CN110317278B

CN110317278B - Fusion protein of SVV and FMDV, encoding gene, expression vector, cell line, engineering bacterium, vaccine and application thereof

Info

Publication number: CN110317278B
Application number: CN201910715145.2A
Authority: CN
Inventors: 贺笋; 程兰玲; 张伟; 李延涛; 李俊辉
Original assignee: Tecon Biological Co ltd; Tiankang Biology Shanghai Co ltd
Current assignee: Tiankang Biopharmaceutical Co ltd
Priority date: 2019-08-02
Filing date: 2019-08-02
Publication date: 2021-01-01
Anticipated expiration: 2039-08-02
Also published as: CN110317278A

Abstract

The invention relates to the technical field of biological medicine, and particularly provides a fusion protein of SVV and FMDV, and a coding gene, an expression vector, a cell line, an engineering bacterium, a vaccine and an application thereof. The fusion protein provided by the invention is obtained by replacing decoy epitopes with epitopes capable of inducing organisms to generate neutralizing antibodies, and comprises SVV VP1 protein fragments, FMDV VP1 protein fragments and complement C3d protein fragments. The fusion protein combines the antigens of two pathogens of SVV and FMDV which induce organisms to generate neutralizing antibodies, retains the antigen epitopes of SVV and FMDV and simultaneously improves the safety of the antigens. The complement C3d molecule can stimulate in vivo nonspecific humoral and cellular immune response, and has important effects in improving antibody titer of vaccine and activating cellular immune response of organism. The vaccine prepared from the fusion protein is safe and effective, and can effectively prevent the vesicular disease and the foot-and-mouth disease.

Description

Fusion protein of SVV and FMDV, encoding gene, expression vector, cell line, engineering bacterium, vaccine and application thereof

Technical Field

The invention relates to the technical field of biomedicine, in particular to fusion protein of SVV and FMDV, and a coding gene, an expression vector, a cell line, an engineering bacterium, a vaccine and application thereof.

Background

Foot-and-mouth disease (FMD), an acute, hot, highly contagious disease of artiodactyl animals caused by foot-and-mouth disease virus (FMDV). It mainly affects artiodactyls, occasionally found in humans and other animals. Clinical diagnosis is characterized by blisters on the oral mucosa, hooves and breast skin. The disease has multiple transmission ways and high speed, and has been epidemic in many times in the world, which causes huge political and economic losses. In view of this, the world animal health Organization (OIE) has listed it as the first infectious disease of class A. At present, FMD is prevalent in two-thirds of OIE member countries, and is a constant threat to livestock safety and livestock product trade in FMD-free countries and regions.

Seneca valley virus A (SVV) belongs to the family picornaviridae, the genus Seneca, and the viral genome is a single-stranded positive-stranded RNA consisting of about 7800 nucleotides. Causing blister disease in pigs and death of piglets in america, china.

Clinical symptoms of vesicular disease in pigs caused by SVV are similar to those of vesicular diseases such as foot-and-mouth disease (FMD) and are difficult to distinguish. The diagnosis and treatment of the two diseases have certain difficulties, and no good technical means can avoid infecting the two diseases at the same time, so that the design of the SVV and FMD recombinant subunit vaccine is important for the prevention and control of epidemic diseases by combining the characteristics of pathogens of the two diseases.

In view of the above, the present invention is particularly proposed.

Disclosure of Invention

The first purpose of the present invention is to provide a fusion protein of SVV and FMDV, which alleviates the technical problem of the lack of vaccine antigen that can prevent SVV and FMDV at the same time in the prior art.

The second purpose of the invention is to provide the application of the fusion protein.

The third objective of the invention is to provide a coding gene of the fusion protein, and an expression vector, a cell line and an engineering bacterium containing the coding gene, so as to provide a biological module capable of rapidly obtaining the fusion protein in large quantity.

It is a fourth object of the present invention to provide a bivalent subunit SVV and FMDV vaccine to alleviate the lack of a product in the prior art that would allow animals to immunize both SVV and FMDV simultaneously.

In order to achieve the above purpose of the present invention, the following technical solutions are adopted:

a fusion protein of SVV and FMDV comprising a fragment of SVV VP1 protein, a fragment of FMDV VP1 protein, and a fragment of complement C3d protein;

the nucleotide sequence of the SVV VP1 protein fragment is SEQ ID NO. 1;

the nucleotide sequence of the FMDV VP1 protein fragment is SEQ ID NO. 2;

the nucleotide sequence for coding the complement C3d protein fragment is SEQ ID NO. 3.

Further, the SVV VP1 protein fragment, the FMDV VP1 protein fragment and the complement C3d protein fragment are connected through a flexible amino acid Linker;

the amino acid sequence of the flexible amino acid Linker is SEQ ID NO. 6;

preferably, the nucleotide sequence for coding the flexible amino acid Linker is SEQ ID NO. 7.

Further, the fusion protein comprises the following a) or b):

a) the amino acid sequence of SEQ ID NO.5 in the sequence table;

b) the amino acid sequence derived from the SEQ ID NO.5 is obtained by substituting, deleting or adding one or more amino acid residues of the amino acid sequence of the SEQ ID NO.5, and has the same activity as the amino acid sequence of the SEQ ID NO. 5.

Further, the fusion protein is SEQ ID NO.5 in the sequence table.

The application of the fusion protein in at least one of the following A) to D):

A) preparing SVV and FMDV bivalent subunit vaccine;

B) preparing antibodies to SVV and FMDV;

C) preparing a kit for detecting SVV and FMDV;

D) SVV and FMDV diagnostic antigens are prepared.

A gene encoding the above fusion protein, the encoding gene comprising the following 1) or 2):

1) the nucleotide sequence of SEQ ID NO.4 in the sequence table;

2) a nucleotide sequence which has more than 95 percent of homology with the nucleotide sequence of SEQ ID NO.4 and encodes the same functional protein.

A cloning vector or an expression vector containing the above-mentioned coding gene;

preferably, the cloning vector comprises pMD 18-T;

preferably, the expression vector comprises pcDNA3.1.

A cell line containing the above-mentioned coding gene or expression vector;

preferably, the cell line comprises a CHO cell line.

Engineering bacteria containing the coding gene or cloning vector or expression vector;

preferably, the engineering bacteria are Escherichia coli DH5 alpha containing pMD 18-T;

preferably, the engineering bacterium is escherichia coli TOP10 containing pcDNA3.1.

An SVV and FMDV bivalent subunit vaccine, the active component comprises the fusion protein;

preferably, the SVV and FMDV bivalent subunit vaccine further comprises adjuvants including at least one of vaccine adjuvants, stabilizers, and antibiotics;

preferably, the vaccine adjuvant comprises aluminium hydroxide gel, freund's complete adjuvant, freund's incomplete adjuvant, white oil adjuvant, MF59 adjuvant or ISA206, preferably comprising ISA 206.

Compared with the prior art, the invention has the beneficial effects that:

the fusion protein of SVV and FMDV provided by the invention is obtained by replacing decoy epitopes with epitopes capable of inducing organisms to generate neutralizing antibodies, and comprises SVV VP1 protein fragments, FMDV VP1 protein fragments and complement C3d protein fragments. The fusion protein combines the antigens of two pathogens of SVV and FMDV which induce organisms to generate neutralizing antibodies, retains the antigen epitopes of SVV and FMDV and simultaneously improves the safety of the antigens. The complement C3d molecule can stimulate in vivo nonspecific humoral and cellular immune response, and has important effects in improving antibody titer of vaccine and activating cellular immune response of organism.

The invention provides the coding gene of the fusion protein, and an expression vector, a cell line and engineering bacteria with the coding gene as biological modules for expressing the fusion protein, and the biological modules can be used for rapidly obtaining a large amount of high-purity fusion protein from different layers, thereby facilitating test operation and preservation.

The SVV and FMDV bivalent subunit vaccine taking the fusion protein as an active component is good in safety and immune effect, the epidemic disease prevention and control range is expanded, labor is saved, and working efficiency is improved.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is a schematic diagram of the construction of pcDNA3.1-SVV/VP1-FMDV/VP1-C3d in example 1;

FIG. 2 shows the results of PCR identification of pcDNA3.1-SVV/VP1-FMDV/VP1-C3d in example 2, wherein M: DL2000 DNA marker; 1: a positive plasmid;

FIG. 3 shows the results of the restriction enzyme identification of pcDNA3.1-SVV/VP1-FMDV/VP1-C3d in example 3; wherein, M1: DL15000 DNA marker; m2: DL2000 DNA Marker; 1-4: and (5) carrying out enzyme digestion on the positive plasmid.

Detailed Description

Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer.

The invention provides a fusion protein of SVV and FMDV, which comprises an SVV VP1 protein fragment, an FMDV VP1 protein fragment and a complement C3d protein fragment, wherein the nucleotide sequence of the SVV VP1 protein fragment is SEQ ID NO.1, the nucleotide sequence of the FMDV VP1 protein fragment is SEQ ID NO.2, and the nucleotide sequence of the complement C3d protein fragment is SEQ ID NO. 3.

The fusion protein combines the antigens of two pathogens of SVV and FMDV which induce organisms to generate neutralizing antibodies, retains the antigen epitopes of SVV and FMDV and simultaneously improves the safety of the antigens. The complement C3d molecule can stimulate in vivo nonspecific humoral and cellular immune response, and has important effects in improving antibody titer of vaccine and activating cellular immune response of organism.

Nucleotide sequence encoding fragment of SVV VP1 protein:

atgtcagtttattctgctgatggttggtttagcctgcacaagctgactaaaattactctaccacctgactgcccacagagtccctgcattctctttttcgcctctgctggtgaggattacaccctacgtctccctgttgattgtaatccttcctacgtgttccactccaccgacaacgccgagactggggttattgaggcgggtaacactgacaccgatttctctggtgagctggcggctcctggctctaaccacactaatgtcaagttcctgtttgatcgatctcgattactgaatgtaattaaggtactggagaaggacgccgtcttcccccgtcctttccccacagcaacaggtgcacagcaggacgatggttacttttgccttctaacaccccgcccaacagtcgcttcccgacccgccactcgtttcggcctgtacgtcaatccgtctgacagtggcgttctcgctaacacttcactggatttcaatttttacagcttggcctgtttcacttactttagatcagaccttgaagtcacggtggtctcactggagccagatctggaattcgctgtagggtggttcccctctggcagtgagtaccaggcttccagctttgtctacgaccaactgcatgtgccttaccactttactgggcgcactccccgcgctttcaccagcaagggtggaaaggtatctttcgtgcttccttggaactctgtctcatccgtgcttcccgtgcgctgggggggcgcttccaagctttcttccgccacgcggggtctaccggctcatgctgactgggggaccatttacgccttcatcccccgtcctaatgagaagaaaagcaccgctgtaaagcacgtggcggtgtacgttcggtacaagaacgcgcgtgcctggtgccccagcatgctccccttccgcagctacaagcagaagatgctgatgcaatca(SEQ ID NO.1)。

nucleotide sequence encoding FMDV VP1 protein fragment:

accactactactggggagtccgcagaccctgtcaccaccaccgtggagaactacggcggtgatacacaagtccagagacgtcaccacacggacgtcggcttcattatggaccgatttgtgaagataaacagcctgagccccacacatgtcattgacctcatgcaaacccacaaacacgggatcgtgggtgcgttactgcgtgcagccacgtactacttctccgacttggagattgttgtgcggcacgatggtaatctgacctgggtgcccaacggtgcccccgaggcagccctgtcaaacaccagcaaccccactgcctacaacaaggcaccgttcacgagacttgctctcccttacactgcgccacaccgcgtgttggcaactgtgtacgacgggacaaacaagtactccgcaagcgattcgagatcaggcgacctggggtccatcgcggcgcgagtcgcgacacaacttcctgcttcctttaactacggtgcaatccaggcacaggccatccacgagcttctcgtgcgcatgaaacgggccgagctctactgtcccaggccacttctagcaataaaggtgacttcgcaagacaggtacaagcaaaagattattgcgcccgcaaaacagctgttg(SEQ ID NO.2)。

nucleotide sequence encoding complement C3d protein fragment:

accccctccggctgtggggagcagaacatgatcggcatgacgcccacagtcatcgctgtgcactacctggacagcaccgaacaatgggagaagttcggcctggagaagaggcaggaagccttggagctcatcaagaaggggtacacccagcaactggccttcagacaaaagaactcagcctttgccgccttccaggaccggctgtccagcaccctgctgacagcctatgtggtcaaggtcttcgctatggcagccaacctcatcgccatcgactcccaggtcctctgtggggccgtcaaatggctgatcctggagaagcagaagcctgatggagtcttcgaggagaatgggcccgtgatacaccaagaaatgattggtggcttcaagaacactgaggagaaagacgtgtccctgacagcctttgttctcatcgcgctgcaggaggctaaagacatctgtgaaccacaggtcaatagcctgttgcgcagcatcaataaggcaagagacttcctcgcagactactacctagaattaaaaagaccatatactgtggccattgctggttatgccctggctctatctgacaagctggatgagcccttcctcaacaaacttctgagcacagccaaagaaaggaaccgctgggaggaacctggccagaagctccacaatgtggaggccacatcctacgccctcttggctctgctggtagtcaaagactttgactctgtccctcctattgtgcgctggctcaatgagcagagatactacggaggtggctatggatctacccaggccactttcatggtgttccaagccttggcccaataccagaaggatgtccctgatcacaaggatctgaacctggatgtgtccatccacctgcccagccgcagcgctccagtcaggcatcgtatcctctgggaatctgctagccttctgcgg(SEQ ID NO.3)。

in a preferred embodiment, the SVV VP1 protein fragment, the FMDV VP1 protein fragment and the complement C3d protein fragment are linked by a flexible amino acid Linker, wherein the amino acid sequence of the flexible amino acid Linker is SEQ ID NO. 6. The flexible amino acid can promote the fusion protein to form correct spatial structures respectively, play better biological activity, avoid the mutual influence of the SVV VP1 protein fragment and the FMDV VP1 protein fragment, and improve the yield of the fusion protein.

The fusion protein is composed of the sequence of SVV VP1 protein fragment, FMDV VP1 protein fragment and complement C3d protein fragment, and is connected by flexible amino acid Linker.

Amino acid sequence of flexible amino acid Linker: PPSPSPPSPS (SEQ ID NO. 6).

In a preferred embodiment, the nucleotide sequence encoding the flexible amino acid Linker is SEQ ID NO. 7. Nucleotide sequence encoding flexible amino acid Linker: cctcccagccccagccctcccagccccagc (SEQ ID NO. 7).

In a preferred embodiment, the fusion protein comprises a) or b) as follows:

a) the amino acid sequence of SEQ ID NO.5 in the sequence table;

The fusion protein is preferably shown in SEQ ID NO. 5:

MSVYSADGWFSLHKLTKITLPPDCPQSPCILFFASAGEDYTLRLPVDCNPSYVFHSTDNAETGVIEAGNTDTDFSGELAAPGSNHTNVKFLFDRSRLLNVIKVLEKDAVFPRPFPTATGAQQDDGYFCLLTPRPTVASRPATRFGLYVNPSDSGVLANTSLDFNFYSLACFTYFRSDLEVTVVSLEPDLEFAVGWFPSGSEYQASSFVYDQLHVPYHFTGRTPRAFTSKGGKVSFVLPWNSVSSVLPVRWGGASKLSSATRGLPAHADWGTIYAFIPRPNEKKSTAVKHVAVYVRYKNARAWCPSMLPFRSYKQKMLMQSPPSPSPPSPSTTTTGESADPVTTTVENYGGDTQVQRRHHTDVGFIMDRFVKINSLSPTHVIDLMQTHKHGIVGALLRAATYYFSDLEIVVRHDGNLTWVPNGAPEAALSNTSNPTAYNKAPFTRLALPYTAPHRVLATVYDGTNKYSASDSRSGDLGSIAARVATQLPASFNYGAIQAQAIHELLVRMKRAELYCPRPLLAIKVTSQDRYKQKIIAPAKQLLPPSPSPPSPSTPSGCGEQNMIGMTPTVIAVHYLDSTEQWEKFGLEKRQEALELIKKGYTQQLAFRQKNSAFAAFQDRLSSTLLTAYVVKVFAMAANLIAIDSQVLCGAVKWLILEKQKPDGVFEENGPVIHQEMIGGFKNTEEKDVSLTAFVLIALQEAKDICEPQVNSLLRSINKARDFLADYYLELKRPYTVAIAGYALALSDKLDEPFLNKLLSTAKERNRWEEPGQKLHNVEATSYALLALLVVKDFDSVPPIVRWLNEQRYYGGGYGSTQATFMVFQALAQYQKDVPDHKDLNLDVSIHLPSRSAPVRHRILWESASLLR(SEQ IDNO.5)。

the fusion protein with SEQ ID NO.5 has high antigen activity, can efficiently promote an organism to generate SVV and FMDV antibodies, has high antibody titer, and improves the immunogenicity of the organism.

The fusion protein provided by the invention can be applied to at least one of the following A) to D):

A) preparing SVV and FMDV bivalent subunit vaccine;

B) preparing antibodies to SVV and FMDV;

C) preparing a kit for detecting SVV and FMDV;

D) SVV and FMDV diagnostic antigens are prepared.

The fusion protein provided by the invention has good antigen activity, and can be applied to various fields related to SVV and FMDV. For example, the fusion protein is prepared into a bivalent subunit vaccine for animal immunization, so that SVV and FMDV infection is avoided, and a good immune effect is achieved; the fusion protein is used for preparing SVV and FMDV antibodies, the yield is high, the effect is good, the antibodies can be applied to SVV and FMDV detection kits and the like, and the titer is high and stable.

The invention provides a coding gene of the fusion protein, which comprises the following 1) or 2):

1) the nucleotide sequence of SEQ ID NO.4 in the sequence table;

The coding gene is preferably a nucleotide sequence shown as SEQ ID No.4 in a sequence table:

atgtcagtttattctgctgatggttggtttagcctgcacaagctgactaaaattactctaccacctgactgcccacagagtccctgcattctctttttcgcctctgctggtgaggattacaccctacgtctccctgttgattgtaatccttcctacgtgttccactccaccgacaacgccgagactggggttattgaggcgggtaacactgacaccgatttctctggtgagctggcggctcctggctctaaccacactaatgtcaagttcctgtttgatcgatctcgattactgaatgtaattaaggtactggagaaggacgccgtcttcccccgtcctttccccacagcaacaggtgcacagcaggacgatggttacttttgccttctaacaccccgcccaacagtcgcttcccgacccgccactcgtttcggcctgtacgtcaatccgtctgacagtggcgttctcgctaacacttcactggatttcaatttttacagcttggcctgtttcacttactttagatcagaccttgaagtcacggtggtctcactggagccagatctggaattcgctgtagggtggttcccctctggcagtgagtaccaggcttccagctttgtctacgaccaactgcatgtgccttaccactttactgggcgcactccccgcgctttcaccagcaagggtggaaaggtatctttcgtgcttccttggaactctgtctcatccgtgcttcccgtgcgctgggggggcgcttccaagctttcttccgccacgcggggtctaccggctcatgctgactgggggaccatttacgccttcatcccccgtcctaatgagaagaaaagcaccgctgtaaagcacgtggcggtgtacgttcggtacaagaacgcgcgtgcctggtgccccagcatgctccccttccgcagctacaagcagaagatgctgatgcaatcacctcccagccccagccctcccagccccagcaccactactactggggagtccgcagaccctgtcaccaccaccgtggagaactacggcggtgatacacaagtccagagacgtcaccacacggacgtcggcttcattatggaccgatttgtgaagataaacagcctgagccccacacatgtcattgacctcatgcaaacccacaaacacgggatcgtgggtgcgttactgcgtgcagccacgtactacttctccgacttggagattgttgtgcggcacgatggtaatctgacctgggtgcccaacggtgcccccgaggcagccctgtcaaacaccagcaaccccactgcctacaacaaggcaccgttcacgagacttgctctcccttacactgcgccacaccgcgtgttggcaactgtgtacgacgggacaaacaagtactccgcaagcgattcgagatcaggcgacctggggtccatcgcggcgcgagtcgcgacacaacttcctgcttcctttaactacggtgcaatccaggcacaggccatccacgagcttctcgtgcgcatgaaacgggccgagctctactgtcccaggccacttctagcaataaaggtgacttcgcaagacaggtacaagcaaaagattattgcgcccgcaaaacagctgttgcctcccagccccagccctcccagccccagcaccccctccggctgtggggagcagaacatgatcggcatgacgcccacagtcatcgctgtgcactacctggacagcaccgaacaatgggagaagttcggcctggagaagaggcaggaagccttggagctcatcaagaaggggtacacccagcaactggccttcagacaaaagaactcagcctttgccgccttccaggaccggctgtccagcaccctgctgacagcctatgtggtcaaggtcttcgctatggcagccaacctcatcgccatcgactcccaggtcctctgtggggccgtcaaatggctgatcctggagaagcagaagcctgatggagtcttcgaggagaatgggcccgtgatacaccaagaaatgattggtggcttcaagaacactgaggagaaagacgtgtccctgacagcctttgttctcatcgcgctgcaggaggctaaagacatctgtgaaccacaggtcaatagcctgttgcgcagcatcaataaggcaagagacttcctcgcagactactacctagaattaaaaagaccatatactgtggccattgctggttatgccctggctctatctgacaagctggatgagcccttcctcaacaaacttctgagcacagccaaagaaaggaaccgctgggaggaacctggccagaagctccacaatgtggaggccacatcctacgccctcttggctctgctggtagtcaaagactttgactctgtccctcctattgtgcgctggctcaatgagcagagatactacggaggtggctatggatctacccaggccactttcatggtgttccaagccttggcccaataccagaaggatgtccctgatcacaaggatctgaacctggatgtgtccatccacctgcccagccgcagcgctccagtcaggcatcgtatcctctgggaatctgctagccttctgcggtaa(SEQ IDNO.4)。

the invention provides an expression vector, a cell line and an engineering bacterium containing the coding gene, wherein the cloning vector is preferably pMD18-T, the expression vector is preferably pcDNA3.1, the cell line is preferably a CHO cell line, and the engineering bacterium is preferably Escherichia coli DH5 alpha containing pMD18-T or Escherichia coli TOP10 containing pcDNA3.1. The CHO cell has accurate post-transcriptional modification function, can express fusion protein close to natural protein molecules, has the advantages of stable foreign gene expression, secretory expression, high antigen yield and the like, so the cell line is selected for preparing the vaccine antigen.

The invention provides the coding gene of the fusion protein, and an expression vector, a cell line and engineering bacteria containing the coding gene as biological modules for expressing the fusion protein, and the biological modules can be used for rapidly obtaining a large amount of high-purity fusion protein from different layers, thereby facilitating test operation and preservation.

The invention also provides a SVV and FMDV bivalent subunit vaccine, and the active ingredients of the vaccine comprise the fusion protein provided by the invention. The vaccine has good safety and good immune effect, enlarges the epidemic disease prevention and control range, saves labor force and improves the working efficiency.

In some embodiments, the SVV and FMDV bivalent subunit vaccine further comprises adjuvants including at least one of a vaccine adjuvant, a stabilizer, and an antibiotic.

In preferred embodiments, the vaccine adjuvant comprises aluminum hydroxide gel, freund's complete adjuvant, freund's incomplete adjuvant, white oil adjuvant, MF59 adjuvant, or ISA206, preferably ISA206 is used.

The invention finally provides a method for constructing SVV and FMDV fusion protein, expressing in high yield and preparing bivalent subunit vaccine, which comprises the following steps:

(1) connecting a nucleotide sequence (SEQ ID NO.1) for coding an SVV VP1 protein fragment, a nucleotide sequence (SEQ ID NO.2) for coding an FMDV VP1 protein fragment and a nucleotide sequence (SEQ ID NO.3) for coding a complement C3d protein fragment into a recombinant fragment by using a nucleotide sequence (SEQ ID NO.7) for coding a flexible amino acid Linker, inserting the recombinant fragment into a pMD18-T cloning vector, carrying out enzyme digestion identification and sequencing, screening out a positive recombinant vector, and transforming the positive recombinant vector into a DH5 alpha competent cell to obtain a recombinant plasmid pMD18-VP1/SVV-VP1/FMDV-C3 d.

(2) After the recombinant plasmid containing the gene sequence of VP1/SVV-VP1/FMDV-C3d and expression plasmid pcDNA3.1 are digested by restriction endonuclease, gene recombinant fragments and linear expression plasmids are recovered and connected overnight to obtain a positive recombinant expression plasmid, which is named as pcDNA3.1-SVV/VP1-FMDV/VP1-C3 d.

(3) Transfecting the obtained recombinant positive plasmid pcDNA3.1-SVV/VP1-FMDV/VP1-C3d to CHO cells, wherein the CHO cells have a single pressurization system, which is beneficial to screening of high expression cells, obtaining a positive cell line through single cell clone screening and bioreactor full-suspension serum-free culture, expressing fusion protein containing SVV and FMDV, and purifying to obtain the fusion protein;

the full-suspension serum-free culture method comprises the following steps: adopting CHO serum-free medium to culture CHO cells adapting to high pH medium to make its density reach 3.6 × 10⁶Culturing living cells/mL by adopting a shake flask or a stirring bioreactor under the condition of high pH, inoculating 35mL by adopting 125mL of aeration shake flask, inoculating 300mL by adopting 2L of aeration shake flask, culturing at 37 ℃ at the rotating speed of 80-100 rpm for 48-96 h, adding 1N NaOH during the culture, continuously sampling, and monitoring by using a calibrated pH meter to maintain the pH of the culture medium at 7.0-7.4.

(4) And (4) mixing the fusion protein purified in the step (3) with an ISA206 adjuvant to prepare the senega valley virus and foot-and-mouth disease virus bivalent subunit vaccine.

The invention is further illustrated by the following specific examples, which, however, are to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever.

Example 1 expression of fusion proteins by CHO cell expression System

1 materials and methods

1.1 cell culture

CHO cell line and geneticin (50mg/ml) were purchased from Invitrogen USA, culture temperature was 37 deg.C, and culture medium (Hycell CHO medium) was purchased from Hyclone USA. The CHO expression system and associated reagents were purchased from Invitrogen, usa.

Cell density and viability were counted and observed using trypan blue staining. Cell viability was calculated as the percentage of viable cells to total cells at different times post infection. Cell suspension culture at cell density 5X 10⁶Infection was carried out at cell viability of greater than 95% per ml.

1.2VP1 Gene Synthesis and construction of recombinant Positive plasmid

VP1 gene sequences (GenBank accession numbers MF615510.1 and NC _001623) and C3d sequences were artificially synthesized according to SVV and FMDV whole genomes, and the genes were inserted between KpnI and XbaI cleavage sites of pMD18-T after gene ligation to obtain plasmid pMD18-VP1/SVV-VP1/FMDV-C3 d.

Primers are designed according to the gene sequence, and the target fragment is 533 bp. The upstream primer is located at the SVV sequence position, the downstream primer is located at the FMDV sequence position, plasmids are amplified, and positive plasmids are screened and identified. The primer sequences are as follows:

upstream primer P1: 5'-TCCCCCGTCCTAATGAGAAGAAAA-3' (SEQ ID NO. 8);

the downstream primer P2: 5'-GTGTGGCGCAGTGTAAGGGAGAGC-3' (SEQ ID NO. 9).

1.3 construction and identification of pcDNA3.1-VP1/(SVV/FMDV) -C3d expression vector

The pMD18-VP1/SVV-VP1/FMDV-C3d cloning vector and pcDNA3.1 expression vector are subjected to double enzyme digestion by Kpn I and Xba I respectively, after enzyme digestion products are subjected to electrophoresis, VP1/SVV-VP1/FMDV-C3d and pcDNA3.1 gene fragments are recovered by a DNA recovery kit, VP1/SVV-VP1/FMDV-C3d and pcDNA3.1 enzyme fragment genes are connected overnight by a DNA connection kit, and the expression vector is introduced into TOP10 competent cells and cultured overnight by LB culture medium. Construction of

pcDNA3.1-VP1/(SVV/FMDV) -C3d expression vector.

pcDNA3.1-VP1/(SVV/FMDV) -C3d (i.e.

The construction scheme of pcDNA3.1-SVV/VP1-FMDV/VP1-C3d) expression vector is shown in FIG. 1. Extracting the cultured bacterium plasmid by using a plasmid extraction kit, and performing PCR amplification on a target fragment by using an identifying primer, wherein the size of a target gene is 533bp, and the result is shown in FIG. 2; and carrying out double enzyme digestion identification by using Kpn I and Xba I, wherein the identification result shows that after enzyme digestion, a vector fragment of about 5400bp and a target band of about 2600bp appear, and the result is shown in FIG. 3. The positive plasmids were sent to the GeneCorp for sequencing analysis.

1.3 establishment and screening of expression cells

1.3.1 transfection

Preparing plasmids, namely extracting the recombinant plasmids by using an extraction kit (according to the kit instruction), and centrifuging the obtained plasmids for 10min at 12000rpm for later use; collecting CHO cells, namely centrifuging suspension cultured CHO cells, washing the cells once by using a PBS solution, and then centrifuging and collecting the cells;

electrotransformation reaction system (200 μ L): 3X 10⁶CHO cells, 20. mu.g plasmid; and (3) electrotransformation conditions and culture: adding the electroporation reaction system containing cells and plasmids into an electric cuvette, and electrifying under the conditions of 1500V and 10msThree times, the cells after electric shock were transferred to two 10cm plates containing 10mL adherent medium, at 37 deg.C and 5% CO₂The culture was carried out for 1 day.

1.3.2 Positive clone selection

Drug screening: changing the liquid of the electric shock cell culture plate cultured for 1 day, adding G418 with the final concentration of 1.8mg/mL after 2 days of culture, and changing a new culture medium for 7 days after 2 days of culture;

positive clone selection and detection: culturing for 7 days, picking the cells to be attached to the wall to 96-well plate, culturing at 37 deg.C with 5% CO₂And after 7 days of culture, adding 100 mu L of suspension culture medium to express and culture for 3 days, using the culture medium in an empty plate for dot blot detection, transferring the high-expression clone into a 24-well plate, using the culture medium for Western Blot (WB) detection, and finally obtaining the high-expression clone according to an experimental result.

1.3.3 Shake flask culture of recombinant Positive clonal cells

Suspension culture in 500mL Erlenmeyer flask: in a shaking flask, the rotation speed is 120rpm, the temperature is 37 ℃ and the CO content is 5 percent₂Culturing under the condition; the suspension cultured recombinant CHO cells were then cultured at 1X 10⁶The final concentration of each/mL is inoculated into a 500mL conical flask containing 120mL suspension culture medium, vitamin K is added into the culture medium at the final concentration of 1mg/L, and the rotation speed is 120rpm, 37 ℃ and 5 percent CO₂Samples were taken daily to determine cell density, fusion protein concentration and glucose concentration in the culture medium.

1.3.4 expression and identification of fusion proteins

Protein gel electrophoresis: SDS-PAGE gel is prepared from 5% concentrated gel at the upper layer and 12% separated gel at the lower layer by electrophoresis at 400mA and 100V for 10min, and then at 400mA and 150V for 1 h.

Immunoblotting: transferring a sample into a PDVF membrane in a membrane transferring buffer solution after SDS-PAGE gel separation, wherein the membrane transferring condition is 100V voltage and 400mA current for 1h, the PDVF membrane is subjected to the action of a Cap protein monoclonal antibody for 4h through sealing and incubation, adding HRP (horse radish peroxidase) labeled goat-anti-mouse secondary antibody diluent, incubating for 2h at room temperature, washing for three times through PBST (para-phenylenedicarboxymethane-polyacrylamide gel electrophoresis), each time for 10min, and finally performing color development detection by using a DAB color development solution.

1.3.5 purification of fusion proteins

The expressed fusion protein sample was centrifuged at 8000rpm for 10min, and after collecting the supernatant, Ni was used⁺The affinity column was purified, and the purified protein was dialyzed against physiological saline and identified by SDS-PAGE. The identification result shows that: after SDS-PAGE electrophoresis of the purified product, the target protein fragment is consistent with the expected size. The content of the fusion protein is 0.8mg/mL, and the fusion protein is frozen and stored at the temperature of minus 80 ℃.

Example 2 engineering mammalian CHO cells to increase recombinant antigen production

1 method

The construction of the recombinant plasmid with the highest expression level is shown in example 1.

1.1.1 preparation of plasmid, extracting the recombinant plasmid with an extraction kit (according to kit instructions), adding 75% ethanol into the obtained plasmid, performing sterile treatment to ensure that the plasmid transfected into cells is sterile, and measuring the plasmid concentration by using a concentration detector.

1.1.2 Liposomal transfection: 5X 10⁶CHO cells/ml, 1. mu.g/. mu.l final concentration plasmid; transfection conditions and culture: preparing solution A, diluting plasmid DNA by adding 900 μ l OptiPRO SFM, standing for 5-10 min; preparing solution B, diluting liposome reagent 80 μ l with OptiPRO SFM 920 μ l, standing for 5-10min, adding solution B into solution A, gently inverting, mixing, standing for 3-5min, adding cell to be transfected, 37 deg.C, and adding 5% CO₂Culturing for 48 h.

1.1.3 Positive clone screening

Drug screening: the transfected cells cultured for 48h were transferred to culture flasks, 0.6mg/mL of G418 selection antibiotic was added, and the flask was divided into 5X 10 flasks⁵The CHO cells/ml are cultured for 7 days;

positive clone selection and detection: 37 ℃ and 5% CO₂And subculturing the grown survival cells in a cell bottle after 7 days of culture, increasing the concentration of G418 to be 0.8mg/ml final concentration, stabilizing for 2-3 generations, subculturing the cells for 5-7 days, collecting sample supernatant, detecting by a Western Blot (WB), and finally obtaining high-expression clones according to experimental results.

1.2 CHO Single cell clone screening

Performing gradient dilution on high-expression passage cells with the cell viability rate of more than 90% to breed the cells on a 96-well cell culture plate, averagely 0.5-1.0 cells/well, 200 mu l of cell culture medium per well, performing Elisa detection analysis after the cells grow to 80-100%, screening high-expression single cell clones, performing volume expansion culture to 24-well plates, 6-well plates and cell bottles, continuously performing Elisa detection analysis in the volume expansion culture process, and screening stable higher-expression strains.

1.3 adaptation and culture of CHO Single cell clone

Placing the mixture in a TPP tube at 37 ℃ and 5% CO₂The incubator performs suspension culture under the condition of 20ml and 200rpm, cell counting is performed every time of passage, positive cells are cultured and detected, stable expression is performed for 2-3 generations, passage samples are collected for detection, and stable higher expression samples are reserved for continuous passage.

1.4 CHO Positive cells suspension culture

Selecting 3-5 positive cells with high expression, subculturing, stabilizing, selecting the cell strain with the highest expression level, performing serum-free amplification culture, and culturing at 37 deg.C and 120rpm in air-permeable shake flask (from Corning Corp.) at 3 × 10⁵Individual cells/ml concentration maintenance and expansion culture.

1.55L bioreactor fermentation culture: recombinant CHO cells cultured in suspension at 1X 10⁶Inoculating the final concentration of each/mL into a bioreactor containing 3L of suspension culture medium, generally amplifying by 5-8 times, expressing the antigen when the final concentration is amplified to a specific volume, culturing at 37 ℃ to 5 days, reducing the temperature to 32 ℃, adjusting the pH to 7.5 +/-0.1, culturing at a proper rotating speed, adding 10% of initial working volume of effective Feed on 4 days and 9 days, detecting the glucose concentration every day, and supplementing the glucose to 3-4 g/L when the glucose concentration is lower than 2.5 g/L. When the cell viability is lower than 75%, the supernatant is harvested to be the required antigen.

By optimizing the culture condition and the feeding time of the cell strain, the feeding amount finally obtains the expression of the fusion protein of 1.0 mg/ml.

1.6 antigen purification the expressed fusion protein samples were centrifuged at 8000rpm for 10min, and after the supernatant was collected, Ni was used⁺Purifying with affinity chromatography column, wherein the purified protein is physiologically obtainedThe saline was dialyzed and identified using SDS-PAGE. The identification result shows that: after SDS-PAGE electrophoresis of the purified product, the target protein fragment is consistent with the expected size. The content of the fusion protein is 0.8mg/mL, and the fusion protein is frozen and stored at the temperature of minus 80 ℃.

EXAMPLE 3 formulation of SVV-FMDV bivalent vaccine

Diluting the SVV-FMDV fusion protein obtained by expression and harvesting into different concentrations by using a PBS solution, mixing the diluted fusion protein solution with SEPPIC ISA206 adjuvant according to the ratio of 1:1 of antigen components to the adjuvant, and finally preparing different antigen gradient vaccines of 0.5 mu g/head part, 5 mu g/head part, 10 mu g/head part and 30 mu g/head part. Stirring at 8000r/min for 8-10min, adding 0.01% (volume ratio) thimerosal solution before stopping stirring, shaking thoroughly, mixing, performing aseptic inspection, viscosity measurement and stability measurement according to the requirement of appendix of Chinese veterinary pharmacopoeia (current edition), and standing at 4 deg.C for use.

Example 4 recombinant bivalent subunit vaccine safety and antibody detection

4.1 method

4.1.1 animals and immunization

The 21-day-old newborn piglets are all negative by the detection of pig foot-and-mouth disease, pig vesicular stomatitis and pig vesicular stomatitis virus antibody kits, and the SVV is negative by PCR detection. Example 3 the resulting vaccine was prepared. 10 newborn piglets are divided into 5 groups, 1 group is a normal saline control group, and 2-5 groups of newborn piglets are injected with vaccines of 0.5 mu g/head part, 5 mu g/head part, 10 mu g/head part and 30 mu g/head part through muscle respectively. Blood was taken prior to immunization. And carrying out secondary immunization 21 days after the immunization of the newborn piglet is completed. Blood was taken 14 days after the second immunization and FMDV and SVV antibody levels were measured. The weight change of each group of pigs was observed before and after immunization to see if there were fever, anorexia, etc.

4.1.2 serum antibody detection

The antibody detection method is carried out according to the instructions of a pig foot-and-mouth disease (FMD) ELISA antibody detection kit (cat number: SBJ-Z180) and a pig seneca virus antibody detection reagent (Biostone). Two weeks after the second immunization, blood was collected weekly, and serum was separated for antibody detection.

4.2 results:

4.2.1 FMD antibody detection: blood was collected weekly for the detection of FMD ELISA antibody levels 14 days after the second immunization of 50 immunized piglets, and the detection results are shown in Table 1.

TABLE 1 Experimental piglet FMD antibody detection

4.2.2SVV antibody detection 14 days after the piglet secondary immunization, all piglet antibody levels were positive at 5. mu.g/head dose (SP value > 0.3). Antibody levels of all piglets in the 10. mu.g/head dose group and the 30. mu.g/head dose group were continuously increased 14 days after the second immunization, which is obviously superior to other low dose groups. The specific test results are shown in Table 2.

TABLE 2 Experimental piglet SVV antibody detection

The results show that the increase of the antigen content in the vaccine corresponds to the corresponding increase of the antibody titer, which indicates that the antigen immunized piglet can generate good immunogenicity.

4.2.3 No obvious difference exists between the weight of the immunized piglets and the weight of the piglets of a control group after the immunization observation, and no phenomena of fever, anorexia and the like are observed, which shows that the vaccine of the invention is safe and is shown in a table 3.

TABLE 3 clinical observations of post-vaccine immunization safety trials

While particular embodiments of the present invention have been illustrated and described, it would be obvious that various other changes and modifications can be made without departing from the spirit and scope of the invention. It is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this invention.

SEQUENCE LISTING

<110> Tiankang biological (Shanghai) Co., Ltd

TECON BIOLOGICAL Co.,Ltd.

Fusion protein of SVV and FMDV, and coding gene, expression vector, cell line, engineering bacterium, vaccine and vaccine thereof

Applications of

<160> 9

<170> PatentIn version 3.5

<210> 1

<211> 960

<212> DNA

<213> Artificial sequence

<400> 1

atgtcagttt attctgctga tggttggttt agcctgcaca agctgactaa aattactcta 60

ccacctgact gcccacagag tccctgcatt ctctttttcg cctctgctgg tgaggattac 120

accctacgtc tccctgttga ttgtaatcct tcctacgtgt tccactccac cgacaacgcc 180

gagactgggg ttattgaggc gggtaacact gacaccgatt tctctggtga gctggcggct 240

cctggctcta accacactaa tgtcaagttc ctgtttgatc gatctcgatt actgaatgta 300

attaaggtac tggagaagga cgccgtcttc ccccgtcctt tccccacagc aacaggtgca 360

cagcaggacg atggttactt ttgccttcta acaccccgcc caacagtcgc ttcccgaccc 420

gccactcgtt tcggcctgta cgtcaatccg tctgacagtg gcgttctcgc taacacttca 480

ctggatttca atttttacag cttggcctgt ttcacttact ttagatcaga ccttgaagtc 540

acggtggtct cactggagcc agatctggaa ttcgctgtag ggtggttccc ctctggcagt 600

gagtaccagg cttccagctt tgtctacgac caactgcatg tgccttacca ctttactggg 660

cgcactcccc gcgctttcac cagcaagggt ggaaaggtat ctttcgtgct tccttggaac 720

tctgtctcat ccgtgcttcc cgtgcgctgg gggggcgctt ccaagctttc ttccgccacg 780

cggggtctac cggctcatgc tgactggggg accatttacg ccttcatccc ccgtcctaat 840

gagaagaaaa gcaccgctgt aaagcacgtg gcggtgtacg ttcggtacaa gaacgcgcgt 900

gcctggtgcc ccagcatgct ccccttccgc agctacaagc agaagatgct gatgcaatca 960

<210> 2

<211> 636

<212> DNA

<213> Artificial sequence

<400> 2

accactacta ctggggagtc cgcagaccct gtcaccacca ccgtggagaa ctacggcggt 60

gatacacaag tccagagacg tcaccacacg gacgtcggct tcattatgga ccgatttgtg 120

aagataaaca gcctgagccc cacacatgtc attgacctca tgcaaaccca caaacacggg 180

atcgtgggtg cgttactgcg tgcagccacg tactacttct ccgacttgga gattgttgtg 240

cggcacgatg gtaatctgac ctgggtgccc aacggtgccc ccgaggcagc cctgtcaaac 300

accagcaacc ccactgccta caacaaggca ccgttcacga gacttgctct cccttacact 360

gcgccacacc gcgtgttggc aactgtgtac gacgggacaa acaagtactc cgcaagcgat 420

tcgagatcag gcgacctggg gtccatcgcg gcgcgagtcg cgacacaact tcctgcttcc 480

tttaactacg gtgcaatcca ggcacaggcc atccacgagc ttctcgtgcg catgaaacgg 540

gccgagctct actgtcccag gccacttcta gcaataaagg tgacttcgca agacaggtac 600

aagcaaaaga ttattgcgcc cgcaaaacag ctgttg 636

<210> 3

<211> 945

<212> DNA

<213> Artificial sequence

<400> 3

accccctccg gctgtgggga gcagaacatg atcggcatga cgcccacagt catcgctgtg 60

cactacctgg acagcaccga acaatgggag aagttcggcc tggagaagag gcaggaagcc 120

ttggagctca tcaagaaggg gtacacccag caactggcct tcagacaaaa gaactcagcc 180

tttgccgcct tccaggaccg gctgtccagc accctgctga cagcctatgt ggtcaaggtc 240

ttcgctatgg cagccaacct catcgccatc gactcccagg tcctctgtgg ggccgtcaaa 300

tggctgatcc tggagaagca gaagcctgat ggagtcttcg aggagaatgg gcccgtgata 360

caccaagaaa tgattggtgg cttcaagaac actgaggaga aagacgtgtc cctgacagcc 420

tttgttctca tcgcgctgca ggaggctaaa gacatctgtg aaccacaggt caatagcctg 480

ttgcgcagca tcaataaggc aagagacttc ctcgcagact actacctaga attaaaaaga 540

ccatatactg tggccattgc tggttatgcc ctggctctat ctgacaagct ggatgagccc 600

ttcctcaaca aacttctgag cacagccaaa gaaaggaacc gctgggagga acctggccag 660

aagctccaca atgtggaggc cacatcctac gccctcttgg ctctgctggt agtcaaagac 720

tttgactctg tccctcctat tgtgcgctgg ctcaatgagc agagatacta cggaggtggc 780

tatggatcta cccaggccac tttcatggtg ttccaagcct tggcccaata ccagaaggat 840

gtccctgatc acaaggatct gaacctggat gtgtccatcc acctgcccag ccgcagcgct 900

ccagtcaggc atcgtatcct ctgggaatct gctagccttc tgcgg 945

<210> 4

<211> 2604

<212> DNA

<213> Artificial sequence

<400> 4

atgtcagttt attctgctga tggttggttt agcctgcaca agctgactaa aattactcta 60

ccacctgact gcccacagag tccctgcatt ctctttttcg cctctgctgg tgaggattac 120

accctacgtc tccctgttga ttgtaatcct tcctacgtgt tccactccac cgacaacgcc 180

gagactgggg ttattgaggc gggtaacact gacaccgatt tctctggtga gctggcggct 240

cctggctcta accacactaa tgtcaagttc ctgtttgatc gatctcgatt actgaatgta 300

attaaggtac tggagaagga cgccgtcttc ccccgtcctt tccccacagc aacaggtgca 360

cagcaggacg atggttactt ttgccttcta acaccccgcc caacagtcgc ttcccgaccc 420

gccactcgtt tcggcctgta cgtcaatccg tctgacagtg gcgttctcgc taacacttca 480

ctggatttca atttttacag cttggcctgt ttcacttact ttagatcaga ccttgaagtc 540

acggtggtct cactggagcc agatctggaa ttcgctgtag ggtggttccc ctctggcagt 600

gagtaccagg cttccagctt tgtctacgac caactgcatg tgccttacca ctttactggg 660

cgcactcccc gcgctttcac cagcaagggt ggaaaggtat ctttcgtgct tccttggaac 720

tctgtctcat ccgtgcttcc cgtgcgctgg gggggcgctt ccaagctttc ttccgccacg 780

cggggtctac cggctcatgc tgactggggg accatttacg ccttcatccc ccgtcctaat 840

gagaagaaaa gcaccgctgt aaagcacgtg gcggtgtacg ttcggtacaa gaacgcgcgt 900

gcctggtgcc ccagcatgct ccccttccgc agctacaagc agaagatgct gatgcaatca 960

cctcccagcc ccagccctcc cagccccagc accactacta ctggggagtc cgcagaccct 1020

gtcaccacca ccgtggagaa ctacggcggt gatacacaag tccagagacg tcaccacacg 1080

gacgtcggct tcattatgga ccgatttgtg aagataaaca gcctgagccc cacacatgtc 1140

attgacctca tgcaaaccca caaacacggg atcgtgggtg cgttactgcg tgcagccacg 1200

tactacttct ccgacttgga gattgttgtg cggcacgatg gtaatctgac ctgggtgccc 1260

aacggtgccc ccgaggcagc cctgtcaaac accagcaacc ccactgccta caacaaggca 1320

ccgttcacga gacttgctct cccttacact gcgccacacc gcgtgttggc aactgtgtac 1380

gacgggacaa acaagtactc cgcaagcgat tcgagatcag gcgacctggg gtccatcgcg 1440

gcgcgagtcg cgacacaact tcctgcttcc tttaactacg gtgcaatcca ggcacaggcc 1500

atccacgagc ttctcgtgcg catgaaacgg gccgagctct actgtcccag gccacttcta 1560

gcaataaagg tgacttcgca agacaggtac aagcaaaaga ttattgcgcc cgcaaaacag 1620

ctgttgcctc ccagccccag ccctcccagc cccagcaccc cctccggctg tggggagcag 1680

aacatgatcg gcatgacgcc cacagtcatc gctgtgcact acctggacag caccgaacaa 1740

tgggagaagt tcggcctgga gaagaggcag gaagccttgg agctcatcaa gaaggggtac 1800

acccagcaac tggccttcag acaaaagaac tcagcctttg ccgccttcca ggaccggctg 1860

tccagcaccc tgctgacagc ctatgtggtc aaggtcttcg ctatggcagc caacctcatc 1920

gccatcgact cccaggtcct ctgtggggcc gtcaaatggc tgatcctgga gaagcagaag 1980

cctgatggag tcttcgagga gaatgggccc gtgatacacc aagaaatgat tggtggcttc 2040

aagaacactg aggagaaaga cgtgtccctg acagcctttg ttctcatcgc gctgcaggag 2100

gctaaagaca tctgtgaacc acaggtcaat agcctgttgc gcagcatcaa taaggcaaga 2160

gacttcctcg cagactacta cctagaatta aaaagaccat atactgtggc cattgctggt 2220

tatgccctgg ctctatctga caagctggat gagcccttcc tcaacaaact tctgagcaca 2280

gccaaagaaa ggaaccgctg ggaggaacct ggccagaagc tccacaatgt ggaggccaca 2340

tcctacgccc tcttggctct gctggtagtc aaagactttg actctgtccc tcctattgtg 2400

cgctggctca atgagcagag atactacgga ggtggctatg gatctaccca ggccactttc 2460

atggtgttcc aagccttggc ccaataccag aaggatgtcc ctgatcacaa ggatctgaac 2520

ctggatgtgt ccatccacct gcccagccgc agcgctccag tcaggcatcg tatcctctgg 2580

gaatctgcta gccttctgcg gtaa 2604

<210> 5

<211> 867

<212> PRT

<213> Artificial sequence

<400> 5

Met Ser Val Tyr Ser Ala Asp Gly Trp Phe Ser Leu His Lys Leu Thr

1 5 10 15

Lys Ile Thr Leu Pro Pro Asp Cys Pro Gln Ser Pro Cys Ile Leu Phe

20 25 30

Phe Ala Ser Ala Gly Glu Asp Tyr Thr Leu Arg Leu Pro Val Asp Cys

35 40 45

Asn Pro Ser Tyr Val Phe His Ser Thr Asp Asn Ala Glu Thr Gly Val

50 55 60

Ile Glu Ala Gly Asn Thr Asp Thr Asp Phe Ser Gly Glu Leu Ala Ala

65 70 75 80

Pro Gly Ser Asn His Thr Asn Val Lys Phe Leu Phe Asp Arg Ser Arg

85 90 95

Leu Leu Asn Val Ile Lys Val Leu Glu Lys Asp Ala Val Phe Pro Arg

100 105 110

Pro Phe Pro Thr Ala Thr Gly Ala Gln Gln Asp Asp Gly Tyr Phe Cys

115 120 125

Leu Leu Thr Pro Arg Pro Thr Val Ala Ser Arg Pro Ala Thr Arg Phe

130 135 140

Gly Leu Tyr Val Asn Pro Ser Asp Ser Gly Val Leu Ala Asn Thr Ser

145 150 155 160

Leu Asp Phe Asn Phe Tyr Ser Leu Ala Cys Phe Thr Tyr Phe Arg Ser

165 170 175

Asp Leu Glu Val Thr Val Val Ser Leu Glu Pro Asp Leu Glu Phe Ala

180 185 190

Val Gly Trp Phe Pro Ser Gly Ser Glu Tyr Gln Ala Ser Ser Phe Val

195 200 205

Tyr Asp Gln Leu His Val Pro Tyr His Phe Thr Gly Arg Thr Pro Arg

210 215 220

Ala Phe Thr Ser Lys Gly Gly Lys Val Ser Phe Val Leu Pro Trp Asn

225 230 235 240

Ser Val Ser Ser Val Leu Pro Val Arg Trp Gly Gly Ala Ser Lys Leu

245 250 255

Ser Ser Ala Thr Arg Gly Leu Pro Ala His Ala Asp Trp Gly Thr Ile

260 265 270

Tyr Ala Phe Ile Pro Arg Pro Asn Glu Lys Lys Ser Thr Ala Val Lys

275 280 285

His Val Ala Val Tyr Val Arg Tyr Lys Asn Ala Arg Ala Trp Cys Pro

290 295 300

Ser Met Leu Pro Phe Arg Ser Tyr Lys Gln Lys Met Leu Met Gln Ser

305 310 315 320

Pro Pro Ser Pro Ser Pro Pro Ser Pro Ser Thr Thr Thr Thr Gly Glu

325 330 335

Ser Ala Asp Pro Val Thr Thr Thr Val Glu Asn Tyr Gly Gly Asp Thr

340 345 350

Gln Val Gln Arg Arg His His Thr Asp Val Gly Phe Ile Met Asp Arg

355 360 365

Phe Val Lys Ile Asn Ser Leu Ser Pro Thr His Val Ile Asp Leu Met

370 375 380

Gln Thr His Lys His Gly Ile Val Gly Ala Leu Leu Arg Ala Ala Thr

385 390 395 400

Tyr Tyr Phe Ser Asp Leu Glu Ile Val Val Arg His Asp Gly Asn Leu

405 410 415

Thr Trp Val Pro Asn Gly Ala Pro Glu Ala Ala Leu Ser Asn Thr Ser

420 425 430

Asn Pro Thr Ala Tyr Asn Lys Ala Pro Phe Thr Arg Leu Ala Leu Pro

435 440 445

Tyr Thr Ala Pro His Arg Val Leu Ala Thr Val Tyr Asp Gly Thr Asn

450 455 460

Lys Tyr Ser Ala Ser Asp Ser Arg Ser Gly Asp Leu Gly Ser Ile Ala

465 470 475 480

Ala Arg Val Ala Thr Gln Leu Pro Ala Ser Phe Asn Tyr Gly Ala Ile

485 490 495

Gln Ala Gln Ala Ile His Glu Leu Leu Val Arg Met Lys Arg Ala Glu

500 505 510

Leu Tyr Cys Pro Arg Pro Leu Leu Ala Ile Lys Val Thr Ser Gln Asp

515 520 525

Arg Tyr Lys Gln Lys Ile Ile Ala Pro Ala Lys Gln Leu Leu Pro Pro

530 535 540

Ser Pro Ser Pro Pro Ser Pro Ser Thr Pro Ser Gly Cys Gly Glu Gln

545 550 555 560

Asn Met Ile Gly Met Thr Pro Thr Val Ile Ala Val His Tyr Leu Asp

565 570 575

Ser Thr Glu Gln Trp Glu Lys Phe Gly Leu Glu Lys Arg Gln Glu Ala

580 585 590

Leu Glu Leu Ile Lys Lys Gly Tyr Thr Gln Gln Leu Ala Phe Arg Gln

595 600 605

Lys Asn Ser Ala Phe Ala Ala Phe Gln Asp Arg Leu Ser Ser Thr Leu

610 615 620

Leu Thr Ala Tyr Val Val Lys Val Phe Ala Met Ala Ala Asn Leu Ile

625 630 635 640

Ala Ile Asp Ser Gln Val Leu Cys Gly Ala Val Lys Trp Leu Ile Leu

645 650 655

Glu Lys Gln Lys Pro Asp Gly Val Phe Glu Glu Asn Gly Pro Val Ile

660 665 670

His Gln Glu Met Ile Gly Gly Phe Lys Asn Thr Glu Glu Lys Asp Val

675 680 685

Ser Leu Thr Ala Phe Val Leu Ile Ala Leu Gln Glu Ala Lys Asp Ile

690 695 700

Cys Glu Pro Gln Val Asn Ser Leu Leu Arg Ser Ile Asn Lys Ala Arg

705 710 715 720

Asp Phe Leu Ala Asp Tyr Tyr Leu Glu Leu Lys Arg Pro Tyr Thr Val

725 730 735

Ala Ile Ala Gly Tyr Ala Leu Ala Leu Ser Asp Lys Leu Asp Glu Pro

740 745 750

Phe Leu Asn Lys Leu Leu Ser Thr Ala Lys Glu Arg Asn Arg Trp Glu

755 760 765

Glu Pro Gly Gln Lys Leu His Asn Val Glu Ala Thr Ser Tyr Ala Leu

770 775 780

Leu Ala Leu Leu Val Val Lys Asp Phe Asp Ser Val Pro Pro Ile Val

785 790 795 800

Arg Trp Leu Asn Glu Gln Arg Tyr Tyr Gly Gly Gly Tyr Gly Ser Thr

805 810 815

Gln Ala Thr Phe Met Val Phe Gln Ala Leu Ala Gln Tyr Gln Lys Asp

820 825 830

Val Pro Asp His Lys Asp Leu Asn Leu Asp Val Ser Ile His Leu Pro

835 840 845

Ser Arg Ser Ala Pro Val Arg His Arg Ile Leu Trp Glu Ser Ala Ser

850 855 860

Leu Leu Arg

865

<210> 6

<211> 10

<212> PRT

<213> Artificial sequence

<400> 6

Pro Pro Ser Pro Ser Pro Pro Ser Pro Ser

1 5 10

<210> 7

<211> 30

<212> DNA

<213> Artificial sequence

<400> 7

cctcccagcc ccagccctcc cagccccagc 30

<210> 8

<211> 24

<212> DNA

<213> Artificial sequence

<400> 8

tcccccgtcc taatgagaag aaaa 24

<210> 9

<211> 24

<212> DNA

<213> Artificial sequence

<400> 9

gtgtggcgca gtgtaaggga gagc 24

Claims

1. A fusion protein of SVV and FMDV, comprising a fragment of SVV VP1 protein, a fragment of FMDV VP1 protein, and a fragment of complement C3d protein;

the nucleotide sequence of the SVV VP1 protein fragment is SEQ ID NO. 1;

the nucleotide sequence of the FMDV VP1 protein fragment is SEQ ID NO. 2;

the nucleotide sequence of the complement C3d protein fragment is SEQ ID NO. 3;

wherein, the SVV VP1 protein fragment, the FMDV VP1 protein fragment and the complement C3d protein fragment are connected through a flexible amino acid Linker;

the amino acid sequence of the flexible amino acid Linker is SEQ ID NO. 6;

the fusion protein is connected in sequence from N end to C end, namely SVV VP1 fragment-Linker-FMDV VP1 fragment-Linker-complement C3d fragment.

2. The fusion protein of claim 1, wherein the nucleotide sequence encoding the flexible amino acid Linker is SEQ ID No. 7.

3. The fusion protein of claim 2, wherein the fusion protein comprises the amino acid sequence of SEQ ID No.5 of the sequence listing.

4. The fusion protein of claim 3, wherein the amino acid sequence of the fusion protein is set forth in SEQ ID No. 5.

5. Use of a fusion protein according to any of claims 1 to 4 for at least one of the following A) to D):

A) preparing SVV and FMDV bivalent subunit vaccine;

B) preparing antibodies to SVV and FMDV;

C) preparing a kit for detecting SVV and FMDV;

D) SVV and FMDV diagnostic antigens are prepared.

6. A gene encoding the fusion protein according to any one of claims 1 to 4, wherein the gene comprises the following 1) or 2):

1) the nucleotide sequence of SEQ ID NO.4 in the sequence table;

7. A cloning vector comprising the gene encoding the gene of claim 6.

8. The cloning vector of claim 7, wherein the cloning vector comprises pMD 18-T.

9. An expression vector comprising the coding gene of claim 6.

10. The expression vector of claim 9, wherein the expression vector comprises pcDNA3.1.

11. A cell line comprising the coding gene of claim 6 or the expression vector of claim 9 or 10.

12. The cell line of claim 11, wherein the cell line comprises a CHO cell line.

13. An engineered bacterium comprising the coding gene of claim 6, or the cloning vector of claim 7 or 8, or the expression vector of claim 9 or 10.

14. The engineered bacterium of claim 13, wherein the engineered bacterium is escherichia coli DH5 α containing pMD 18-T.

15. The engineering bacterium of claim 13, wherein the engineering bacterium is escherichia coli TOP10 containing pcdna3.1.

16. A SVV and FMDV bivalent subunit vaccine comprising the fusion protein of any one of claims 1-4.

17. The SVV and FMDV bivalent subunit vaccine according to claim 16, further comprising adjuvants, said adjuvants comprising at least one of vaccine adjuvants, stabilizers, and antibiotics.

18. The SVV and FMDV bivalent subunit vaccine according to claim 17, wherein said vaccine adjuvant comprises aluminum hydroxide gel, Freund's complete adjuvant, Freund's incomplete adjuvant, white oil adjuvant, MF59 adjuvant or ISA 206.