CN110423273B

CN110423273B - Anti-pseudomonas aeruginosa exotoxin A nano antibody and application thereof

Info

Publication number: CN110423273B
Application number: CN201910761071.6A
Authority: CN
Inventors: 宋海鹏; 刘原源; 于建立; 黄琪; 古一; 李飞; 周宇航; 王欢; 李靖婵
Original assignee: Shenzhen Guochuang Nano Antibody Technology Co ltd
Current assignee: Shenzhen Guochuang Nano Antibody Technology Co ltd
Priority date: 2017-11-01
Filing date: 2017-11-01
Publication date: 2022-03-11
Anticipated expiration: 2037-11-01
Also published as: CN110423274B; CN107827981A; CN107827981B; CN110423273A; CN110423274A

Abstract

The invention discloses a nano antibody with high neutralizing activity and anti-pseudomonas aeruginosa exotoxin A, which has unique 3 complementarity determining regions CDR1, CDR2 and CDR3, and also discloses application of the nano antibody in preparation of anti-PE toxin drugs. The anti-PE toxin nano antibody provided by the invention has specific recognition and binding capacity on PE toxin and can effectively neutralize the toxicity of the PE toxin, thereby protecting normal cells.

Description

Anti-pseudomonas aeruginosa exotoxin A nano antibody and application thereof

The patent application of the invention is a divisional application of a Chinese patent application 'nano antibody against pseudomonas aeruginosa exotoxin A and application thereof' with the application date of 2017, 11 month and 1 day and the application number of CN 201711059631.0.

Technical Field

The invention discloses a nano antibody, belonging to the field of immunology.

Background

Pseudomonas aeruginosa, also known as Pseudomonas aeruginosa (academic name), is a gram-negative, aerobic, long rod-shaped bacterium with unidirectional motility. Pseudomonas aeruginosa was first isolated from wound pus by Gersard in 1882. The bacterium is widely existed in water, soil, air and intestinal tract and skin of animals in nature, is a conditioned pathogen, and can cause infection and morbidity of human and animals under specific conditions.

In 1972, p.v. liu found a virulence factor, Exotoxin a, in the culture of clinical isolates, which caused infection with pseudomonas aeruginosa, and indicated that pseudomonas aeruginosa Exotoxin a (PE) had a necrotic effect on the skin mucosa and could induce sepsis when entering the blood. In organ tissue cells, pseudomonas aeruginosa exotoxin a has an effect of inhibiting protein synthesis, similar to diphtheria toxin; has high sensitivity to mice and rats, has lethal effect, and has 'cell disintegrating toxicity' to cultured cells. The pseudomonas aeruginosa exotoxin A has very strong toxicity, can cause great harm to body tissues and organs, and even can destroy corneal stromal cells. In order to explore methods for effectively controlling and treating diseases related to pseudomonas aeruginosa exotoxin a, researches on the biological characteristics and pathogenicity of pseudomonas aeruginosa exotoxin a are increasing.

The existing research results show that the pseudomonas aeruginosa exotoxin a is a 66kD single-chain toxin protein which has three structural domains, wherein the Ia region is mainly responsible for the recognition of cells and enables PE to be combined with target cells; zone II is a translocation zone which allows it to enter the human cytoplasm; region iii is the active region, catalyzing Elongation Factor 2 (EF 2)) ADP ribosylation, leading to EF2 inactivation, hindering protein synthesis, and ultimately leading to cell death; the function of the Ib region is not known so far, but deletion of most amino acids does not affect the activity of the toxin molecule. PE is one of the most effective cytotoxins known at present, and is more suitable for gene modification than other toxins because of integrating three functions of cell binding, translocation and enzyme activity, thereby meeting the requirement of constructing recombinant immunotoxins. The modified PE lacking the cell recognition region is one of the most commonly used toxin proteins at present, and can exert the effects of damaging and killing cells by inhibiting the synthesis of cell proteins. Due to the characteristics, the PE is combined with a specific carrier (such as a monoclonal antibody, a cytokine and the like) to form a corresponding immunotoxin, and the immunotoxin can be used for the targeted therapy research of tumors.

Based on the outstanding characteristics of PE toxin in clinical pathology and the great application prospect of PE toxin as an immunotoxin component in the field of clinical treatment, particularly tumor treatment, the development of a specific neutralizing antibody aiming at PE toxin and the improvement of clinical diagnosis and treatment efficiency become urgent needs of the prior art.

However, the conventional antibodies have some disadvantages, such as low affinity, low immune recognition efficiency, and difficulty in achieving ideal binding and neutralizing effects for some antigens and toxins with high hiding degree.

In 1993, Hamers-Casterman et al found that a class of heavy chain-only dimers (H) was found in camelids (camels, dromedary and llamas) in vivo₂) Antibodies of the type IgG2 and IgG3, which are predominantly of the IgG2 and IgG3, are also referred to as single domain antibodies or single domain antibodies (sdabs) because they lack a light chain and are thus referred to as Heavy chain-only antibodies (HCAbs), whereas their antigen binding site consists of one domain, referred to as a VHH region. Because the antibody is dessertedThe sequence of the variable region after the localization has a molecular weight of only 15kD, a diameter of about 10 nm, and is therefore also referred to as nanobodies (Nbs). In addition, such single domain antibodies, called VNARs, are also observed in sharks. This heavy chain-only antibody was originally recognized only as a pathological form of a human B-cell proliferative disease (heavy chain disease). This heavy chain-only antibody may be due to genomic level mutations and deletions that result in the inability of the heavy chain CH1 domain to be expressed, such that the expressed heavy chain lacks CH1 and thus lacks the ability to bind to the light chain, thus forming a heavy chain dimer.

Nanobodies are comparable in affinity to their corresponding scFv, but surpass scfvs in solubility, stability, resistance to aggregation, refolding, expression yield, and ease of DNA manipulation, library construction, and 3-D structure determination, relative to scfvs of conventional four-chain antibodies.

Nanobodies have minimal functional antigen-binding fragments derived from HCabs in adult camelids, have high stability and high avidity for antigen binding, and can interact with protein clefts and enzymatic active sites, making their action similar to inhibitors. Therefore, the nano-antibody can provide a new idea for designing small molecule enzyme inhibitors from peptide-mimetic drugs. Due to the heavy chain only, nanobodies are easier to manufacture than monoclonal antibodies. The unique properties of nanobodies, such as stability in extreme temperature and pH environments, allow for large yields to be produced at low cost. Therefore, the nano antibody has great value in the treatment and diagnosis of diseases and has great development prospect in the antibody target diagnosis and treatment of tumors.

The invention aims to provide the anti-PE toxin nano antibody which can fully exert the excellent performance of the nano antibody and overcome the inherent defects of the nano antibody, and further provides the application of the anti-PE toxin nano antibody in the fields of PE toxin detection and pharmacy.

Disclosure of Invention

Based on the above objects, the present invention provides a nanobody with high affinity activity against pseudomonas aeruginosa exotoxin a, wherein the variable region of the nanobody has 3 complementarity determining regions CDR1, CDR2, and CDR3, wherein the CDR1 sequence consists of the amino acid sequence depicted in SEQ ID No.7, the CDR2 sequence consists of the amino acid sequence depicted in SEQ ID No.8, and the CDR3 sequence consists of the amino acid sequence depicted in SEQ ID No. 9.

In a preferred technical scheme, the variable region sequence of the nanobody consists of the amino acid sequence shown in SEQ ID NO. 10.

Secondly, the invention also provides an antibody containing the variable region of the nano antibody, wherein the antibody also has a constant region, and the sequence of the constant region of the antibody consists of the amino acid sequence shown in SEQ ID NO. 11.

Thirdly, the invention also provides a polynucleotide for coding the antibody sequence, and the sequence of the polynucleotide is shown by SEQ ID NO. 12.

Fourth, the present invention provides an expression vector comprising the above polynucleotide.

In a preferred embodiment, the vector is pMES 4.

Fifth, the present invention provides a host cell containing the above expression vector.

In a preferred embodiment, the cell is E.coli BL21(DE 3).

Sixth, the invention also provides application of the nano antibody in preparation of anti-PE toxin drugs.

Finally, the invention provides a nanobody composition comprising a nanobody having an amino acid sequence whose variable region is represented by SEQ ID No. 10.

The nano antibody for resisting pseudomonas aeruginosa exotoxin A provided by the invention has unique CDR1, 2 and 3 region sequences, so that the antibody has specific recognition and binding capacity on pseudomonas aeruginosa exotoxin A antigen. The affinity of the nano antibody reaches 10^-8The nano antibody provided by the invention has high specific binding activity.

The nanobody provided by the invention also shows application in the aspect of toxin neutralization. In the embodiment of the invention, the nano antibody has obvious effects of neutralizing toxin and protecting cells, and can effectively reduce the inhibition rate of PE toxin on the cells, thereby playing a role in protecting the cells.

Drawings

FIG. 1 is a diagram of plasmid double restriction enzyme identification of recombinant PE immunotoxin vector;

FIG. 2 shows SDS-PAGE electrophoresis identification chart of recombinant PE immunotoxin expression and purification;

FIG. 3 shows SDS-PAGE electrophoretic identification of HIS tag excision by recombinant PE immunotoxin;

FIG. 4 is a schematic diagram of the PMES4 expression vector structure;

FIG. 5 shows the first round of PCR amplification of antibody variable region gene electrophoresis identification map;

FIG. 6 shows the second round of PCR amplification of antibody variable region gene electrophoresis identification map;

FIG. 7 shows the electrophoretic identification chart of the product of the double digestion reaction with pMES4 vector;

FIG. 8 is a graph showing the results of electrotransformation of antibody libraries;

FIG. 9 shows the electrophoretic identification chart of the transformant identified by colony PCR;

FIG. 10 is an SDS-PAGE identification of nanobody purification;

FIG. 11 is a graph showing the dissociation of the binding between nanobody and PE antigen;

FIG. 12 is a graph of the neutralizing effect of the in vitro cellular PE toxicity of the nanobody.

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. These examples are only illustrative and do not limit the scope of the present invention.

Example 1 prokaryotic expression and purification of recombinant PE immunotoxins

1.1 prokaryotic expression of recombinant PE immunotoxins

The partially sequence of PE toxin (AE004091.2) plasmid PE-PUC57 (synthesized by Jinwei Zhi Co.) synthesized by the whole gene and the vector pET28a were digested simultaneously with Nco I and Not I (purchased from NEB Co.) to recover a 1.4kb target gene fragment, which was then digested with T₄DNA ligase connection, named PE-Pet28a, BL21 host bacteria transformation, kanamycin resistance screening, positive colony selection, amplification and plasmid extraction, and NcIdentification of the two enzymes oI and Not I (FIG. 1: M is Trans 2K plus DNA marker; 1 is PE-Pet28a double restriction products of Nco I and Not I). The correct identified strains were amplified overnight and then tested as 1: inoculating 50% of the seed in 200ml Kan⁺Amplification to OD at 37 ℃ in LB Medium₆₀₀When the concentration is about 0.6, IPTG is added to the final concentration of 1mmol/L, and the induction is carried out for 6 hours.

1.2 purification of recombinant PE immunotoxins

The thalli is collected by centrifugation at 8000 r/min at 4 ℃ for 10 minutes according to the volume ratio of 1: adding PBS solution according to the proportion of 20, carrying out ultrasonic bacteria breaking until the bacteria are clear, and collecting supernatant at 8000 r/min again. Purification with Ni-NTA resin, elution with imidazole at various concentrations and collection, and electrophoretic analysis of the reduced protein in the collected samples (FIG. 2: M for PageRuler)^TMPrestained Protein Ladder; 1 is 20mM imidazole eluted product; 2 is 80mM imidazole eluted product; 3 is 100mM imidazole eluate; 4 was 200mM imidazole eluted product) and finally PE toxin was dialyzed into PBS.

1.3 recombinant PE immunotoxin excision HIS tag

The ratio of enterokinase 1: 8000, adding diluted enterokinase into the purified recombinant PE immunotoxin, carrying out enzyme digestion at 37 ℃ for 3 hours, and carrying out reduced protein electrophoresis analysis on the enzyme-digested PE toxin protein (in figure 3, M is rainbow 180 broad-spectrum protein Marker; 1 is non-enzyme-digested recombinant PE immunotoxin protein; 2 is a product of enzyme digestion of PE immunotoxin protein for 2 hours; and 3 is a product of enzyme digestion of PE immunotoxin protein for 3 hours). The HIS-tag-cleaved PE protein was recovered with Ni-NTA resin, and the permeate was collected.

Example 2 construction and screening of anti-PE Nanobody phage display library

2.1 immunization of alpaca

Selecting one healthy adult alpaca, uniformly mixing the recombinant protein PE and Freund's adjuvant according to the proportion of 1:1, immunizing the alpaca by adopting a back subcutaneous multipoint injection mode according to 6-7 mu g/Kg for four times, wherein the immunization interval is 2 weeks. And collecting alpaca peripheral blood for constructing a phage display library.

2.2 isolation of Camel-derived lymphocytes

In accordance with the technical fieldRoutine procedure lymphocytes were analyzed from pooled camel-derived anticoagulated whole blood every 2.5X 10⁷1mL of RNA isolation reagent was added to each living cell, 1mL of the reagent was extracted with RNA, and the remaining cells were stored at-80 ℃.

2.3 Total RNA extraction

Total RNA was extracted according to the routine procedures in the art and adjusted to 1. mu.g/. mu.L with RNase-free water.

2.4 Synthesis of cDNA by reverse transcription

The cDNA was reverse-transcribed using the RNA obtained in the 2.3 step as a template according to the reverse transcription KIT (Transcriptor first stand cDNA Synthesis KIT from Roche).

2.5 antibody variable region Gene amplification

And carrying out PCR reaction by using cDNA obtained by reverse transcription as a template. Amplification was performed in two rounds, and the primer sequences for the first round of PCR were as follows:

CALL001：GTCCTGGCTGCTCTTCTACAAGG

CALL002：GGTACGTGCTGTTGAACTGTTCC

the PCR reaction conditions and procedures were: 5 minutes at 95 ℃; 30 cycles of 95 ℃ for 30 seconds, 57 ℃ for 30 seconds, 72 ℃ for 30 seconds; the band of about 700bp was recovered at 72 ℃ for 7 minutes using an agarose gel recovery kit gel, and the nucleic acid concentration was finally adjusted to 5 ng/. mu.l with water (FIG. 5: M is Trans 2K DNA Marker; 1 is the first round PCR product).

The primer sequences for the second round of PCR were as follows:

VHH-Back：GATGTGCAGCTGCAGGAGTCTGGRGGAGG

VHH-For：CTAGTGCGGCCGCTGGAGACGGTGACCTGGGT

the PCR reaction conditions and procedures were: 5 minutes at 95 ℃; 30 seconds at 95 ℃, 30 seconds at 55 ℃, 30 seconds at 72 ℃ and 15 cycles; the PCR product was purified using the PCR product recovery kit at 72 ℃ for 7 minutes (FIG. 6: M is Trans 2K DNA Marker; 1 is second round PCR product).

2.6 vector construction

pMES4 (purchased from Biovector, whose schematic structure is shown in FIG. 4) was double digested with PstI and BstEII, respectively, to obtain 1.5. mu.g of the digested vector and 450ng of the digested second PCR product, 15. mu. L T4 of DNA ligase was added, buffer and water were supplemented to a total volume of 150. mu.L, ligation was performed overnight at 16 ℃ and the ligation product was recovered. Product recovery was performed using a PCR product recovery kit, eluting with 20. mu.L water. The double-restriction enzyme digestion result of the pMES4 vector was detected by 1% agarose electrophoresis gel (FIG. 7: M is Trans 2K DNA Marker; 1 is pMES4 vector plasmid which has not been restricted; and 2 is pMES4 vector product after double-restriction enzyme digestion).

2.7 electrotransformation and determination of the storage volume

mu.L of the purified ligation product was taken, and added to a pre-cooled electric cuvette containing 50. mu.L of E.coli TG1 competent cells, and the electric cuvette was placed in an electric converter (ECM 630 electric converter of BTX, USA) for electric conversion, and the electric cuvette was taken out, and the transformant was recovered and cultured (FIG. 8 is a transformation culture plate). 18 clones were randomly selected and subjected to colony PCR identification (FIG. 9: M is Trans 2K DNA Marker; 1-18 are randomly selected single clone PCR identification products). The pool capacity (pool capacity ═ number of clones × dilution × positive rate of PCR identification × 10) was estimated from the PCR positive rate.

The primer sequences are as follows:

MP57：TTATGCTTCCGGCTCGTATG

GIII：CCACAGACAGCCCTCATAG

2.8 phage amplification

Inoculating recovered bacteria solution into YT-AG culture medium, culturing at 37 deg.C and 200rpm until culture OD₆₀₀0.5. 10ml of the bacterial suspension was taken out and added to 4X 10¹⁰VCSM13, 30 min at 37 ℃ for static infection. At 4000rpm, the mixture was centrifuged at room temperature for 10 minutes, and the supernatant was removed. The cells were resuspended in 2 XYT-AK (ampicillin and kanamycin-containing) medium and cultured overnight at 37 ℃ and 200 rpm. Centrifuging, taking a supernatant in a 40ml tube, adding 10ml of PEG/NaCl (20%/2.5M) solution, mixing thoroughly, centrifuging, discarding the supernatant, washing the precipitate with 1ml of ice PBS, centrifuging, taking 250 μ l of precooled PEG/NaCl from the supernatant, mixing thoroughly, washing and resuspending.

Determining the phage titer: TG1 was cultured to OD₆₀₀When the phage was diluted with LB medium in a gradient manner at 0.4, the phage TG1 culture was mixed and cultured in a double dilution manner, and the plaque formation in the plate was observed the next day, and the number of plaques was counted on a dilution gradient plate of 30 to 300 and the phage titer (pfu) was calculated according to the following equation.

Phage titer (pfu/ml) dilution times plaque number times 100

2.9 Nanobody screening

Positive clones were screened by ELISA with recombinant PE antigen. ELISA plates were coated with recombinant PE antigen, blocked with 5% BSA, and washed with PBST. Mu.l phage supernatant was added to each well and left at 37 ℃ for 1 hour. The supernatant was discarded, and a secondary HRP-labeled mouse anti-M13 antibody was added thereto and the mixture was left at 37 ℃ for 1 hour. The supernatant was discarded, TMB solution was added, incubation was carried out at room temperature for 5 hours, 2M sulfuric acid stop solution was added to each well, and reading was carried out with a microplate reader at 450 nm.

2.10 expression and purification of Nanobodies in E.coli

Selecting the clone with positive phage ELSIA result, extracting plasmid and transforming to strain BL₂₁Competent cells, inducing expression of the nanobody protein with IPTG, collecting the supernatant (periplasmic extract), dialyzing the periplasmic extract into PBS, purifying with Ni-NTA resin, eluting and collecting with imidazole of different concentrations, performing reduced protein electrophoresis analysis on the collected sample, and finally dialyzing the nanobody into PBS.

3 strains of PE-resistant nano antibodies are screened out through alpaca immunization, cell separation, construction of a phage library and screening of the nano antibodies. The sequencing results were analyzed using Vector NTI software, and the entries IMGT (see Table II)http://www.imgt.org/ IMGT_vquest) Antibody light and heavy chain genes were analyzed to determine the Framework Regions (FR) and Complementarity Determining Regions (CDR) of the variable Regions.

The heavy chain nucleotide sequence of the nano antibody VHH-PE 1 is shown as SEQ ID NO.6, the amino acid sequence of the variable region is shown as SEQ ID NO.4, wherein the amino acid sequence at the 1 st to 20 th positions is FR1, the amino acid sequence at the 21 st to 37 th positions is CDR1, the amino acid sequence at the 38 th to 51 th positions is FR2, the amino acid sequence at the 52 th to 68 th positions is CDR2, the amino acid sequence at the 69 th to 100 th positions is FR3, the amino acid sequence at the 101 th and the 120 th positions is CDR3, the amino acid sequence at the 121 th and the 126 th positions is FR4, and the amino acid sequence of the constant region is shown as SEQ ID NO. 5.

The heavy chain nucleotide sequence of the nano antibody VHH-PE 2 is shown as SEQ ID NO.12, the amino acid sequence of the variable region is shown as SEQ ID NO.10, wherein the amino acid sequence at the 1 st to 20 th positions is FR1, the amino acid sequence at the 21 st to 32 th positions is CDR1, the amino acid sequence at the 33 th to 46 th positions is FR2, the amino acid sequence at the 47 th to 63 th positions is CDR2, the amino acid sequence at the 64 th to 95 th positions is FR3, the amino acid sequence at the 96 th to 111 th positions is CDR3, the amino acid sequence at the 112 th and 117 th positions is FR4, and the amino acid sequence of the constant region is shown as SEQ ID NO. 11.

The heavy chain nucleotide sequence of the nano antibody VHH-PE 3 is SEQ ID NO.18, the amino acid sequence of the variable region is SEQ ID NO.16, wherein the amino acid sequences at the 1 st to 20 th positions are FR1, the amino acid sequences at the 21 st to 32 th positions are CDR1, the amino acid sequences at the 33 th to 46 th positions are FR2, the amino acid sequences at the 47 th to 63 th positions are CDR2, the amino acid sequences at the 64 th to 95 th positions are FR3, the amino acid sequences at the 96 th to 111 th positions are CDR3, the amino acid sequence at the 112 th and 117 th positions is FR4, and the amino acid sequence of the constant region is shown in SEQ ID NO. 17.

Example 3 preparation of anti-PE Nanobodies

3.1 amplification of original strain TG1 of nano antibody and transformation of Escherichia coli BL by recombinant plasmid of nano antibody₂₁(DE₃)

Performing a reaction on an original strain TG1 glycerol strain containing nano antibody nucleic acid according to the ratio of 1: the culture was inoculated at 1000 ratio to 5mL of fresh LB-A medium and cultured overnight at 37 ℃ and 200 rpm. The following day, Plasmid was extracted using a Plasmid mini kit (OMEGA) as per the instructions. After verification, 1. mu.l of the plasmid was transformed into 100. mu.l of competent cells, gently mixed, placed on ice for 30 minutes, heat-shocked in a water bath at 42 ℃ for 90 seconds, and cooled in an ice bath for 3 minutes. 600. mu.l of LB medium was added to the centrifuge tube, and the tube was cultured with shaking at 37 ℃ for 60 minutes. 100. mu.l of the supernatant was applied to an LB-A plate using a triangle spreader and cultured overnight at 37 ℃ in an inverted state.

3.2 Induction expression and extraction of Nanobodies

The above monoclonal colonies were picked up in LB-A medium and cultured overnight with shaking at 37 ℃. The next day, the bacterial liquid was taken according to the ratio of 1: adding 100ml of fresh LB-A culture medium in a proportion of 100, and performing shaking culture at 37 ℃ for 3 hours until the bacterial liquid OD₆₀₀After adding IPTG to a final concentration of 1mM, the mixture was induced overnight at 30 ℃. On the third day, 8000rpm, the cells were collected by centrifugation for 10 minutes, and 1.5mL of precooled TES buffer was added to resuspend the pellet. After 2 minutes in ice bath, gently shake for 30 seconds and repeat this cycle 6 times. Adding 3.0mTES/4 (TES diluted 4 fold with water), gently shaken for 30 seconds, then allowed to stand on an ice bath for 2 minutes, and the shaking and standing steps were repeated a total of 6 times. After centrifugation at 9000rpm at 4 ℃ for 10 minutes, about 4.5mL of the supernatant (periplasmic extract) was collected and subjected to protein electrophoresis.

3.3 purification and characterization of Nanobodies

After resuspending IMAC Sepharose (GE Co.), 2ml was added to the gravity column, and the column was allowed to stand for 30 minutes to allow Sepharose to naturally settle at the bottom of the gravity column, and the preservation buffer was discharged. Adding 2 column volumes of nickel sulfate solution (0.1M) and flowing out the nickel sulfate solution at a flow rate of about 8 seconds per drop; adding 10 times of column volume of balance buffer solution to balance and wash sepharose, and keeping the flow rate unchanged; diluting the sample by 2 times of a balance buffer solution, adding the diluted sample into a gravity column, adjusting the flow rate to be 6 seconds/drop, and collecting the penetration liquid; adding 10 times of column volume of washing buffer solution to wash sepharose, maintaining the flow rate unchanged, and collecting washing solution; adding elution buffer solution with the volume being 3 times of that of the column, maintaining the flow rate at 6 seconds per drop, and collecting the eluent containing the target protein; finally sepharose was washed by sequentially adding 10 column volumes of equilibration buffer, 10 column volumes of pure water and 10 column volumes of 20% ethanol, and finally 4ml of 20% ethanol was retained to preserve the column. The collected samples were subjected to SDS-PAGE detection (FIG. 10: M is a rainbow 180 broad-spectrum protein Marker; 1-3 are Escherichia coli induced expression purified nanobodies VHH-PE 1, VHH-PE 2 and VHH-PE 3).

Example 4 affinity Activity of anti-PE Nanobodies with PE antigens

4.1 chip antigen coupling

Preparing the antigen into working solution of 20 mu g/mL by using sodium acetate buffer solutions (pH 5.5, pH 5.0, pH 4.5 and pH 4.0) with different pH values, preparing 50mM NaOH regeneration solution, analyzing the electrostatic binding between the antigen and the surface of a chip (GE company) under different pH conditions by using a template method in a Biacore T100 protein interaction analysis system instrument, selecting a proper most neutral pH system by taking the quantity of signal increase reaching 5 times RL as a standard, and adjusting the antigen concentration as required to serve as the condition during coupling. Coupling the chip according to a template method carried by the instrument: wherein, the 1 channel selects a blank coupling mode, the 2 channel selects a Target coupling mode, and the Target is set as a designed theoretical coupling quantity. The coupling procedure took approximately 60 minutes.

4.2 analyte concentration setting Condition exploration and regeneration Condition optimization

A manual sample injection mode is adopted, a 1, 2-channel 2-1 mode is selected for sample injection, and the flow rate is set to be 30 mu L/min. The injection conditions were 120 seconds and 30. mu.L/min. Regeneration conditions were 30 seconds, 30. mu.L/min. The buffer was run continuously empty first until all baselines were stable. The nanobody solution with larger concentration span is prepared to be configured with the running buffer, and 200. mu.g/mL, 150. mu.g/mL, 100. mu.g/mL, 50. mu.g/mL, 20. mu.g/mL, 10. mu.g/mL and 2. mu.g/mL are suggested to be set. Preparing a regeneration solution, selecting the regeneration solution with four pH gradients of a glutamate acid system: 1.5,2.0,2.5,3.0. A200. mu.g/mL sample of analyte was manually injected and the 2-channel was observed, regenerating from the most neutral pH regeneration buffer until the line of response after 2-channel regeneration returned to the same height as the baseline. And manually injecting a sample of 200 mu g/mL of analyte once again, observing the signal change of the 2-1 channel and recording the binding capacity, regenerating by using a regeneration solution which finally returns the response line to the base line in the previous step, then manually injecting a sample of 200 mu g/mL of analyte once again, observing the signal change of the 2-1 channel and recording the binding capacity, comparing with the value of the previous binding capacity, if the deviation is less than 5 percent, determining that the regeneration solution with the pH value is the optimal regeneration solution, and if the binding capacity of re-injection is lower, continuing to perform the experiment by using a regeneration buffer solution with lower pH value. And taking the selected optimal regeneration solution as a chip surface regeneration reagent after each sample introduction. And respectively injecting analyte concentration samples arranged on the sample injection device, and analyzing the binding capacity of each concentration to finally determine the concentration gradient required by the affinity test.

4.3 affinity assay

According to the optimized sample concentration gradient, the solution is regenerated, and the affinity between the nano antibody and the antigen is tested by using a template method carried by the instrument (wherein the sample introduction condition is set to be 60 seconds and 30 mu L/min; the dissociation time is 600 seconds, and the regeneration condition is set to be 30 seconds and 30 mu L/min). The signal condition of the 2-1 channel is observed at any time. The affinity testing process took approximately 200 minutes. In a specific experiment, PE nanobodies on a chip were captured to appropriate signal values and then injected onto the chip with system running buffer HBS-EP (10mM HEPES, 150mM NaCl, 3mM EDTA, 0.05% P20) at a flow rate of 30 μ L/min to obtain a dynamic process of nanobody interaction with PE antigen. The ability of 3 PE nanobodies to bind and dissociate from PE antigen was tested using this method, respectively.

4.4 analysis of results

And (3) selecting proper binding and dissociation curves of a plurality of concentration gradients, fitting all the curves by adopting a 1: 1binding mode, and finally obtaining important parameters such as affinity values, binding constants, dissociation constants and the like. The affinity of the three screened nano-antibodies reaches 10^-8. VHH-PE 1 binds fastest, VHH-PE 2 dissociates slowest, and the binding time is longer than that of VHH-PE 1 (see FIG. 11 for the binding dissociation curve). VHH-PE 3 affinity values were highest.

Table 1: nanobody affinity data

Sample numbering	Binding constant	Dissociation constant	Affinity of
				VHH-PE 1	3.684×10⁺⁵	0.004483	1.22E-08
VHH-PE 2	1.953×10⁺⁴	9.469×10^-5	4.85E-09
				VHH-PE 3	1.607×10⁺⁶	0.005506	3.42E-09

。

Example 5 in vitro tumor cell assay for neutralizing immunotoxin effect of anti-PE Nanobody

5.1 inhibition Rate of native PE immunotoxin against A431 cells and SK-OV3 cells

Two strains of nano antibodies VHH-PE 1 and VHH-PE 2 with moderate affinity are selected for in vitro cell experiments. The toxic effect of PE immunotoxins on cells is related to the amount of EGFR on the cell surface. Therefore, the tumor cells A431 (from ATCC) and SK-OV3 (from ATCC) used in this experiment were two types of tumor cells with a large difference in the amount of EGFR on the cell surface. The number of EGFR on the A431 cell surface is about 3X 10⁶The number of EGFR on the surface of SK-OV3 cells is less than 2 x 10⁵. Cytotoxicity experiments were performed using the MTT assay (MTT cell proliferation and cytotoxicity assay kit). A431 (purchased from ATCC) cells were seeded into 96-well plates at 6,000 cells per well and 5% CO at 37 deg.C₂Incubate for 24 hours. Natural PE antigen (purchased from SIGMA) was added at a final concentration of 5ug/ml followed by 2 antibodies at final concentrations of 160. mu.L/ml, 80. mu.L/ml, 40. mu.L/ml, 20. mu.L/ml, 10. mu.L/ml, 5. mu.L/ml, 2.5. mu.L/ml, each antibody concentration being triplicated. A blank control was set with PBS solution, a negative control was set with pure antigen, and pure antibody was used as a positive control. Placing in a constant temperature incubator at 37 deg.C and 5% CO₂And incubated for 24 hours. The medium was discarded and 10ul MTT and 100ul fresh medium were added and incubated for 4 hours. The medium was then discarded and 110ul of Formazan solvent was added and shaken at low speed for 10 minutes. Finally, measurement by enzyme-linked immunosorbent assay (570nm)And (3) comparing the absorbance of each hole with the inhibition rate of the natural PE immunotoxin on A431 and SK-OV3 tumor cells before and after the addition of the nano antibody.

5.2 analysis of results

The inhibition rate of the natural PE toxin to A431 cells reaches 92% without adding the antibody, and the inhibition rate to SK-OV3 cells reaches 100%. After the nano-antibody with different concentrations is added, the inhibition rate of A431 cells is gradually reduced, and the inhibition rate of SK-OV3 cells is not changed. The results show that the antibody concentration of 40ug/ml has obvious protective effect on the cells. When the antibody concentration reaches 80ug/ml, the protection of the cells tends to be smooth (the inhibition rate graph is shown in figure 12).

Sequence listing

<110> Shenzhen Shang Nanobody technology Limited

<120> high-neutralization-activity anti-pseudomonas aeruginosa exotoxin A nano antibody and application thereof

<160> 18

<170> SIPOSequenceListing 1.0

<210> 1

<211> 17

<212> PRT

<213> Lama pacos

<400> 1

Gly Arg Thr Phe Ser Ser Thr Gly His Thr Phe Ser Ser Tyr Ala Met

1 5 10 15

Gly

<210> 2

<211> 17

<212> PRT

<213> Lama pacos

<400> 2

Ala Ile Ser Trp Ser Gly Thr Ser Thr Tyr Tyr Ala Asp Ser Val Lys

1 5 10 15

Gly

<210> 3

<211> 20

<212> PRT

<213> Lama pacos

<400> 3

Arg Phe Trp Asp Tyr Gly Leu Gly Ser Ser Asp Leu Lys Ser Pro Arg

1 5 10 15

Glu Tyr Asp Tyr

20

<210> 4

<211> 126

<212> PRT

<213> Lama pacos

<400> 4

Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly Ser Leu Arg Leu Ser

1 5 10 15

Cys Ala Ala Ser Gly Arg Thr Phe Ser Ser Thr Gly His Thr Phe Ser

20 25 30

Ser Tyr Ala Met Gly Trp Phe Arg Gln Thr Pro Gly Lys Glu Arg Glu

35 40 45

Phe Val Ala Ala Ile Ser Trp Ser Gly Thr Ser Thr Tyr Tyr Ala Asp

50 55 60

Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr

65 70 75 80

Val Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr

85 90 95

Tyr Cys Ala Ala Arg Phe Trp Asp Tyr Gly Leu Gly Ser Ser Asp Leu

100 105 110

Lys Ser Pro Arg Glu Tyr Asp Tyr Trp Gly Gln Gly Thr Gln

115 120 125

<210> 5

<211> 231

<212> PRT

<213> Lama pacos

<400> 5

Ala His His Ser Glu Asp Pro Ser Ser Lys Cys Pro Lys Cys Pro Gly

1 5 10 15

Pro Glu Leu Leu Gly Gly Pro Thr Val Phe Ile Phe Pro Pro Lys Pro

20 25 30

Lys Asp Val Leu Ser Ile Thr Arg Lys Pro Glu Val Thr Cys Val Val

35 40 45

Val Asp Val Gly Lys Glu Asp Pro Glu Ile Glu Phe Ser Trp Ser Val

50 55 60

Asp Asp Thr Glu Val His Thr Ala Glu Thr Lys Pro Lys Glu Glu Gln

65 70 75 80

Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu Pro Ile Gln His Gln

85 90 95

Asp Trp Leu Thr Gly Lys Glu Phe Lys Cys Lys Val Asn Asn Lys Ala

100 105 110

Leu Pro Ala Pro Ile Glu Arg Thr Ile Ser Lys Ala Lys Gly Gln Thr

115 120 125

Arg Glu Pro Gln Val Tyr Ala Leu Ala Pro His Arg Glu Glu Leu Ala

130 135 140

Lys Asp Thr Val Ser Val Thr Cys Leu Val Lys Gly Phe Phe Pro Ala

145 150 155 160

Asp Ile Asn Val Glu Trp Gln Arg Asn Gly Gln Pro Glu Ser Glu Gly

165 170 175

Thr Tyr Ala Thr Thr Leu Pro Gln Leu Asp Asn Asp Gly Thr Tyr Phe

180 185 190

Leu Tyr Ser Lys Leu Ser Val Gly Lys Asn Thr Trp Gln Gln Gly Glu

195 200 205

Val Phe Thr Cys Val Val Met His Glu Ala Leu His Asn His Ser Thr

210 215 220

Gln Lys Ser Ile Ser Gln Ser

225 230

<210> 6

<211> 1086

<212> DNA

<213> Lama pacos

<400> 6

gagtctgggg gaggattggt gcaggccggg ggctctctga gactctcctg tgcagcctct 60

ggacgcacct tcagtagcac tggacacacc ttcagcagct atgccatggg ctggttccgc 120

caaactccag ggaaggagcg tgagtttgta gcagctatta gctggagtgg tacgagcact 180

tactatgcag actccgtgaa gggccgattc accatctcca gagacaacgc caagaacacg 240

gtgtatctgc aaatgaacag cctgaaacct gaggacacgg ccgtttatta ctgtgcagca 300

aggttctggg actacgggtt agggtcatcc gacctgaagt cccccaggga gtatgactac 360

tggggtcagg ggacccaggt caccgtctcc tcggcgcacc acagcgaaga ccccagctcc 420

aagtgtccca aatgcccagg ccctgagctc cttggagggc ccacggtctt catcttcccc 480

ccgaaaccca aggacgtcct ctccatcacc cgaaaacctg aggtcacgtg cgttgtggtg 540

gacgtgggta aggaagaccc tgagatcgag ttcagctggt ccgtggatga cacagaggta 600

cacacggctg agacaaagcc aaaggaggaa cagttcaaca gcacgtaccg cgtggtcagc 660

gtcctgccca tccagcacca ggactggctg acggggaagg aattcaagtg caaggtcaac 720

aacaaagctc tcccagcccc catcgagagg accatctcca aggccaaagg gcagacccgg 780

gagccgcagg tgtacgccct ggccccacac cgggaagagc tggccaagga caccgtgagc 840

gtaacctgcc tggtcaaagg cttcttccca gctgacatca acgttgagtg gcagaggaac 900

gggcagccgg agtcagaggg cacctacgcc accacgctgc cccagctgga caacgacggg 960

acctacttcc tctacagcaa actctccgtg ggaaagaaca cgtggcagca gggagaagtc 1020

ttcacctgtg tggtgatgca cgaggctcta cacaatcact ccacccagaa atccatctcc 1080

cagtct 1086

<210> 7

<211> 12

<212> PRT

<213> Lama pacos

<400> 7

Arg Arg Thr Phe Cys Asn Tyr Leu Asp Ala Met Gly

1 5 10

<210> 8

<211> 17

<212> PRT

<213> Lama pacos

<400> 8

His Ile Thr Gly Asn Arg Gly Asp Val Met Tyr Leu Asp Ser Val Lys

1 5 10 15

Ala

<210> 9

<211> 16

<212> PRT

<213> Lama pacos

<400> 9

Lys Ala Thr Gly Phe Phe Ser Pro Lys Glu Glu Glu Lys Tyr Asn Trp

1 5 10 15

<210> 10

<211> 117

<212> PRT

<213> Lama pacos

<400> 10

Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly Ser Leu Arg Leu Ser

1 5 10 15

Gly Val Ala Ser Arg Arg Thr Phe Cys Asn Tyr Leu Asp Ala Met Gly

20 25 30

Trp Leu Ser Leu Val Thr Gly Lys Glu Arg Glu Leu Val Ala His Ile

35 40 45

Thr Gly Asn Arg Gly Asp Val Met Tyr Leu Asp Ser Val Lys Ala Gly

50 55 60

Ser Thr Ile Ser Arg Val Lys Thr Asn Ser Thr Val Tyr Leu Gln Met

65 70 75 80

Asn Ser Met Lys Pro Glu Asp Thr His Val Tyr Tyr Trp Ala Pro Lys

85 90 95

Ala Thr Gly Phe Phe Ser Pro Lys Glu Glu Glu Lys Tyr Asn Trp Trp

100 105 110

Gly Gln Gly Thr Gln

115

<210> 11

<211> 231

<212> PRT

<213> Lama pacos

<400> 11

Ala His His Ser Glu Asp Pro Ser Ser Lys Cys Pro Lys Cys Pro Gly

1 5 10 15

Pro Glu Leu Leu Gly Gly Pro Thr Val Phe Ile Phe Pro Pro Lys Pro

20 25 30

Lys Asp Val Leu Ser Ile Thr Arg Lys Pro Glu Val Thr Cys Val Val

35 40 45

Val Asp Val Gly Lys Glu Asp Pro Glu Ile Glu Phe Ser Trp Ser Val

50 55 60

Asp Asp Thr Glu Val His Thr Ala Glu Thr Lys Pro Lys Glu Glu Gln

65 70 75 80

Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu Pro Ile Gln His Gln

85 90 95

Asp Trp Leu Thr Gly Lys Glu Phe Lys Cys Lys Val Asn Asn Lys Ala

100 105 110

Leu Pro Ala Pro Ile Glu Arg Thr Ile Ser Lys Ala Lys Gly Gln Thr

115 120 125

Arg Glu Pro Gln Val Tyr Ala Leu Ala Pro His Arg Glu Glu Leu Ala

130 135 140

Lys Asp Thr Val Ser Val Thr Cys Leu Val Lys Gly Phe Phe Pro Ala

145 150 155 160

Asp Ile Asn Val Glu Trp Gln Arg Asn Gly Gln Pro Glu Ser Glu Gly

165 170 175

Thr Tyr Ala Thr Thr Leu Pro Gln Leu Asp Asn Asp Gly Thr Tyr Phe

180 185 190

Leu Tyr Ser Lys Leu Ser Val Gly Lys Asn Thr Trp Gln Gln Gly Glu

195 200 205

Val Phe Thr Cys Val Val Met His Glu Ala Leu His Asn His Ser Thr

210 215 220

Gln Lys Ser Ile Ser Gln Ser

225 230

<210> 12

<211> 1059

<212> DNA

<213> Lama pacos

<400> 12

gagtctggag gaggattggt gcaggcaggg ggctctctga gactctcggg agtagcctct 60

agacgcactt tctgtaacta tctcgatgcc atgggctggt taagcctggt tacagggaag 120

gagcgtgaat tggtagcaca tattacaggg aataggggtg atgtcatgta tttagattcc 180

gtgaaggccg gatccaccat ctccagagtt aagaccaaca gcacggtgta tctccaaatg 240

aacagcatga aacctgagga tacgcacgtt tattattggg caccaaaggc cacaggcttt 300

ttttccccga aggaagagga gaaatataac tggtggggcc aggggaccca ggtcaccgtc 360

tcctcggcgc accacagcga agaccccagc tccaagtgtc ccaaatgccc aggccctgag 420

ctccttggag ggcccacggt cttcatcttc cccccgaaac ccaaggacgt cctctccatc 480

acccgaaaac ctgaggtcac gtgcgttgtg gtggacgtgg gtaaggaaga ccctgagatc 540

gagttcagct ggtccgtgga tgacacagag gtacacacgg ctgagacaaa gccaaaggag 600

gaacagttca acagcacgta ccgcgtggtc agcgtcctgc ccatccagca ccaggactgg 660

ctgacgggga aggaattcaa gtgcaaggtc aacaacaaag ctctcccagc ccccatcgag 720

aggaccatct ccaaggccaa agggcagacc cgggagccgc aggtgtacgc cctggcccca 780

caccgggaag agctggccaa ggacaccgtg agcgtaacct gcctggtcaa aggcttcttc 840

ccagctgaca tcaacgttga gtggcagagg aacgggcagc cggagtcaga gggcacctac 900

gccaccacgc tgccccagct ggacaacgac gggacctact tcctctacag caaactctcc 960

gtgggaaaga acacgtggca gcagggagaa gtcttcacct gtgtggtgat gcacgaggct 1020

ctacacaatc actccaccca gaaatccatc tcccagtct 1059

<210> 13

<211> 12

<212> PRT

<213> Lama pacos

<400> 13

Arg Arg Thr Phe Ser Asn Tyr Ala Asp Ala Met Gly

1 5 10

<210> 14

<211> 17

<212> PRT

<213> Lama pacos

<400> 14

Ala Ile Ser Trp Asn Ser Ala Thr Thr Arg Tyr Leu Asp Ser Val Lys

1 5 10 15

Ala

<210> 15

<211> 16

<212> PRT

<213> Lama pacos

<400> 15

Lys Pro Thr Gly Ser Phe Pro Pro Val Glu Glu Glu Lys Tyr Asn Tyr

1 5 10 15

<210> 16

<211> 117

<212> PRT

<213> Lama pacos

<400> 16

Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly Ser Val Ser Leu Ser

1 5 10 15

Cys Val Ala Ser Arg Arg Thr Phe Ser Asn Tyr Ala Asp Ala Met Gly

20 25 30

Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val Ala Ala Ile

35 40 45

Ser Trp Asn Ser Ala Thr Thr Arg Tyr Leu Asp Ser Val Lys Ala Arg

50 55 60

Phe Thr Ile Ser Arg Val Asn Ala Asn Asn Thr Val Tyr Leu Gln Met

65 70 75 80

Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ala Lys

85 90 95

Pro Thr Gly Ser Phe Pro Pro Val Glu Glu Glu Lys Tyr Asn Tyr Trp

100 105 110

Gly Gln Gly Thr Gln

115

<210> 17

<211> 231

<212> PRT

<213> Lama pacos

<400> 17

Ala His His Ser Glu Asp Pro Ser Ser Lys Cys Pro Lys Cys Pro Gly

1 5 10 15

Pro Glu Leu Leu Gly Gly Pro Thr Val Phe Ile Phe Pro Pro Lys Pro

20 25 30

Lys Asp Val Leu Ser Ile Thr Arg Lys Pro Glu Val Thr Cys Val Val

35 40 45

Val Asp Val Gly Lys Glu Asp Pro Glu Ile Glu Phe Ser Trp Ser Val

50 55 60

Asp Asp Thr Glu Val His Thr Ala Glu Thr Lys Pro Lys Glu Glu Gln

65 70 75 80

Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu Pro Ile Gln His Gln

85 90 95

Asp Trp Leu Thr Gly Lys Glu Phe Lys Cys Lys Val Asn Asn Lys Ala

100 105 110

Leu Pro Ala Pro Ile Glu Arg Thr Ile Ser Lys Ala Lys Gly Gln Thr

115 120 125

Arg Glu Pro Gln Val Tyr Ala Leu Ala Pro His Arg Glu Glu Leu Ala

130 135 140

Lys Asp Thr Val Ser Val Thr Cys Leu Val Lys Gly Phe Phe Pro Ala

145 150 155 160

Asp Ile Asn Val Glu Trp Gln Arg Asn Gly Gln Pro Glu Ser Glu Gly

165 170 175

Thr Tyr Ala Thr Thr Leu Pro Gln Leu Asp Asn Asp Gly Thr Tyr Phe

180 185 190

Leu Tyr Ser Lys Leu Ser Val Gly Lys Asn Thr Trp Gln Gln Gly Glu

195 200 205

Val Phe Thr Cys Val Val Met His Glu Ala Leu His Asn His Ser Thr

210 215 220

Gln Lys Ser Ile Ser Gln Ser

225 230

<210> 18

<211> 1059

<212> DNA

<213> Lama pacos

<400> 18

gagtctggag gaggattggt gcaggctggg ggctctgtga gtctctcctg tgtagcctct 60

agacgcactt tcagtaacta tgccgatgcc atgggctggt tccgccaggc tccagggaag 120

gagcgtgaat ttgtagcagc tattagctgg aatagtgcta ctaccaggta tttagactcc 180

gtgaaggccc gattcaccat ctccagagtt aacgccaaca acacggtgta tctgcaaatg 240

aacagcctga aacctgagga cacggccgtt tattattgtg cagcaaagcc tacaggctct 300

tttcccccgg tggaagagga gaaatataac tactggggcc aggggaccca ggtcaccgtc 360

tcctcggcgc accacagcga agaccccagc tccaagtgtc ccaaatgccc aggccctgag 420

ctccttggag ggcccacggt cttcatcttc cccccgaaac ccaaggacgt cctctccatc 480

acccgaaaac ctgaggtcac gtgcgttgtg gtggacgtgg gtaaggaaga ccctgagatc 540

gagttcagct ggtccgtgga tgacacagag gtacacacgg ctgagacaaa gccaaaggag 600

gaacagttca acagcacgta ccgcgtggtc agcgtcctgc ccatccagca ccaggactgg 660

ctgacgggga aggaattcaa gtgcaaggtc aacaacaaag ctctcccagc ccccatcgag 720

aggaccatct ccaaggccaa agggcagacc cgggagccgc aggtgtacgc cctggcccca 780

caccgggaag agctggccaa ggacaccgtg agcgtaacct gcctggtcaa aggcttcttc 840

ccagctgaca tcaacgttga gtggcagagg aacgggcagc cggagtcaga gggcacctac 900

gccaccacgc tgccccagct ggacaacgac gggacctact tcctctacag caaactctcc 960

gtgggaaaga acacgtggca gcagggagaa gtcttcacct gtgtggtgat gcacgaggct 1020

ctacacaatc actccaccca gaaatccatc tcccagtct 1059

Claims

1. A nanobody against Pseudomonas aeruginosa exotoxin A, the variable region of which has 3 complementarity determining regions CDR1, CDR2 and CDR3, wherein the CDR1 sequence consists of the amino acid sequence set forth in SEQ ID No.7, the CDR2 sequence consists of the amino acid sequence set forth in SEQ ID No.8, and the CDR3 sequence consists of the amino acid sequence set forth in SEQ ID No. 9.

2. The nanobody of claim 1, wherein the variable region sequence of the nanobody consists of the amino acid sequence set forth in SEQ ID No. 10.

3. An antibody comprising the nanobody variable region of claim 2, wherein said antibody further has a constant region consisting of the amino acid sequence set forth in SEQ ID No. 11.

4. A polynucleotide encoding the sequence of the antibody of claim 3, the sequence of said polynucleotide being represented by SEQ ID No. 12.

5. An expression vector comprising the polynucleotide of claim 4.

6. The vector of claim 5, wherein said vector is pMES 4.

7. A host cell comprising the expression vector of claim 6.

8. The host cell of claim 7, wherein the cell is E.coli BL21(DE 3).

9. Use of the antibody of claim 3 for the manufacture of a medicament against pseudomonas aeruginosa exotoxin a.

10. A nanobody composition, which comprises a nanobody having a variable region amino acid sequence shown in SEQ ID No. 10.