYVQNSMRVPGERGTCYSRPLVTFEHNGTGVIEGQLGDDNELLISRDLIEPCTGNHRRYFKLGSGYVYYEDYSYVRMVEVPETISTRVTLNLTLLEDREFLPLEVYTREELADTGLLDYSEIQRRNQLHALKFYDIDRVVKVDHN