CN114920843B

CN114920843B - MHC II ligand, fusion protein and application thereof in animal immunity

Info

Publication number: CN114920843B
Application number: CN202210606805.5A
Authority: CN
Inventors: 张鸣
Original assignee: Qingdao Youheng Biotechnology Co ltd
Current assignee: Qingdao Youheng Biotechnology Co ltd
Priority date: 2022-05-31
Filing date: 2022-05-31
Publication date: 2023-11-21
Anticipated expiration: 2042-05-31
Also published as: CN114920843A

Abstract

The invention relates to an MHC II ligand, fusion protein and application thereof in animal immunity. The invention aims to provide an immune fusion protein which can improve the antigenicity of small molecules of MHC II ligands 2H4, G9 and H8, has obviously enhanced antigenicity compared with the immune antigen of fusion proteins of immune antigens CEA, HE4 and PCT, does not cause a large number of nonspecific antibodies to be produced by organisms, and has important application in the fields of animal immunity and biochemical detection.

Description

MHC II ligand, fusion protein and application thereof in animal immunity

Technical Field

The invention belongs to the technical field of medical immunology, and particularly relates to an MHC (major histocompatibility complex) II ligand, a fusion protein obtained by coupling the MHC II ligand with an immune antigen, and application of the MHC II ligand and the fusion protein in the field of animal immunity.

Background

The disclosure of this background section is only intended to increase the understanding of the general background of the invention and is not necessarily to be construed as an admission or any form of suggestion that this information forms the prior art already known to those of ordinary skill in the art.

The major histocompatibility complex (major histocompatibility complex, MHC) is a generic name for a group of genes encoding major histocompatibility antigens of animals. Major histocompatibility complexes are classified into three classes, MHC I, MHC II, MHC III, respectively, according to the location and function of the gene. Among them, MHC II is mostly located on Antigen Presenting Cells (APCs), such as macrophages, etc. A group of highly polymorphic transmembrane glycoproteins, consisting of non-covalent chains of the alpha and beta chains, can present processed foreign antigens to the antigen receptors of helper T cells, resulting in helper T cell activation and differentiation, and thus play an important role in eliciting an immune response. For example, in some viral infections, certain proteins of the virus interfere with the function of MHC II, affecting normal immune recognition. The MHC class II molecule can mediate multiple signal transduction pathways, apoptosis and other biological behaviors of APC in the antigen presenting process, and some cells which do not express the MHC class II molecule under normal conditions can also be induced to express the MHC class II molecule by cytokines and the like in the growing process, so that the expression of the MHC class II molecule is regarded as a marker of antigen presenting capability. Studies have shown that genes associated with endogenous antigen processing and presentation, i.e., LMP and TAP, exist within the human MHC ii gene region. LMP is also called protease-related gene (LMP 2 and LMP7 genes), and the coded product LMP (low molecular mass polypeptide or large multifunctional protease) is related to the treatment of endogenous antigens. TAP is a polypeptide transporter gene, including both TAP1 and TAP2 genes, encoding a product TAP (transporter of antigenic peptides) involved in the transport of antigenic peptides. Thus, it can be seen that the MHC II gene plays an important role in regulating the immune response.

Animal immunization is a common technique in the biomedical field, and an antigen (or immunogen) is injected into an animal body, so that the animal body itself generates or obtains an antibody specific to a certain antigen (immunogen). However, the amount of antibody produced after immunization of an animal is determined by the immunogenicity and immunoreactivity of the antigen (or immunogen). Immunogenicity refers to the ability of an antigen to be recognized and bound by T, B cell surface specific antigen receptors to induce an adaptive immune response in the body. Immunoreactivity refers to the ability of an antigen to specifically bind to its induced immune response effector substance. Substances that are both immunogenic and immunoreactive are referred to as complete antigens. Substances that are only immunoreactive and not immunogenic are called haptens. The hapten and a carrier such as macromolecular protein or polylysine can be crosslinked or combined to obtain immunogenicity, so that the organism is stimulated to generate specific antibodies aiming at the hapten. However, for small molecule antigens, the structure of the coupled large molecule protein often changes greatly, so that the immune activity structural domain of the small molecule protein cannot be exposed, and most of antibodies generated by the body are targeting large molecule proteins, so that immune failure is caused. The immunogenicity of an antigen is truly determined by the foreign matter and physical and chemical properties of the antigen, and is also related to the heredity, sex and physiological state of the organism and the way and mode of the antigen entering the organism. For example, the farther the affinity between an antigen and the body, the more immunogenic; the natural antigen of macromolecular organic matters has stronger immunogenicity; the greater the antigen molecular weight, the more immunogenic it is; antigens with multiple branched chains or cyclic structural groups are more immunogenic than linear antigens; the polymeric protein is more immunogenic than the monomer; the particulate antigen is more immunogenic than the soluble antigen. For some specific small molecule antigens with simple structures, immunization fails after optimizing the immunization mode, dosage and other conditions. Therefore, it is necessary to find a method that can increase the immunogenicity of small molecule antigens without the body producing large amounts of non-specific antibodies.

In alpaca peripheral blood there is a naturally deleted light chain antibody comprising only one heavy chain variable region (VHH) and two conventional CH2 and CH3 regions, but not as easily sticking to each other or even agglomerating as artificial engineered single chain antibody fragments (scFv). More importantly, the VHH structure cloned and expressed alone has structural stability comparable to that of the original heavy chain antibody and binding activity to the antigen, the smallest unit known to bind the antigen of interest. The VHH crystals were 2.5nm long and only 15kDa in molecular weight, also known as Nanobody (Nb). Nanobodies are comparable in affinity to their corresponding scFv relative to conventional four-chain antibodies, but exceed scFv in terms of solubility, stability, resistance to aggregation, refolding, expression yield, and ease of DNA manipulation, library construction, and 3-D structure determination.

Disclosure of Invention

The invention provides three MHC II ligands, namely, nanometer antibodies of anti-camel MHC II, which are respectively named as MHC II ligands 2H4, G9 and H8. The three ligands have good affinity with MHC II, can specifically enhance the immunogenicity of CEA, HE4 and PCT markers, and can be used as specific immunoadjuvants of the markers.

Based on the technical background, the invention provides the following technical scheme:

in a first aspect of the invention there is provided an MHC II ligand having a variable region amino acid sequence comprising a CRD1 region as shown in SEQ ID NO.3, a CRD2 region as shown in SEQ ID NO.4 and a CRD3 region as shown in SEQ ID NO. 5;

or, a CRD1 region as shown in SEQ ID NO.11, a CRD2 region as shown in SEQ ID NO.12, and a CRD3 region as shown in SEQ ID NO. 13;

or, a CRD1 region as shown in SEQ ID NO.16, a CRD2 region as shown in SEQ ID NO.17, and a CRD3 region as shown in SEQ ID NO. 18.

Further, the variable region amino acid sequence of the MHC II ligand is as follows:

(1) An amino acid sequence shown as SEQ ID NO.1, SEQ ID NO.9 or SEQ ID NO. 14;

(2) The amino acid sequence shown in SEQ ID No.1, SEQ ID No.9 or SEQ ID No.14 still shows similar physiological activity after adding, deleting or replacing one or more amino acids.

In one embodiment with better screening effect, the invention provides an MHC II ligand 2H4, wherein the amino acid sequence of a variable region of the MHC II ligand 2H4 is shown as SEQ ID NO.1, the amino acid sequence of the 1 st to 25 th positions is FR1, the amino acid sequence of the 26 th to 33 th positions is CDR1 (shown as SEQ ID NO. 3), the amino acid sequence of the 34 th to 50 th positions is FR2, the amino acid sequence of the 51 th to 58 th positions is CDR2 (shown as SEQ ID NO. 4), the amino acid sequence of the 59 th to 96 th positions is FR3, the amino acid sequence of the 97 th to 113 th positions is CDR3 (shown as SEQ ID NO. 5), and the amino acid sequence of the 114 th to 124 th positions is FR4.

In yet another embodiment of the present invention, there is provided an MHC II ligand G9, wherein the variable region amino acid sequence of the MHC II ligand G9 is shown as SEQ ID NO.9, wherein amino acid sequences 1 to 25 are FR1, amino acid sequences 26 to 33 are CDR1 (shown as SEQ ID NO. 11), amino acid sequences 34 to 50 are FR2, amino acid sequences 51 to 58 are CDR2 (shown as SEQ ID NO. 12), amino acid sequences 59 to 96 are FR3, amino acid sequences 97 to 113 are CDR3 (shown as SEQ ID NO. 13), and amino acid sequences 114 to 124 are FR4.

In yet another embodiment of the present invention, there is provided an MHC II ligand H8, wherein the variable region amino acid sequence of the MHC II ligand H8 is shown as SEQ ID NO.14, wherein amino acid sequences 1 to 25 are FR1, amino acid sequences 26 to 33 are CDR1 (shown as SEQ ID NO. 16), amino acid sequences 34 to 50 are FR2, amino acid sequences 51 to 58 are CDR2 (shown as SEQ ID NO. 17), amino acid sequences 59 to 96 are FR3, amino acid sequences 97 to 108 are CDR3 (shown as SEQ ID NO. 18), and amino acid sequences 109 to 119 are FR4.

Preferably, the MHC II ligand further comprises a derivative polypeptide obtained by modifying the amino acid sequence of the above (1) or (2), wherein the modification method comprises, but is not limited to, modification or addition of a molecular marker such as polyethylene glycol, streptavidin, biotin, a radioisotope, a fluorescent agent, etc.; further, the functional group modification includes modification of the FR region with a hydrophilic group or substitution of a hydrophobic residue of the FR region.

In a second aspect of the invention there is provided a nucleic acid substance encoding an MHC ii ligand according to the first aspect.

The nucleic acid material of the second aspect includes a nucleic acid encoding the above MHC II ligand, which is not limited to DNA or RNA, due to codon degeneracy; preferably, the coding nucleic acid is DNA, including cDNA, genomic DNA, or synthetic DNA; the DNA may be single-stranded or double-stranded, and may be coding or non-coding.

In a specific embodiment of the present invention, the nucleic acid sequence encoding the MHC II ligand 2H4 is shown in SEQ ID NO. 2.

In yet another embodiment of the present invention, the nucleic acid sequence encoding the MHC II ligand G9 is shown in SEQ ID NO. 10.

In yet another embodiment of the present invention, the nucleic acid sequence encoding the MHC II ligand H8 is shown in SEQ ID NO. 15.

In a third aspect of the invention, there is provided an expression vector comprising said nucleic acid material.

Preferably, the expression vector includes, but is not limited to, bacterial plasmids, phage, yeast plasmids, plant cell viruses, mammalian cell viruses, or other vectors;

further, the expression vector is a bacterial plasmid or a yeast plasmid.

In a fourth aspect of the invention, there is provided a host cell comprising a nucleic acid material according to the second aspect and/or an expression vector according to the third aspect.

Preferably, the host cell is a plant cell or a microbial cell; further, the host cell is a microbial cell, and in a specific example, E.coli is used as the host cell.

In the conventional animal immunization technique, in the case of failure of immunization with small molecule antigens, large molecule proteins or polylysine and the like are usually coupled to improve the immunogenicity of the antigens. However, in this way, the structure of the small molecule antigen is often changed greatly after the small molecule antigen is coupled with the large molecule protein, so that the immune activity structural domain of the small molecule protein cannot be exposed, or most of antibodies generated by the body are targeting large molecule proteins, so that the immune failure is caused. Based on the enhancement effect of the ligand on the immune antigen, the invention designs that the ligand is connected with the small molecule antigen to obtain the corresponding fusion protein, and the antigen presenting efficiency of the organism can be improved on the premise of ensuring the self structural domain of the small molecule protein, thereby improving the immunogenicity of the antigen and the antibody titer of immune serum. The method is not only suitable for small antigens, but also has the immune enhancement effect on larger antigens.

Accordingly, in a fifth aspect the present invention provides a fusion protein of the first aspect of an MHC ii ligand linked to an immunogenic antigen selected from CEA, HE4, PCT.

A connecting peptide can be added between the ligand of the MHC II and the immune antigen so that the MHC II ligand and the immune antigen can be expressed respectively and form a space structure of the MHC II ligand and the immune antigen, the steric hindrance effect is avoided, and the connecting peptide can be adopted(GGGGS) _n A flexible polypeptide.

Preferably, the MHC II ligand is linked to the immunological antigen by a covalent bond or by a linking peptide, which is (GGGGS) _n Wherein n is any integer from 1 to 7.

Further, n is any integer from 3 to 7; in a specific example, n=7.

The preparation method of the fusion protein comprises, but is not limited to, adopting a recombinant expression mode to fuse the coding genes of the MHC II ligand and the immune antigen, and then expressing the fusion protein in escherichia coli, saccharomycetes, insect cells or mammalian cells.

In a sixth aspect of the invention there is provided the use of an MHC ii ligand according to the first aspect, a fusion protein according to the third aspect, in animal immunization.

Preferably, the application mode in animal immunization includes, but is not limited to, any of the following:

(1) Using said MHC ii ligand or said fusion protein for the preparation of a vaccine;

(2) The MHC II ligand or the fusion protein is used for developing biochemical detection reagents.

In the above aspect (2), the biochemical detection reagent, for example, a capture antibody or a detection antibody reagent of CEA, HE4, PCT, can be used in a detection method and a kit based on antibody specific recognition.

Drawings

The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the invention.

Fig. 1: first and second rounds of PCR amplification antibody variable region gene electrophoresis identification patterns;

fig. 2: third round PCR amplification antibody variable region gene electrophoresis identification map;

fig. 3: a pMES4 vector and a VHH double-enzyme digestion reaction product electrophoresis identification chart;

fig. 4: estimating a stock-keeping result by single colony counting;

fig. 5: identifying a transformant electrophoresis identification chart by colony PCR;

fig. 6: SDS-PAGE patterns of nano-antibody purification;

wherein, the left graph is ligand 2H4, the middle graph is ligand G9, and the right graph is ligand H8;

fig. 7: immunogen a purified SDS-PAGE;

fig. 8: immunogen C purified SDS-PAGE patterns;

fig. 9: immunogen B purified SDS-PAGE patterns;

fig. 10: antigen a alone and antibody titer after fusion immunization;

fig. 11: antigen C alone and antibody titer after fusion immunization;

fig. 12: antigen B alone and antibody titer after fusion immunization.

Detailed Description

It should be noted that the following detailed description is illustrative and is intended to provide further explanation of the invention. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of exemplary embodiments according to the present invention. As used herein, the singular is also intended to include the plural unless the context clearly indicates otherwise, and furthermore, it is to be understood that the terms "comprises" and/or "comprising" when used in this specification are taken to specify the presence of stated features, steps, operations, devices, components, and/or combinations thereof.

In order to enable those skilled in the art to more clearly understand the technical scheme of the present invention, the technical scheme of the present invention will be described in detail with reference to specific embodiments.

EXAMPLE 1 construction of nanobody synthetic library

1.1 overlap extension PCR amplification of VHH full Length fragments

Two rounds of PCR reactions were performed using 2D1-pMES4 as template (2D 1 nucleic acid sequence shown as SEQ ID NO. 8). Amplification was performed in two rounds, and the PCR reaction system and primer sequences were as follows:

TABLE 1

F1:CAGGTGCAGCTGCAGGAGTC(SEQ ID NO.19)

R1:AAATTCACGCTCCTTCCCGGGAGCCTGGCGGAACCACCCCAT(MNN) ₈ AGAGGCTACACAGGAGAGTC(SEQ ID NO.20)

F2:CCGCCAGGCTCCCGGGAAGGAGCGTGAATTTGTCGCAGGTNNKNNKNNKNNKNNKNNKNNKNNKCATTATGCAGACTCCGTGAA(SEQ ID NO.21)

R2:TGGGTCCCCTGGCCCCAGTA(MNN) _8/12/16 ACAGTAATAGACGGCCGTGT(SEQ ID NO.22)

The PCR reaction conditions and procedures were: 98℃for 10s at 68℃for 1min for a total of 35 cycles. The agarose gel recovery kit gel was used to recover bands of about 141bp and 252bp (FIG. 1:M is Trans 2K plus DNA Marker;1-2 as the first round PCR amplification product; 3-4 as the second round PCR amplification product).

A third round of PCR was performed using the recovered product of the second round of PCR as a template. The third round of PCR reaction system and primer sequences are as follows:

TABLE 2

F1:CAGGTGCAGCTGCAGGAGTC(SEQ ID NO.19)

R3:TGAGGAGACGGTGACCTGGGTCCCCTGGCCCCAGTA(SEQ ID NO.23)

The PCR reaction conditions and procedures were: 98℃for 10s at 68℃for 1min for a total of 35 cycles. The PCR products were purified using a PCR product recovery kit (FIG. 2:M Trans 2K plus DNA Marker;1 is third round PCR amplification product).

1.2 vector construction

200. Mu.g of pMES4 (from Biovector) was digested with PstI and BstEII, respectively, and 60. Mu.g of VHH overnight at 37℃in the following manner:

TABLE 3 Table 3

The PCR product recovery kit was used for product recovery, and the pMES4 vector and VHH double digestion results were detected by 1% agarose electrophoresis gel (FIG. 3:M is 1Kb DNA marker;1 is the uncleaved vector plasmid; 2 is the vector double digested product; 3-4 is the vector single digested product; 5 is the VHH double digested product). 120. Mu.g of the digested vector and 50. Mu.g of the digested third PCR product were taken, 500. Mu. l T4 DNA ligase was added, buffer and water were supplemented to a total volume of 50ml, and ligation was performed overnight at 16℃and the ligation product was recovered. The ligation products were purified using the Cycle-Pure Kit.

1.3 electric conversion and storage Capacity determination

The ligation system was added to TG1 competent cells (ligation system: competent=1:100) and gently mixed by pipetting. The competent cells with the connection system are respectively packaged in electric shock cups (-20 ℃ precooling), and each electric shock cup is respectively packaged with 200 μl and kept stand on ice for 5min. The electric shock cup is put into an electric converter for electric conversion, the electric conversion parameters are set to be 2.5kV,25 mu F and 200 omega, and 800 mu l of SOC culture medium is added immediately after the electric conversion is finished and is uniformly mixed. The culture medium in the electric rotating cup is sucked into a centrifuge tube with 15ml, 1ml of SOC culture medium is added into each electric shock cup to wash the electric rotating cup, and then the culture medium is sucked into the centrifuge tube, and is resuscitated for 1h at 37 ℃ and 180 r/min. The medium was centrifuged at 4000r/min for 10min, the supernatant was removed, the cells were collected, and the cells were resuspended in 4ml of 2 XTY medium. The bacterial liquid was spread on 20 plates of 180mm 2 XTY/A, and after the bacterial liquid was absorbed, the plates were inverted and incubated in an incubator at 30℃overnight. 2ml (or 1 ml) of 2 XTY liquid culture medium is added on each plate, thalli on the plate are scraped by a scraper, the thalli are moved into a centrifuge tube by a pipette, the plate is flushed by 2ml (or 1 ml) of 2 XTY liquid culture medium, and the obtained thalli liquid and the centrifuge tube are collected. The following day, the bacterial cells are collected by centrifugation at 4000r/min for 10min, the bacterial cells are suspended to 20ml by using a 2 XTY culture medium, 40ml of 20% glycerol bacteria are obtained by adding 1:1 into 40% glycerol, and the bacterial cells are preserved at-80 ℃ after being evenly mixed.

Mu.l of the constructed total synthetic nanobody library was aspirated out according to 10 ^-1 ，10 ^-2 To 10 ^-8 Gradient dilution (aspiration of 20. Mu.l of the bacterial solution into 180. Mu.l of the medium), 100. Mu.l of each of the bacterial solutions of each gradient was applied to a 2 XTY/A plate and incubated overnight in an incubator at 37 ℃. The single colonies on each dilution plate were counted, the plate with the appropriate number of single colonies was selected, and the library capacity was calculated from the dilutions (see FIG. 4 for results). After 22 single colonies were randomly picked up by a sterile gun head and streaked on LB plates, they were placed in an EP tube containing 10. Mu.l of endotoxin-free water and mixed well for colony PCR identification (FIG. 5:M is Trans 2K plus DNA Marker;1-22 is a randomly selected monoclonal PCR identification product; N is a negative control). The primer sequences and PCR systems were as follows:

pMES-F：GCCGCTGGATTGTTATTACTC(SEQ ID NO.24)

pMES-R：CTTTCAACAGTGGAACCGTAG(SEQ ID NO.25)

TABLE 4 Table 4

The PCR procedure was as follows:

TABLE 5

The PCR positive rate was calculated from the electrophoresis result of this time, and the library capacity was estimated [ library capacity=clone number (20) ×dilution x positive rate×10 ]. Calculated, the storage capacity is 3.05X10 ¹¹ 。

EXAMPLE 2 selection and expression of nanobodies

2.1 M13 phage amplification

Inoculating the resuscitated bacterial solution into YT-AG culture medium, and culturing at 37deg.C and 200rpm until the culture OD ₆₀₀ ＝0.5。10ml of the bacterial liquid is taken out and added with 4 multiplied by 10 ¹⁰ VCSM13, resting at 37 ℃ for 30 min. Centrifugation at 4000rpm for 10min at normal temperature and removal of supernatant. The cells were resuspended in 2 XYT-AK (ampicillin and kanamycin) medium and incubated overnight at 37℃at 200 rpm. The supernatant was centrifuged in a 40ml tube, 10ml of PEG/NaCl (20%/2.5M) solution was added and thoroughly mixed, the supernatant was discarded by centrifugation, the pellet was washed with 1ml of ice PBS and centrifuged, 250. Mu.l of pre-chilled PEG/NaCl was taken, thoroughly mixed and washed for resuspension.

Phage titer was determined: culturing TG1 to OD ₆₀₀ Phage were diluted in gradient with LB medium, mixed with phage TG1 culture diluted in a double ratio, observed for plaque formation in the plate the next day, counted on dilution gradient plates with plaque numbers ranging from 30 to 300 and phage titer (pfu) was calculated according to the following formula.

Phage titer (pfu/ml) =dilution x number of plaques x 100

Phage display of 2.2 nanobodies

Inoculating 1ml of bacterial solution of nanobody library into 2 10ml of 2 XYT-AG culture medium, respectively, and culturing at 37deg.C and 200rpm/min to OD ₆₀₀ =0.5, add 4×10 per tube ¹⁰ F.u helper phage, resting at 37℃for 30min; centrifuging at 4000rpm for 10min at normal temperature, removing supernatant, adding 3ml of 2 XYT-AK culture medium, re-suspending, and finally adding into 100ml of 2YT-AK culture solution, and culturing at 37deg.C and 200rpm/min for overnight. The next day the displayed phage were concentrated and precipitated and titers were determined.

2.3 solid phase panning of phage display libraries

Diluting MHC II recombinant antigen (XP_ 006202267.2) with CBS to 10. Mu.g/ml, coating ELISA plates 100. Mu.l per well, standing overnight at 4℃and washing the plates 5 times with PBST; mu.l of 1% BSA was added to each well, blocked at 37℃for 1h, and the plates were washed 5 times with PBST; mu.l of each well was diluted to 10 ¹¹ F.u phage display, 37 ℃ 2h incubation, PBST washing plate 15-25 times; after the last washing, adding 100 μl glycine solution into each well, and incubating on a horizontal shaker for 15min; the eluate from each well was added to an EP tube to which 15. Mu.l of Tris solution had been added in advance, and the titers were detected after combining. The total panning was performed 3-4 times.

2.4 ELISA screening of phage for Positive clones

Positive clones were screened for antigen by ELISA method. ELISA plates were coated with antigen, blocked with 5% BSA, and washed with PBST. Mu.l phage supernatant was added to each well and left at 37℃for 1 hour. The supernatant was discarded, and HRP-labeled secondary antibody against M13 was added and left at 37 ℃ for 1 hour. The supernatant was discarded, TMB solution was added, incubated at room temperature for 5 hours, 2M sulfuric acid stop solution was added to each well, and the wells were read with a microplate reader at 450 nm. Clones positive for phage ELISA were selected and sequenced.

2.5 amplification of nanobody original Strain TG1 and transformation of nanobody recombinant plasmid into E.coli BL21 (DE 3)

Clones with positive results were selected, and original strain TG1 glycerol bacteriase:Sub>A containing nanobody nucleic acid were inoculated in 5ml of fresh LB-A medium at ase:Sub>A ratio of 1:1000, and cultured overnight at 37℃at 200 rpm. The following day, plasmids were extracted using the Plasmid mini kit (OMEGA) according to the instructions. After verification, 1. Mu.l of the above plasmid was transformed into 100. Mu.l of competent cells, gently mixed, placed on ice for 30 minutes, heat-shocked in a 42℃water bath for 90 seconds, and cooled in an ice bath for 3 minutes. 600 μl LB medium was added to the centrifuge tube and incubated with shaking at 37deg.C for 60 minutes. 100 μl of the supernatant was spread on LB-A plates with ase:Sub>A triangular spreader and incubated overnight at 37deg.C with inversion.

2.6 Induction of expression of nanobodies

The above monoclonal colonies were picked up in LB-A medium and cultured overnight at 37℃with shaking. The next day, 100ml of fresh LB-A culture medium is added into the bacterial liquid according to the proportion of 1:100, and the bacterial liquid is cultured for 3 hours at 37 ℃ in ase:Sub>A shaking way until the bacterial liquid OD ₆₀₀ About=0.8, 1mm iptg was added to the final concentration and induced overnight at 30 ℃. On the third day, 8000rpm, the cells were collected by centrifugation for 10 minutes, and 1.5ml of pre-chilled TES buffer was added to resuspend the pellet. After 2 minutes of ice bath, the cycle was repeated 6 times with gentle shaking for 30 seconds. 3.0ml TES/4 (4-fold dilution of TES with water) was added, and after gentle shaking for 30 seconds, the ice bath was allowed to stand for 2 minutes, and the shaking and standing steps were repeated 6 times as much. Centrifugation was performed at 9000rpm at 4℃for 10 minutes, and about 4.5ml of the supernatant (periplasmic extract) was collected.

2.7 purification and identification of nanobodies

After the IMAC Sepharose (GE company) was resuspended, 2ml was added to the gravity column, and allowed to stand for 30 minutes to allow the Sepharose to naturally settle to the bottom of the gravity column and the preservation buffer was drained. 2 column volumes of nickel sulfate solution (0.1M) were added and the nickel sulfate solution was tapped at a flow rate of about 8 seconds/drop; adding 10 times of column volume of balance buffer to balance and wash sepharose, and keeping the flow rate unchanged; diluting a sample with a balancing buffer solution for 2 times, adding the diluted sample into a gravity column, regulating the flow rate to 6 seconds/drop, and collecting penetrating fluid; adding a washing buffer solution with a volume of 10 times of the column volume to wash sepharose, maintaining the flow rate unchanged, and collecting washing solution; adding an elution buffer solution with the volume of 3 times of the column, maintaining the flow rate at 6 seconds/drop, and collecting the elution solution containing the target protein; finally, 10 times of column volume of equilibration buffer, 10 times of column volume of pure water and 10 times of column volume of 20% ethanol are sequentially added to wash sepharose, and finally 4ml of 20% ethanol is reserved to preserve the column. The collected samples were subjected to SDS-PAGE detection (FIG. 6:M shows the rainbow 180 broad-spectrum protein Marker;1 shows the E.coli induced expression of the purified nanobody).

Analysis of antibody light and heavy chain genes was performed on the sequencing results using Vector NTI software to determine the framework regions (Framework Regions, FR) and complementarity determining regions (Complementary Determining Regions, CDR) of the variable regions.

EXAMPLE 3 determination of affinity Activity of nanobodies with antigen

3.1 chip antigen coupling

The MHC II recombinant antigen (XP_ 006202267.2) is prepared into 20 mug/ml working solution by using sodium acetate buffer solutions (pH 5.5,pH 5.0,pH 4.5,pH 4.0) with different pH values, 50mM NaOH regenerating solution is prepared, electrostatic combination between antigens with different pH values and the surface of a chip (GE company) is analyzed by using a template method in a Biacore T100 protein interaction analysis system instrument, the signal increment amount reaches 5 times RL as a standard, and a proper most neutral pH system is selected and the antigen concentration is adjusted as required as the condition during coupling. The chip is coupled according to a template method in the instrument: wherein, the 1 channel selects a blank coupling mode, the 2 channel selects a Target coupling mode, and the Target is set as the designed theoretical coupling amount. The coupling process takes approximately 60 minutes.

3.2 analyte concentration setting Condition exploration and regeneration Condition optimization

And adopting a manual sample injection mode, selecting a 1, 2-channel 2-1 mode sample injection mode, and setting the flow rate to be 30 mu l/min. The sample injection conditions were 120 seconds and 30. Mu.l/min. Regeneration conditions were 30 seconds, 30. Mu.l/min. First, running buffer was kept empty until all baselines were stable. Nanobody solutions with large concentration spans were prepared for running buffer configurations, suggesting that 200 μg/ml,150 μg/ml,100 μg/ml,50 μg/ml,20 μg/ml,10 μg/ml,2 μg/ml were set. Preparing a regeneration solution, and selecting four pH gradient regeneration solutions of a glutamic acid hydrochloric acid system: 1.5,2.0,2.5,3.0. Samples of 200 μg/ml analyte were manually injected and 2 channels were observed for regeneration from the most neutral pH regeneration buffer until the response line after 2 channel regeneration returned to the same height as baseline. And manually feeding an analyte sample once again by 200 mug/ml, observing the signal change of the 2-1 channel, recording the binding amount, recovering the analyte sample again by 200 mug/ml after regenerating the regeneration solution which returns the response line to the base line in the last step, observing the signal change of the 2-1 channel, recording the comparison between the binding amount and the value of the binding amount just before, and if the deviation is less than 5%, confirming that the regeneration solution with the pH value is the optimal regeneration solution, and if the binding amount of the reinjection is lower, continuing to perform experiments by using the regeneration buffer solution with the lower pH value. And taking the selected optimal regeneration solution as a chip surface regeneration reagent after each sample injection. The analyte concentration samples set forth above were separately sampled and the binding capacity for each concentration was analyzed to finally determine the concentration gradient required for the affinity test.

3.3 affinity test

According to the optimized sample concentration gradient, regenerating the solution, and testing the affinity between the nano antibody and the antigen by using a template method (wherein the sampling condition is set to be 60 seconds, 30 mu l/min, the dissociation time is 600 seconds, and the regeneration condition is 30 seconds, 30 mu l/min) carried out by the instrument. The signal condition of the 2-1 channel is observed at any time. The affinity test procedure takes approximately 200 minutes.

3.4 analysis of results

The binding dissociation curve for selecting the appropriate several concentration gradients was 1: all curves were fitted in a 1binding mode to obtain 8 nanobodies with higher affinity for MHC II recombinant antigen, named G4, G9, H8, 2C10, 2D1, 2H4, 3A7, 3B8, respectively. The affinity values, binding constants and dissociation constant parameters of the 8-strain nanobody are shown in Table 6.

TABLE 6 Biacore analysis of nanobody affinity

EXAMPLE 4 construction and expression of immune antigen vector

The amino acid sequences of CEA (GenBank: CAE 75559.1), HE4 (GenBank: CAA 44869.1) and PCT (NP-001365878.1) were synthesized, and BamHI and EcoRI cleavage sites were added to both ends of the sequences, respectively, and the two cleavage sites were ligated to the vector pcDNA3.1 (+).

The expression mode of the immune antigen carrier is described by taking nano antibody 2H4 as an example: and amplifying the 2H4 sequence by PCR, adding a signal peptide (the amino acid sequence of the signal peptide is shown as SEQ ID NO. 6) at the N end of the 2H4 sequence, and adding a flexible peptide (the amino acid sequence of the flexible peptide is shown as SEQ ID NO. 7) at the C end. The PCR product was cloned into pcDNA3.1 (+) through two cleavage sites of HindIII and BamHI to obtain fusion immunogens 2H4-A (2H 4-CEA), 2H4-B (2H 4-HE 4), 2H4-C (2H 4-PCT). At the same time, three immunogen carriers were constructed without 2H4, namely immunogen A, B, C alone. The 293 cells in logarithmic growth were transfected with endotoxin-free large plasmids. After the transfected cells were obtained and cultured for 36 hours, the cell culture solution was poured into a 50ml centrifuge tube, 12000g was centrifuged for 5 minutes, the supernatant was collected, filtered with a 0.22 μm filter membrane, and the culture supernatant was purified by ion exchange chromatography. FIGS. 7 to 9 show the purification effect of SDS-PAGE for detecting immunogens (FIG. 7:M shows a rainbow 180 broad-spectrum protein Marker;1 shows a simple antigen A;2 shows a fusion antigen 2H4-A. FIG. 8:M shows a rainbow 180 broad-spectrum protein Marker;1 shows a simple antigen C;2 shows a fusion antigen 2H4-C. FIG. 9:M shows a rainbow 180 broad-spectrum protein Marker;1 shows a simple antigen B;2 shows a fusion antigen 2H 4-B). The immune antigen carrier of the other 7 antibodies is constructed with 2H4.

EXAMPLE 5 immune alpaca and immune Effect detection

5.1 immunization alpaca

8 healthy adult male alpaca heads are selected and named 1-8. Mixing recombinant immunogen A, B, C with Freund's adjuvant at a ratio of 1:1, and immunizing 1-3 alpaca respectively by back subcutaneous multipoint injection at an immunization interval of 2 weeks at 6-7 μg/Kg for 3-4 times. The 8-strain nanobody fusion immunogen A, B, C is respectively immunized with No. 1-8 alpaca in the same way.

5.2 detection of immune Effect

Serum was collected in small amounts before each immunization as a serum sample of antibodies after the previous immunization. Results ELISA were used to detect antibody titres, and the procedure was as follows: the corresponding antigen was diluted to 10. Mu.g/ml with CBS coating solution, 100. Mu.l per well was added to the ELISA plate, the plates were sealed, and the plates were shaken on a horizontal shaker for 3-5s. Standing and incubating for 24 hours at 4 ℃ and washing the plate for 4 times; blocking with 1% BSA, incubating for 1h at 37℃and washing the plate 4 times; diluting the serum to be tested and the negative serum according to the ratio of 1000-1000 ten thousand times, incubating for 1h at 37 ℃ for 4 times in 100 mu l of each hole; 100 μl of the sample was added per well according to 1:15000 diluted goat anti-alpaca IgG enzyme-labeled secondary antibody (product number ab 112786) marked by HRP is incubated for 1h at 37 ℃ and the plates are washed for 4 times; adding 100 μl TMB color developing solution into each hole, and keeping away from light at room temperature for 15-30min; mu.l of 2M H are added per well ₂ SO ₄ The OD value of each well is detected on an enzyme label instrument by taking 650nm as a reference wavelength and 450nm as a detection wavelength.

The line graph was drawn according to the change in antibody titer in alpaca bodies after each immunization, and the results are shown in fig. 10-12. FIG. 10 shows antibody titers after antigen A alone and fusion immunization; FIG. 11 shows antibody titers after C antigen immunization alone and fusion immunization; figure 12 shows antibody titers following B antigen immunization alone and fusion immunization. In 8-strain nanobody with higher affinity with MHC II recombinant antigen, G9, 2H4 and H8 can obviously improve the immunogenicity of immunogen, so that alpaca can generate a larger amount of specific antibodies. While the remaining 5 antibodies showed no significant effect.

The above description is only of the preferred embodiments of the present invention and is not intended to limit the present invention, but various modifications and variations can be made to the present invention by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

SEQUENCE LISTING

<110> Qingdao blessing biotechnology Co.Ltd

<120> an MHC II ligand, fusion protein and use thereof in animal immunization

<130> 2022603213

<160> 25

<170> PatentIn version 3.3

<210> 1

<211> 124

<212> PRT

<213> artificial sequence

<400> 1

Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Val Ala Ser Pro Arg Ala Leu Tyr His Arg

20 25 30

Trp Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val

35 40 45

Ala Gly Met Gly Ser Arg Gly Lys Gly Ala His Tyr Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Thr Ala Lys Asn Thr Val Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Thr Lys Ser Arg Lys His Ser Leu Met Leu Thr Gln Ser Pro Trp

100 105 110

Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser

115 120

<210> 2

<211> 372

<212> DNA

<213> artificial sequence

<400> 2

caggtgcagc tgcaggagtc tggaggagga ttggtgcagg ctggggggtc tctcagactc 60

tcctgtgtag cctctcctag ggctctgtat catcggtgga tggggtggtt ccgccaggct 120

cccgggaagg agcgtgaatt tgtcgcaggt atgggtagtc ggggtaaggg ggcgcattat 180

gcagactccg tgaagggccg attcaccatc tccagagaca ccgccaagaa cacggtgtat 240

ctgcaaatga acagtctgaa acctgaggac acggccgtct attactgtgc tactaagtcg 300

cggaagcatt ctcttatgct gacgcagtcg ccgtggtact ggggccaggg gacccaggtc 360

accgtctcct ca 372

<210> 3

<211> 8

<212> PRT

<213> artificial sequence

<400> 3

Pro Arg Ala Leu Tyr His Arg Trp

1 5

<210> 4

<211> 8

<212> PRT

<213> artificial sequence

<400> 4

Met Gly Ser Arg Gly Lys Gly Ala

1 5

<210> 5

<211> 17

<212> PRT

<213> artificial sequence

<400> 5

Ala Thr Lys Ser Arg Lys His Ser Leu Thr Leu Met Gln Ser Pro Trp

1 5 10 15

Tyr

<210> 6

<211> 20

<212> PRT

<213> artificial sequence

<400> 6

Met Glu Ser Pro Ala Gln Leu Leu Phe Leu Leu Leu Leu Trp Leu Pro

1 5 10 15

Asp Thr Gln Ala

20

<210> 7

<211> 35

<212> PRT

<213> artificial sequence

<400> 7

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly

1 5 10 15

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly

20 25 30

Gly Gly Ser

35

<210> 8

<211> 324

<212> DNA

<213> artificial sequence

<400> 8

ctgcaggagt ctggaggagg attggtgcag gctgggggct ctctgagact cgcctgcgca 60

gcctctggac gctccttcgg tacgtatggc tggtaccgcc aggctccagg gaaggagcgt 120

gagtttgtcg cagctattag ctggagtggt ggtagcattt ggtatgcaga ctccgtgaag 180

ggccgattca ccatctccag agacaacgcc aggaacacgg tgtatctcga aatgaacagc 240

ctgaaacctg aggacacggc catctattac tgtaatacag gcaatagtac cattgactac 300

tggggccagg ggacccaggt cacc 324

<210> 9

<211> 124

<212> PRT

<213> artificial sequence

<400> 9

Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Val Ala Ser Asn Lys Asn Asn Arg Ile Arg

20 25 30

Pro Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val

35 40 45

Ala Gly Leu Ser Leu Gly Gly Glu Leu Ile His Tyr Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Thr Ala Lys Asn Thr Val Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Thr Ser Met Ser Lys Pro Leu Arg Pro Gln Arg Val Gln Pro Thr Lys

100 105 110

Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser

115 120

<210> 10

<211> 372

<212> DNA

<213> artificial sequence

<400> 10

caggtgcagc tgcaggagtc tggaggagga ttggtgcagg ctggggggtc tctcagactc 60

tcctgtgtag cctctaataa gaataatagg attcggccga tggggtggtt ccgccaggct 120

cccgggaagg agcgtgaatt tgtcgcaggt ctttctctgg gtggtgagtt gattcattat 180

gcagactccg tgaagggccg attcaccatc tccagagaca ccgccaagaa cacggtgtat 240

ctgcaaatga acagtctgaa acctgaggac acggccgtct attactgtac ttcgatgtcg 300

aagcctctgc ggccgcagag ggttcagccg acgaagtact ggggccaggg gacccaggtc 360

accgtctcct ca 372

<210> 11

<211> 8

<212> PRT

<213> artificial sequence

<400> 11

Asn Lys Asn Asn Arg Ile Arg Pro

1 5

<210> 12

<211> 8

<212> PRT

<213> artificial sequence

<400> 12

Leu Ser Leu Gly Gly Glu Leu Ile

1 5

<210> 13

<211> 17

<212> PRT

<213> artificial sequence

<400> 13

Thr Ser Met Ser Lys Pro Leu Arg Pro Val Arg Gln Gln Pro Thr Lys

1 5 10 15

Tyr

<210> 14

<211> 119

<212> PRT

<213> artificial sequence

<400> 14

Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Val Ala Ser Arg His Thr Arg Ser Glu Leu

20 25 30

Arg Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val

35 40 45

Ala Gly Asn Tyr Ala Gly Arg Trp Lys Leu His Tyr Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Thr Ala Lys Asn Thr Val Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Ala Lys Pro Gln Arg Arg Asn Lys Lys Thr Tyr Trp Gly Gln Gly

100 105 110

Thr Gln Val Thr Val Ser Ser

115

<210> 15

<211> 357

<212> DNA

<213> artificial sequence

<400> 15

caggtgcagc tgcaggagtc tggaggagga ttggtgcagg ctggggggtc tctcagactc 60

tcctgtgtag cctctaggca tacgaggtcg gagcttcgga tggggtggtt ccgccaggct 120

cccgggaagg agcgtgaatt tgtcgcaggt aattatgcgg gtcggtggaa gctgcattat 180

gcagactccg tgaagggccg attcaccatc tccagagaca ccgccaagaa cacggtgtat 240

ctgcaaatga acagtctgaa acctgaggac acggccgtct attactgtgc ggcgaagcct 300

cagcggcgga ataagaagac ttactggggc caggggaccc aggtcaccgt ctcctca 357

<210> 16

<211> 8

<212> PRT

<213> artificial sequence

<400> 16

Arg His Thr Arg Ser Glu Leu Arg

1 5

<210> 17

<211> 8

<212> PRT

<213> artificial sequence

<400> 17

Asn Tyr Ala Gly Arg Trp Lys Leu

1 5

<210> 18

<211> 12

<212> PRT

<213> artificial sequence

<400> 18

Ala Ala Lys Pro Gln Arg Arg Asn Lys Lys Thr Tyr

1 5 10

<210> 19

<211> 20

<212> DNA

<213> artificial sequence

<400> 19

caggtgcagc tgcaggagtc 20

<210> 20

<211> 65

<212> DNA

<213> artificial sequence

<220>

<221> misc_feature

<222> (44)..(45)

<223> n is a, c, g, or t

<400> 20

aaattcacgc tccttcccgg gagcctggcg gaaccacccc atmnnagagg ctacacagga 60

gagtc 65

<210> 21

<211> 84

<212> DNA

<213> artificial sequence

<220>

<221> misc_feature

<222> (41)..(42)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (44)..(45)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (47)..(48)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (50)..(51)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (53)..(54)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (56)..(57)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (59)..(60)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (62)..(63)

<223> n is a, c, g, or t

<400> 21

ccgccaggct cccgggaagg agcgtgaatt tgtcgcaggt nnknnknnkn nknnknnknn 60

knnkcattat gcagactccg tgaa 84

<210> 22

<211> 64

<212> DNA

<213> artificial sequence

<220>

<221> misc_feature

<222> (22)..(23)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (25)..(26)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (28)..(29)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (31)..(32)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (34)..(35)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (37)..(38)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (40)..(41)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (43)..(44)

<223> n is a, c, g, or t

<400> 22

tgggtcccct ggccccagta mnnmnnmnnm nnmnnmnnmn nmnnacagta atagacggcc 60

gtgt 64

<210> 23

<211> 36

<212> DNA

<213> artificial sequence

<400> 23

tgaggagacg gtgacctggg tcccctggcc ccagta 36

<210> 24

<211> 21

<212> DNA

<213> artificial sequence

<400> 24

gccgctggat tgttattact c 21

<210> 25

<211> 21

<212> DNA

<213> artificial sequence

<400> 25

ctttcaacag tggaaccgta g 21

Claims

1. An MHC ii ligand, wherein the MHC ii ligand is a nanobody of MHC ii of anti-camel origin; the variable region amino acid sequence of the MHC II ligand has a CDR1 region shown as SEQ ID NO.3, a CDR2 region shown as SEQ ID NO.4 and a CDR3 region shown as SEQ ID NO. 5;

or, a CDR1 region as shown in SEQ ID NO.11, a CDR2 region as shown in SEQ ID NO.12, and a CDR3 region as shown in SEQ ID NO. 13;

or, a CDR1 region as shown in SEQ ID NO.16, a CDR2 region as shown in SEQ ID NO.17, and a CDR3 region as shown in SEQ ID NO. 18.

2. The MHC ii ligand of claim 1, wherein the variable domain amino acid sequence of the MHC ii ligand is as follows:

the amino acid sequence of the variable region of MHC II ligand 2H4 is shown as SEQ ID NO.1, wherein CDR1 is shown as SEQ ID NO.3, CDR2 is shown as SEQ ID NO.4, and CDR3 is shown as SEQ ID NO. 5;

or, the amino acid sequence of the variable region of MHC II ligand G9 is shown as SEQ ID NO.9, wherein CDR1 is shown as SEQ ID NO.11, CDR2 is shown as SEQ ID NO.12, and CDR3 is shown as SEQ ID NO. 13;

or, the amino acid sequence of the variable region of ligand MHC II ligand H8 is shown as SEQ ID NO.14, wherein CDR1 is shown as SEQ ID NO.16, CDR2 is shown as SEQ ID NO.17, and CDR3 is shown as SEQ ID NO. 18.

3. The MHC ii ligand of claim 2, further comprising a polypeptide derived from a modification of the amino acid sequence set forth in SEQ ID No.1, SEQ ID No.9 or SEQ ID No.14 by the addition of polyethylene glycol, streptavidin, biotin, a radioisotope, a fluorescent molecular marker.

4. Nucleic acid substance encoding an MHC ii ligand according to claim 2;

the nucleic acid substance is a nucleic acid capable of translating to the above MHC II ligand.

5. The nucleic acid substance of claim 4, wherein the nucleic acid sequence encoding MHC ii ligand 2H4 is as shown in SEQ ID No. 2;

or, the coding nucleic acid sequence of the MHC II ligand G9 is shown as SEQ ID NO. 10;

alternatively, the coding nucleic acid sequence of the MHC II ligand H8 is shown as SEQ ID NO. 15.

6. An expression vector comprising the nucleic acid agent of claim 4;

the expression vector comprises bacterial plasmids, bacteriophage, yeast plasmids, plant cell viruses and mammalian cell viruses.

7. The expression vector of claim 6, wherein the expression vector is a bacterial plasmid or a yeast plasmid.

8. A host cell of the nucleic acid agent of claim 5 and/or the expression vector of claim 6;

the host cell is a microbial cell.

9. The host cell of claim 8, wherein the host cell is e.

10. A fusion protein comprising an MHC ii ligand according to any one of claims 1 to 3 linked to an immunogenic antigen selected from CEA, HE4, PCT.

11. The fusion protein of claim 10, wherein the MHC ii ligand is linked to the immune antigen by a covalent bond or by a linking peptide, the linking peptide being (GGGGS) _n Wherein n is any integer from 1 to 7.

12. The fusion protein of claim 11, wherein n = 7.

13. Use of an MHC ii ligand according to any of claims 1-3, a fusion protein according to any of claims 10-12 for the preparation of an animal immune formulation.

14. Use of an MHC ii ligand, fusion protein as claimed in claim 13 in the preparation of an animal immune formulation, wherein said use comprises any of the following: (1) Using said MHC ii ligand or said fusion protein for the preparation of a vaccine;

(2) Using said MHC ii ligand or said fusion protein for the development of a biochemical detection reagent;

in the above (2), the biochemical detection reagent is specifically a capture antibody or detection antibody reagent of CEA, HE4, PCT, and is used in a detection method and a kit based on antibody specific recognition.