CN104293740B - Recombinant baculovirus of surface display SARS bivalent antigens and its preparation method and application - Google Patents

Abstract

The invention discloses a kind of recombinant baculovirus of surface display SARS bivalent antigens and its preparation method and application, the virus is to be inserted into donor plasmid by recombinant protein SP N TM and SP RBD TM encoding gene and carry out homologous recombination by swivel base and shuttle vector Bacmid genome, obtain recombinant baculovirus genomic DNA, then the genomic DNA is transfected into bombyx mori cell, the recombinant baculovirus being packaged to be in the cell；The membrane-spanning domain TM that wherein recombinant protein SP N TM are signal peptide SP, the C ends connection GP64 for connecting GP64 by the N ends of the N protein of SARS virus is formed；SP RBD TM are to connect SP by the N ends of the RBD albumen of SARS virus, and C ends connection TM is formed.The N protein of SARS virus and RBD GFPs are shown there is good immunogenicity by the recombinant baculovirus in viral capsid surface.

Description

Recombinant baculovirus of surface display SARS bivalent antigens and its preparation method and application

Technical field

The present invention relates to biomedicine technical field, and in particular to a kind of restructuring of surface display SARS bivalent antigens is shaft-like Virus and its preparation method and application.

Background technology

Serious acute respiratory syndrome（Severe Acute Respiratory Syndromes）, also known as infectiousness SARS Type pneumonia, abbreviation SARS, it is a kind of new respiratory system communicable disease caused by infecting sars coronavirus.Mainly pass through Closely air droplet transmission, to generate heat, have a headache, DOMS, weak, few phlegm of dry cough etc. for main clinical manifestation, severe patient It may occur in which respiratory distress.This disease has stronger infectiousness, has significant clustering phenomena in family and hospital.The first case, It is global the first, appears in Foshan in November, 2002, and quickly form epidemic status.In November, 2002 was to 2003 8 The moon 5,29 national report clinically diagnosed cases totally 8422, dead 916.The average mortality of reported cases is 9.3%. The virus likely originates from animal, is crossed over germline barrier due to the change of external environment and the increase of viral adaptability and is infected To the mankind, and realize interpersonal propagation.

Although SARS is controlled, SARS virus is unlikely to be existed by " elimination " or automatic disappearance, SARS in a short time The possibility occurred again in crowd is very big.Again occur SARS epidemic situations time, mainly the time with virus attack human body have Close, it is occurred frequently to be not necessarily characterized as Winter-Spring.Animal takes viruliferous Seasonal Distribution, people is infected by contact with chance of animal etc. by shadow Ring the time that epidemic situation occurs again.Animal is still the possibility source of virus, and crowd is to still universal susceptible, its epidemic disease of SARS virus Seedling is still current research emphasis.

SARS vaccines include therapeutic vaccine, inactivated vaccine, DNA vaccination, polyepitope vaccines etc. at present, existing necessarily to enter Exhibition, but there is also it is corresponding the problem of, specifically see the table below.

Table 1

	Advantage	Shortcoming
			Therapeutic epidemic disease Seedling	It is not required to the Fc sections that host identifies antibody	Need antibody humanization
Inactivation of viruses Vaccine	Time is short；Inexpensively；Technology is easier to；Vaccine is relative It is stable；It need not refrigerate；It is easy to transport	Production safety condition is high；Safety issue be present；Need multiple injection；It is immune to answer Answer low effort
			Nucleic acid vaccine （Gene vaccine Or DNA epidemic diseases Seedling）	Prepare simple；Easily a large amount of productions；Security is good, Can induction body fluid be immune simultaneously and cellular immunity should Answer；Can continuous expression in vivo	There may be some adverse consequences for continuous expression external source；Nucleic acid vaccine is influenceed to induce The uncertain factor of immune response is a lot
Multi-epitope epidemic disease Seedling	It can be combined with different types of MHC molecule, it is real Now efficiently offer, and can induce very strong thin Born of the same parents are immunized	Lack and SARS-CoV Protein Epitopes, particularly comformational epitope are goed deep into Solution；The polypeptide of synthesis is only capable of a small number of linear epitope of covering, it is impossible to lures High-caliber humoral immune response is given birth in artificial delivery

Urgently study a kind of new SARS vaccines and overcome above mentioned problem.

The content of the invention

In order to overcome the drawbacks described above of prior art vaccine, the invention provides a kind of surface display SARS bivalent antigens Recombinant baculovirus.

The recombinant baculovirus of surface display SARS bivalent antigens, it is characterised in that the virus is by recombinant protein SP- N-TM and SP-RBD-TM encoding gene is inserted into donor plasmid and carried out together by swivel base and shuttle vector Bacmid genome Source is recombinated, and obtains recombinant baculovirus genomic DNA, and recombinant baculovirus genomic DNA then is transfected into bombyx mori cell, is in Silkworm is packaged to be the recombinant baculovirus of described surface display SARS antigen N genes into the cell；

Wherein, the recombinant protein SP-N-TM is to connect shaft-like viral envelope proteins by the N- ends of the N protein of SARS virus The membrane-spanning domain TM that GP64 signal peptide SP, C- ends connect shaft-like viral envelope proteins GP64 is formed；The recombinant protein SP-RBD- TM is shaft-like by the shaft-like viral envelope proteins GP64 of N- ends connection of the RBD albumen of SARS virus signal peptide SP, C- ends connection Viral envelope proteins GP64 membrane-spanning domain TM is formed.

Shuttle vector Bacmid（That is Baculovirus plasmid）, can be for the plasmid with Baculovirus Gene group Shuttled between bacterium and insect cell, be one of member of Bac-to-bac baculovirus expression systems, the system also includes supplying Constitution grain and helper plasmid and Escherichia coli, it is prior art.

Preferably, the recombinant baculovirus of above-mentioned surface display SARS bivalent antigens, the donor plasmid are PFastBacDual, recombinant protein SP-N-TM encoding gene are inserted into donor plasmid pFastBacDual p10 promoters Under, recombinant protein SP- RBD-TM encoding gene is inserted under donor plasmid pFastBacDual pPolh promoters, structure Build up the genome after restructuring swivel base plasmid again with shuttle vector Bacmid and carry out homologous recombination.

Wherein, carrier pFastBacDual is the donor plasmid of Bac-to-bac expression systems, may be inserted into foreign gene And under the swivel base enzyme effect of helper plasmid coding, foreign gene is inserted into Bacmid.Carrier pFastBacDual is Commercialization.

Preferably, the recombinant baculovirus of above-mentioned surface display SARS bivalent antigens, the ammonia of the recombinant protein SP-N-TM Base acid sequence such as SEQ ID NO:Shown in 1；The amino acid sequence of the recombinant protein SP-RBD-TM such as SEQ ID NO:Shown in 2.

Preferably, the recombinant baculovirus of above-mentioned surface display SARS bivalent antigens, the volume of the recombinant protein SP-N-TM Code gene nucleotide series such as SEQ ID NO:Shown in 3；The encoding gene nucleotide sequence of the recombinant protein SP-RBD-TM is such as SEQ ID NO:Shown in 4.

Preferably, the recombinant baculovirus of above-mentioned surface display SARS bivalent antigens, the bombyx mori cell are that silkworm BmN is thin Born of the same parents.

Present invention also offers the preparation method of the recombinant baculovirus of above-mentioned surface display SARS bivalent antigens, step is such as Under：

（1）PCR amplifications obtain baculoviral envelope protein GP64 signal peptides SP encoding gene, the N protein of SARS virus Encoding gene, SARS virus RBD albumen encoding gene and baculoviral envelope protein GP64 membrane-spanning domain TM coding Gene；

（2）The method expanded by over-lap PCR obtains the coding by SP encoding gene, the encoding gene of N protein and TM The recombination SP-N-TM that gene is sequentially connected, and introduced respectively at its 5 ' and 3 ' endSmaI andKpnI restriction enzyme sites；It is overlapping PCR obtains the recombination SP- being sequentially connected by SP encoding gene, the encoding gene of RBD albumen and TM encoding gene RBD-TM, and introduced respectively at its 5 ' and 3 ' endBamH WithSpe Restriction enzyme site；Recombination SP-N-TM is connected to carrier Under pFastBacDual p10 promoters, SP-RBD-TM is connected under carrier pFastBacDual pploh promoters, structure Into restructuring swivel base plasmid；

（3）The Escherichia coli DH10Bac competence for recombinating swivel base plasmid conversion Bacmid containing baculovirus shuttle vector is thin Born of the same parents, homologous recombination is carried out, is carried out on the LB culture plates containing kanamycins, gentamicin, tetracycline, X-gal and IPTG Blue hickie screens, picking hickie after 40 ~ 48h of lucifuge culture, and hickie extracts recombinant baculovirus gene after continuing 24 ~ 48h of culture Group DNA enters performing PCR identification；

（4）Take step（3）Identify that correct recombinant baculovirus genomic DNA is thin by liposome mediated-method transfection silkworm Born of the same parents, generation viral suspension is obtained after morbidity, extraction viral genome enters performing PCR identification again, and identification is correctly surface exhibition Show the recombinant baculovirus of SARS bivalent antigens；

The PCR identifications use two groups of primers, respectively SEQ ID NO:5、SEQ ID NO:7 and SEQ ID NO:12 structures Into primer sets, and SEQ ID NO:6、SEQ ID NO:13 and SEQ ID NO:18 primer sets formed.

Preferably, the preparation method of the recombinant baculovirus of above-mentioned surface display SARS bivalent antigens, step（1）Middle amplification The primer nucleotide sequences such as SEQ ID NO that baculoviral envelope protein GP64 signal peptides SP encoding gene uses:7 ~ 8 institutes Show；The primer nucleotide sequences such as SEQ ID NO that the encoding gene of amplification SARS Nucleocapsid uses:Shown in 9 ~ 10；Expand bar The primer nucleotide sequences that shape viral envelope proteins GP64 membrane-spanning domain TM encoding gene uses such as SEQ ID NO:11 ~ 12 institutes Show.

Preferably, the preparation method of the recombinant baculovirus of above-mentioned surface display SARS bivalent antigens, step（1）Middle amplification The primer nucleotide sequences such as SEQ ID NO that baculoviral envelope protein GP64 signal peptides SP encoding gene uses:13 ~ 14 institutes Show；The primer nucleotide sequences such as SEQ ID NO that the encoding gene of amplification SARS virus RBD albumen uses:Shown in 15 ~ 16；Expand Increase the primer nucleotide sequences such as SEQ ID NO that baculoviral envelope protein GP64 membrane-spanning domain TM encoding gene uses:17~ Shown in 18.

Present invention also offers the recombinant baculovirus of above-mentioned surface display SARS bivalent antigens in SARS vaccines are prepared Application.

Compared with prior art, the invention has the advantages that：

By analyzing the genome structure of SARS virus, it is found that S protein contains 1255aa, be that structural proteins area encodes most Big transmembrane glycoprotein, it is made up of S1 and S2 Liang Ge subunits, the S1 sections (17 ~ 672aa) positioned at S protein N-terminal are isoacceptor blood Pipe tightens the key position that plain converting Enzyme 2 (angiotensin-converting enzyme 2, ACE2) combines, and neutralizes The main function target spot of antibody effect, based on correlative study result, carry out Characterization of antigenic epitopes to the S1 sections of S protein, 211 ~ 550aa section（That is RBD）One function domain is not only, and contains the main neutralizing epitope of S protein.With S gene structures The inducible neutralizing antibody of DNA vaccines built is immunized and cellular immunity, but based on humoral immunity.

The N protein of SARS virus contains 422 amino acid, and the core of virion is present in the form of being combined with RNA Point, the transcription and duplication of virus are participated in, it is more conservative than other albumen such as S, M etc..A highly conserved sequence be present in the N-terminal of N protein Arrange FYYLGTGP（SEQ ID NO:22）, this sequence has presence in every other coronavirus N protein.Therefore successfully N gene vaccines can induce the T cell immune response for producing strong, wide spectrum, lasting neutralizing antibody and protectiveness.

Silkworm baculovirus envelope protein GP64 contains Liang Ge very hydrophobics area：The secretory signal peptide of N- ends（SP）With The membrane spaning domain (TM) of C- ends, what is be connected with membrane spaning domain is hydrophilic domain, can be virus envelope and host Glycoprotein in cell membrane links together.N protein gene of the invention by SARS virus and silkworm baculovirus envelope protein GP64 Gene Fusions, realize surface display of the purpose N protein on viral capsid.

The recombinant baculovirus for the surface display SARS bivalent antigens that the present invention is built, Bombyx noriN cell can be utilized to make For bioreactor, there is the SARS virus of high clinical value by baculovirus expression vector system high efficient expression N protein and RBD albumen, it can prepare vaccine, directly can also prepare vaccine with recombinant virus, suitable for mass producing, Cost can be reduced, improves yield, the SARS vaccine application values produced are big.

SARS vaccines there is no to be produced using baculoviral surface display technologies, and baculovirus expression vector system is eucaryon table Reach, there is posttranslational modification function.The immunogenicity of N protein is relevant with its correct configuration, using eukaryotic expression can possess compared with Good immunogenicity.

Brief description of the drawings

Fig. 1：Carrier pFastBacDual structural representation.

Fig. 2：Restructuring swivel base plasmid pFstBacDual-gp64-N-RBD structure schematic diagrames containing gp64-N-RBD, wherein p10：Polyhedron promoter；pPolh：Polyhedron promoter；SP：The signal peptide sequence of gp64 genes；N protein： Nucleocapsid protein（Nucleocapsid protein）；RBD albumen：Receptor-binding domain（Receptor activity modifying proteins Area）Albumen；TM：The transmembrane domain of gp64 genes；Sma 、Kpn 、BamH 、Spe ：Restriction enzyme site.

Fig. 3：SP-N-TM genes and SP-RBD-TM gene PCR amplified productions, wherein, left figure M：10kb DNA molecular amounts Standard, 1：SP-N-TM gene PCR amplified productions, arrow locations are purpose sequence, 1458bp；Right figure M：10kb DNA molecular amounts Standard, 1：SP-RBD-TM gene PCR amplified productions, arrow locations are purpose sequence, 1212bp.

Fig. 4：Recombinate swivel base plasmid pFastBacDual-gp64-N-RBD PCR identification electrophoretograms, wherein left figure M：10kb DNA molecular amount standard, 1：SP-N-TM target gene, 2：PFastBacDual-gp64-N double digestion products；Right figure M：10kb DNA molecular amount standard, 1：SP-RBD-TM target gene, 2：PFastBacDual-gp64-RBD double digestion products.

Fig. 5:Recombinant baculovirus genome Bacmid-gp64-N-RBD PCR primer electroresis appraisal result, wherein, M： 10kb DNA molecular amount standards, 1 and 4：Blank control, 2：pH （F）1580bp fragments with SV40 (R) for primer amplification, 3： Psp-F2 and M13R is the 1762bp fragments of primer amplification；5：The 1458bp fragments that Psp-F1 and Ptm-R1 expands for primer, 6： The 4107bp fragments of Psp-F1 and M13F primer amplifications each other.

Fig. 6：Recombinant baculovirus Bmp64-N-RBD PCR primer electroresis appraisal result, wherein, M：10kb DNA moleculars Amount standard, 1 and 5：Blank control, 2 and 6：Negative control, 3：The 1212bp fragments of Psp-F2 and Ptm-R2 primer amplifications each other,: 4：The 1762bp fragments 7 of Psp-F2 and M13R primer amplifications each other：The 1458bp pieces of Psp-F1 and Ptm-R1 primer amplifications each other Section, 8：The 4107bp fragments of Psp-F1 and M13F primer amplifications each other.

Fig. 7：Recombinant baculovirus Bmp64-N-RBD antigen protein Western Blot testing results（N protein rabbit-anti is examined Survey）, M：Protein Marker, 1：Prokaryotic expression N protein, 2：Negative control supernatant, 3：Negative control precipitates, and 4：Bmgp64-N Supernatant, 5：Bmgp64-N is precipitated, and 6：Bmgp64-N-RBD supernatants 7：Bmgp64-N-RBD is precipitated.

Fig. 8：Recombinant baculovirus Bmp64-N-RBD antigen protein Western Blot testing results（RBD albumen rabbit-antis Detection）, M：Protein Marker, 1：Prokaryotic expression N protein, 2：Negative control supernatant, 3：Negative control precipitates, and 4： Bmgp64-RBD supernatants, 5：Bmgp64-RBD is precipitated, and 6：Bmgp64-N-RBD supernatants 7：Bmgp64-N-RBD is precipitated.

Fig. 9：Recombinant baculovirus Bmp64-N-RBD antigen protein function Western Blot testing results（N protein, RBD albumen mouse are anti-to be used as probe）, M:Protein Marker, 1：Prokaryotic expression RBD albumen, 2：Bmgp64-RBD；3：Protokaryon table Up to N protein；4：Bmgp64-N；5：Bmp64-N-RBD.

Embodiment

With reference to specific embodiment, the invention will be further described, so that those skilled in the art can be preferably Understand the present invention and can be practiced, but illustrated embodiment is not as a limitation of the invention.

The present invention expands the coding base of the coding gene sequence and RBD albumen that obtain SARS major antigen N proteins by PCR Because of sequence, while expand baculoviral envelope protein GP64 signal peptides SP encoding gene and baculoviral envelope protein GP64 Membrane-spanning domain TM encoding gene, by over-lap PCR, obtain SP-N-TM recombinations fragment and SP-RBD-TM recombination pieces Section, and insect cell expression vector pFastBacDual multiple cloning sites are inserted into, obtain restructuring swivel base plasmid（It is named as pFastBacDual-gp64-N-RBD）, restructuring swivel base plasmid conversion Bacmid containing baculovirus shuttle vector Escherichia coli DH10Bac competent cells, homologous recombination is carried out, obtain recombinant baculovirus genomic DNA（Recombinant plasmid is named as Bacmid-gp64-N-RBD）, by it by liposome transfection Bombyx noriN cell, surface display SARS is assembled to form in the cell The recombinant baculovirus of antigen N genes（It is named as Bmgp64-N-RBD）, and amplification is replicated, connect with third generation Bmgp64-N-RBD Kind Bombyx noriN cell, collected virus liquid after 3 ~ 5 days, centrifuges, isolates and purifies, SARS vaccines are made.This hair is illustrated in detail below Bright particular content.

Embodiment 1 recombinates swivel base plasmid pFastBacDual-gp64-N-RBD structure

1. the acquisition of gp64-N sequences

With silkworm baculovirus gp64 sequences（SEQ ID NO:19）For template, respectively with the primer Psp-F shown in table 2, Psp-R and Ptm-F, Ptm-R enter performing PCR amplification, obtain gp64 signal peptide (SP) sequence and transmembrane region (TM) sequence, with The N protein gene order of SARS virus（SEQ ID NO:20）For template, Pn-F, Pn-R are primer, and PCR amplifications obtain N protein Gene order.PCR primer obtains the restructuring that SP gene orders, N gene orders and TM gene orders be sequentially connected by over-lap PCR Purpose fragment SP-N-TM, restructuring purpose fragment is inserted under carrier pFastBacDual p10 promoters, structure restructuring turns Seat plasmid pFastBacDual-gp64-N, is started the expression of N genes using the polyhedron promoter, has fusion protein N-terminal Signal peptide (SP), C-terminal have transmembrane region (TM), because the promoter belongs to pole late gene promoter and is strong promoter, i.e., Make fusion protein be to baculoviral and the virose albumen of host cell, due to the promoter start track fusion when Virion has been formed, thus fusion protein can also obtain efficiently, express in large quantities.

The SP-N-TM aligning primer sequences Designs of table 2

Psp-F1	ACACCCGGGATGGTAGGCGCTATTG（SEQ ID NO:7）
		Psp-R1	TATCAGACATCGCCGCAAAG（SEQ ID NO:8）
Pn-F	CTTTGCGGCG ATGTCTGATAATGGAC（SEQ ID NO:9）
		Pn-R	CTTCAGCCAT TGCCTGAGTTGA（SEQ ID NO:10）
Ptm-F1	AACTCAGGCAATGGCTGAAGGC（SEQ ID NO:11）
		Ptm-R1	GCCGGTACCTTAATATTGTCTACTATTACGG（SEQ ID NO:12）

It is at underscore in table 2Sma , Kpn Restriction enzyme site.

(1) amplification of gp64 signal peptides (SP) gene

With silkworm baculovirus gp64 sequences（SEQ ID NO:19）For template, Psp-F1 and Psp-R1 are primer, are carried out PCR is expanded.PCR reaction system is 50 μ L, and specific composition is：10 × PCR Buffer 5 μ L, 2.5 mmol/mL dNTPs 5 μ L, 0.01nmol/ μ L each 1 μ L of Psp-F1 and Psp-R1,2 μ L, Taq archaeal dna polymerase of template 2 μ L, ddH₂O 34μL。 After each component mixes, it is put into PCR instrument, PCR response parameters：95 DEG C of pre-degenerations 5min, 95 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 30s, 30 circulations, 72 DEG C of extension 5min.After question response terminates, electroresis appraisal amplified production segment, purpose segment Size is 60bp, while gel extraction purpose segment.

(2) amplification of gp64 membrane-spanning domains (TM)

With silkworm baculovirus gp64 sequences（SEQ ID NO:19）For template, Ptm-F1 and Ptm-R1 are primer, are carried out PCR is expanded.The μ L of PCR reaction systems 50, concrete component are：10 × PCR Buffer 5 μ L, 2.5 mmol/mL the μ L of dNTPs 5, The 0.01nmol/ μ L each 1 μ L of μ L and Ptm-R1 of Ptm-F1 1,2 μ L, Taq archaeal dna polymerase of template 2 μ L, ddH₂O 34μL。 After each component mixes, it is put into PCR instrument, PCR response parameters：95 DEG C of pre-degenerations 5min, 95 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C of extension 30s, 30 circulations, 72 DEG C of extension 5min.After question response terminates, electroresis appraisal amplified production segment, purpose segment Size is 132bp, while gel extraction purpose segment.

(3) the N gene magnifications of SARS virus

With the N protein gene order of SARS virus（SEQ ID NO:20）For template, Pn-F and Pn-R are primer, are carried out PCR is expanded.The μ L of PCR reaction systems 50, concrete component are：10 × PCR Buffer 5 μ L, 2.5 mmol/mL the μ L of dNTPs 5, 0.01nmol/ μ L each 1 μ L of Pn-F and Pn-R, 2 μ L, Taq archaeal dna polymerase of template 2 μ L, ddH₂O 34μL.Each component mixes After even, it is put into PCR instrument, PCR response parameters：95 DEG C of pre-degeneration 5min, 95 DEG C of denaturation 30s, 53 DEG C of annealing 30s, 72 DEG C extend 30s, 30 circulations, 72 DEG C of extension 5min.After question response terminates, electroresis appraisal am-plified fragments, purpose segment size is 1266bp （Terminator is deleted）, while gel extraction purpose segment.

(4) gp64-N acquisition

Simultaneously with step（1）Extremely（3）Obtained SP gene orders, N gene orders and TM gene orders is template, is carried out PCR is expanded.Amplification system is 50 μ L, and composition is：10 × PCR Buffer 5 μ L, 2.5 mmol/mL μ L, the SP bases of dNTPs 5 Because of 3 μ L, Taq archaeal dna polymerase of sequence 3 μ L, N gene order, 3 μ L, TM gene order 2 μ L, ddH₂O 29μL.Each component mixes Afterwards, it is put into PCR instrument, PCR response parameters：95 DEG C of pre-degeneration 5min, 95 DEG C of denaturation 40s, 50 DEG C of renaturation 40s, 72 DEG C extend 1min35s, 35 circulations, 72 DEG C of extension 10min.35 circulations are designed by above-mentioned response parameter, obtain overlapping purpose fragment SP- N-TM（It is named as gp64-N）.After question response terminates, electroresis appraisal am-plified fragments, purpose segment size is 1458bp（Referring to figure 3）, while gel extraction purpose segment.

(5) gp64-N amplification

Using overlapping PCR products SP-N-TM as template, Psp-F1 and Ptm-R1 are primer, enter performing PCR amplification.Amplification system For 50 μ L, composition is：10 × PCR Buffer 5 μ L, 2.5 mmol/mL μ L, the 0.01nmol/ μ L of dNTPs 5 Psp-F1 With each 1 μ L of Ptm-R1,2 μ L, Taq archaeal dna polymerase of template 2 μ L, ddH₂O 34μL.After each component mixes, it is put into PCR instrument, PCR response parameters：95 DEG C of pre-degeneration 5min, 95 DEG C of denaturation 45s, 50 DEG C of renaturation 45s, 72 DEG C of extension 1min35s, 30 circulate, 72 DEG C of extension 10min.30 circulations are designed by above-mentioned response parameter.After question response terminates, electroresis appraisal am-plified fragments, cut simultaneously Glue reclaim purpose segment.

2. the acquisition of gp64-RBD sequences

With silkworm baculovirus gp64 sequences（SEQ ID NO:19）, respectively with primer Psp-F2, Psp-R2 shown in table 3 Enter performing PCR amplification with Ptm-F2, Ptm-R2, obtain gp64 signal peptide (SP) sequence and transmembrane region (TM) sequence.With SARS diseases The RBD protein gene sequences of poison（SEQ ID NO:21）For template, performing PCR amplification is entered as primer using Prbd-F, Prbd-R and obtained RBD protein gene sequences.PCR primer obtains SP gene orders, RBD gene orders and TM gene orders successively by over-lap PCR The restructuring purpose fragment SP-RBD-TM of connection, restructuring purpose fragment is inserted into carrier pFastBacDual pPolh promoters Under, structure restructuring swivel base plasmid pFastBacDual-gp64-RBD, start RBD genes using polyhedron promoter pPolh Expression, makes fusion protein N-terminal have signal peptide (SP), C-terminal has transmembrane region (TM), because the promoter belongs to pole late gene Promoter and be strong promoter, even if fusion protein is to baculoviral and the virose albumen of host cell, due to being opened with this Mover start track fusion when virion formed, so fusion protein can also obtain efficiently, express in large quantities. The signal peptide that RBD albumen passes through baculoviral envelope protein gp64（SP）Guiding and transmembrane region（TM）Grappling is showed in baculoviral Surface, form hedgehog（Pseudo- virus）, the translation of the polyadenylation signal PolyA of end to fusion protein plays an important role.

Table 3SP-RBD-TM aligning primer sequences Designs

Psp-F2	CGGATCCATGGTAGGCGCTATT（SEQ ID NO:13）
		Psp-R2	TAAAACCCATCGCCGCAAAG（SEQ ID NO:14）
Prbd-F	CTTTGCGGCGATGGGTTTTAACACTT（SEQ ID NO:15）
		Prbd-R	CTTCAGCCAT TTGTTGAAATGGT（SEQ ID NO:16）
Ptm-F2	ATTTCAACAAATGGCTGAAGGC（SEQ ID NO:17）
		Ptm-R2	GCCACTAGTTTAATATTGTCTACTA（SEQ ID NO:18）

It is at underscore in table 3BamH , Spe Restriction enzyme site.

(1) amplification of gp64 signal peptides (SP) gene

With silkworm baculovirus gp64 sequences（SEQ ID NO:19）For template, Psp-F2 and Psp-R2 are primer, are carried out PCR is expanded.PCR reaction system is 0.5mL, and specific composition is：10 × PCR Buffer 5 μ L, 2.5 mmol/mL dNTPs 5 μ L, 0.01nmol/ μ L each 1 μ L of Psp-F2 and Psp-R2,2 μ L, Taq archaeal dna polymerase of template 2 μ L, ddH₂O 34μL。 After each component mixes, it is put into PCR instrument, PCR response parameters：95 DEG C of pre-degenerations 5min, 95 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 30s, 30 circulations, 72 DEG C of extension 5min.After question response terminates, electroresis appraisal amplified production segment, purpose segment Size is 60, while gel extraction purpose segment.

(2) amplification of gp64 membrane-spanning domains (TM)

With silkworm baculovirus gp64 sequences（SEQ ID NO:19）For template, Ptm-F 2 and Ptm-R2 are primer, are carried out PCR is expanded.The μ L of PCR reaction systems 50, concrete component are：10 × PCR Buffer 5 μ L, 2.5 mmol/mL the μ L of dNTPs 5, 0.01nmol/ μ L each 1 μ L of Ptm-F2 and Ptm-R2,2 μ L, Taq archaeal dna polymerase of template 2 μ L, ddH₂O 34μL.Each group Divide after mixing, be put into PCR instrument, PCR response parameters：95 DEG C of pre-degeneration 5min, 95 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C Extend 30s, 30 circulations, 72 DEG C of extension 5min.After question response terminates, electroresis appraisal amplified production segment, purpose segment size For 132bp, while gel extraction purpose segment.

(3) the RBD gene magnifications of SARS virus

With the RBD protein gene sequences of SARS virus（SEQ ID NO:21）For template, Prbd-F and Prbd-R are to draw Thing, enter performing PCR amplification.The μ L of PCR reaction systems 50, concrete component are：The μ L of 10 × PCR Buffer 5,2.5 mmol/mL's μ L, the 0.01nmol/ μ L of dNTPs 5 each 1 μ L of Prbd-F and Prbd-R, 2 μ L, Taq archaeal dna polymerase of template 2 μ L, ddH₂O 34μL.After each component mixes, it is put into PCR instrument, PCR response parameters：95 DEG C of pre-degeneration 5min, 95 DEG C of denaturation 30s, 53 DEG C are annealed 30s, 72 DEG C of extension 30s, 30 circulations, 72 DEG C of extension 5min.After question response terminates, electroresis appraisal am-plified fragments, purpose piece Disconnected size is 1020bp, while gel extraction purpose segment.

(4) gp64-RBD acquisition

Simultaneously with step（1）Extremely（3）Obtained SP gene orders, RBD gene orders and TM gene orders is template, is carried out PCR is expanded.Amplification system is 50 μ L, and composition is：10 × PCR Buffer 5 μ L, 2.5 mmol/mL μ L, the SP bases of dNTPs 5 Because of 3 μ L, Taq archaeal dna polymerase of sequence 3 μ L, RBD gene order, 3 μ L, TM gene order 2 μ L, ddH₂O 29μL.Each component After mixing, it is put into PCR instrument, PCR response parameters：95 DEG C of pre-degeneration 5min, 95 DEG C of denaturation 40s, 50 DEG C of renaturation 40s, 72 DEG C are prolonged Stretch 1min35s, 35 circulations, 72 DEG C of extension 10min.35 circulations are designed by above-mentioned response parameter, obtain overlapping purpose fragment SP-RBD-TM（It is named as gp64-RBD）.After question response terminates, electroresis appraisal am-plified fragments, purpose segment size is 1212bp （Referring to Fig. 3）, while gel extraction purpose segment.

(5) gp64-RBD amplification

Using overlapping PCR products SP-RBD-TM as template, Psp-F2 and Ptm-R2 are primer, enter performing PCR amplification.Expand body It is to be for 0.5mL, composition：10 × PCR Buffer 5 μ L, 2.5 mmol/mL dNTPs 5 μ L, 0.01nmol/μ L Psp- Each 1 μ L of F2 and Ptm-R2,2 μ L, Taq archaeal dna polymerase of template 2 μ L, ddH₂O 34μL.After each component mixes, PCR instrument is put into In, PCR response parameters：95 DEG C of pre-degeneration 5min, 95 DEG C of denaturation 45s, 48 DEG C of renaturation 45s, 72 DEG C of extension 30s, 30 circulate, and 72 DEG C extension 10min.30 circulations are designed by above-mentioned response parameter.After question response terminates, electroresis appraisal am-plified fragments, while cut glue Reclaim purpose segment.

3. recombinate swivel base plasmid pFstBacDual-gp64-N-RBD structure

The gp64-N that above-mentioned PCR amplifications are obtained（That is SP-N-TM）Sequence passes through restriction enzyme respectivelySma WithKpn (being purchased from Fermentas companies) carries out double digestion, the gp64-RBD that above-mentioned PCR amplifications obtain（That is SP-RBD-TM）Sequence point Restriction enzyme is not passed throughBamH 、SpeI (being purchased from Fermentas companies) carries out double digestion, two kinds of digestion products difference It is inserted through p10, pPolh promoter multicloning sites downstream upstream and downstream two of the pFastBacDual carriers of double digestion twice End, builds the restructuring swivel base plasmid containing gp64-N sequences and gp64-RBD, is named as pFstBacDual-gp64-N-RBD.Structure Build the restructuring swivel base plasmid of completion by restriction analysis and two-way sequencing identification gene order it is correct after, recombinate swivel base plasmid construction Success.The PCR that Fig. 4 is restructuring swivel base plasmid pFastBacDual-gp64-N-RBD identifies electrophoretogram.

The silkworm with recombinant baculovirus Bmgp64-N-RBD of embodiment 2 acquisition

Identification is recombinated into successfully restructuring swivel base plasmid pFastBacDual-gp64-N-RBD conversions and contains baculovirus shuttle Carrier B acmid Escherichia coli DH10Bac competent cells（Purchased from Invitrogen companies）, big containing kanamycins, celebrating Mycin, tetracycline, X-gal and IPTG LB culture plates（Purchased from Shanghai Sheng Gong biotech firms, operated to specifications） Upper culture, homologous recombination is carried out by swivel base（Gp64-N sequences and gp64-RBD sequences on pFastBacDual-gp64-N-RBD Row are inserted into Bacmid multiple cloning sites by homologous swivel base）After carry out blue hickie screening, picking is white after lucifuge culture 48h Spot, hickie continue to shake bacterium culture 24-48h in the LB nutrient solutions containing tetracycline, kanamycins, gentamicin, X-gal and IPTG Recombinant baculovirus genomic DNA is extracted with isopropanol afterwards, the primer sets formed with M13F, Psp-F1 and Ptm-R1, and The primer sets that M13R, Psp-F2 and Ptm-R2 are formed expand target gene in identification restructuring Bacmid by PCR and insert situation, insert Enter successful plasmid and be named as Bacmid-gp64-N-RBD（That is recombinant baculovirus genome）.Fig. 5 is genome Bacmid- Gp64-N-RBD PCR qualification results.

Wherein, M13 universal primer sequences：

M13F：TGTAAAACGACGGCCAGT（SEQ ID NO:5）；

M13R：CAGGAAACAGCTATGACC（SEQ ID NO: 6）.

Identify that successful plasmid Bacmid-gp64-N-RBD transfects Bombyx noriN cell by liposome mediated-method（It is purchased from Invitrogen companies）, transfect and use the Reagent of Invitrogen companies lipofectamine Cellfectin II, turn Dyeing method transfects specific steps with reference to the transfection reagent specification：

16 μ L plasmid Bacmid-gp64-N-RBD and 8 μ L transfection reagents are added to 76 μ L serum-free by evening before that day In culture medium, 20min is incubated at room temperature, liposome is fully wrapped up plasmid Bacmid-gp64-N-RBD, is then added into In the well-grown Bombyx noriN cells of 1mL, incubator overnight incubation is inserted, the next morning siphons away serum free medium, changes Into having blood serum medium culture 5 ~ 7 days, treat that cell is fallen ill.

After cell morbidity（Micro- sem observation）4 DEG C of generation viral suspension is obtained to preserve, extraction viral genome M13F, The primer sets that Psp-F1 and Ptm-R1 is formed, and the primer sets that M13R, Psp-F2 and Ptm-R2 are formed enter performing PCR identification, mirror Determine result and see Fig. 6, wherein negative control is wild baculoviral, the results showed that virus formulation success, obtain surface display SARS The recombinant baculovirus of bivalent antigen, is named as Bmgp64-N-RBD.

Expression of the N-RBD fusion proteins of embodiment 3 in Bombyx noriN cell

By recombinant baculovirus Bmgp64-N-RBD with 5 × 10^-6Pfu/cell dosage infected silkworm BmN cells carry out disease Poison amplification, after infecting 3 ~ 5 days, virus liquid is collected, through isolating and purifying, take 10 μ L of supernatant liquid to add on 2 isometric × protein Sample buffer solution (100Mm Tris-HCl, 4%SDS, 0.15% bromophenol blues, 10% glycerine), 100 DEG C of heating 10min, after taking heating The μ L of mixed liquor 2 carry out SDS-PAGE analyses, the results showed that, the silkworm with recombinant baculovirus has expressed N, RBD albumen.

Embodiment 4 isolates and purifies Bmgp64-N-RBD viruses from Bombyx noriN cell

（1）Take the Bombyx noriN cell virus liquid that 200mL infects through Bmgp64-N-RBD；

（2）Virus liquid is added in 50mL centrifuge tubes, 8000rpm centrifugation 30min, takes supernatant, it is thin to remove in triplicate Born of the same parents' residue；

（3）By step（2）The centrifuged supernatant of acquisition pours into 50mL centrifuge tubes, 15000rpm centrifugation 60min, takes supernatant, In triplicate；

（4）By step（3）The centrifuged supernatant of acquisition, the hollow-fibre membrane for being 100KD with molecular cut off carry out ultrafiltration, Sterilized water is continuously added, sterile water volume used is about 10 times of sample, and whole ultra-filtration process operates under 4 DEG C of environment, weight It is multiple 5 times；

（5）Step（4）Supernatant after film bag ultrafiltration, is sub-packed in the ultra-filtration centrifuge tube of sterilizing on super-clean bench, with injection Device drives bubble in pipe away, is put into Hitachi's CP70MX centrifuges and centrifuges 40min, the black group's ultrafiltrate of gained with rotating speed 50000rpm （That is phosphate buffer PBS）It is resuspended, the membrane filtration with 0.22 μm is degerming, obtains the recombinant baculovirus of purifying.

The expression of recombinant baculovirus N protein is detected by Western Blot（Detected with the rabbit-anti of N protein）, knot Fruit sees Fig. 7, and wherein swimming lane 1 is the N protein of prokaryotic expression as positive control, is that use is gene constructed in pET-28a by N protein On, with the protein product of e. coli bl21 expression；Swimming lane 2 and 3 is negative control, and negative control uses wild shaft-like disease Poison；Swimming lane 4 and 5 is the Bmgp64-N vial supernatants and precipitation of purifying respectively；Swimming lane 6 and 7 is the Bmgp64-N- of purifying respectively RBD supernatants precipitate.The result detected with RBD albumen rabbit-anti is shown in Fig. 8, and wherein negative control uses wild baculoviral.

Using N protein mouse is anti-, RBD albumen mouse it is anti-as probe by Western Blot to recombinant baculovirus Bmgp64- N-RBD immunogene carries out Function Identification, and testing result is shown in Fig. 9.

The effect of the SARS vaccines of embodiment 5

The recombinant baculovirus strain Bmgp64-N-RBD infected silkworm BmN cell lines that embodiment 2 obtains, received after passing on 3 times Virus is obtained, carries out animal body neutralization test, it is BALB/c mouse that animal, which is immunized,（It is easy to get the limited public affairs of experimental article purchased from Tianjin Austria Department, 5 week old, 20 ± 2g）, it is subcutaneously injected, injection dosage is 5 μ g/20g, and antibody titer is detected after 6 weeks, and it protects antibody titer More than 1：150, challenge test result shows the dosage（5μg/20g）Vaccine can produce neutralizing antibody and with obvious resistance virus Effect.

Embodiment described above is only to absolutely prove preferred embodiment that is of the invention and being lifted, protection model of the invention Enclose not limited to this.The equivalent substitute or conversion that those skilled in the art are made on the basis of the present invention, in the present invention Protection domain within.Protection scope of the present invention is defined by claims.

SEQUENCE LISTING

<110>Te Fei（Tianjin）Biological medicine Science and Technology Ltd.

<120>Recombinant baculovirus of surface display SARS bivalent antigens and its preparation method and application

<130> 131181-I-CP-TJYU

<160> 22

<170> PatentIn version 3.3

<210> 1

<211> 485

<212> PRT

<213>Artificial sequence

<400> 1

Met Val Gly Ala Ile Val Leu Tyr Val Leu Leu Ala Ala Ala His Ser

1 5 10 15

Ala Phe Ala Ala Met Ser Asp Asn Gly Pro Gln Ser Asn Gln Arg Ser

20 25 30

Ala Pro Arg Ile Thr Phe Gly Gly Pro Thr Asp Ser Thr Asp Asn Asn

35 40 45

Gln Asn Gly Gly Arg Asn Gly Ala Arg Pro Lys Gln Arg Arg Pro Gln

50 55 60

Gly Leu Pro Asn Asn Thr Ala Ser Trp Phe Thr Ala Leu Thr Gln His

65 70 75 80

Gly Lys Glu Glu Leu Arg Phe Pro Arg Gly Gln Gly Val Pro Ile Asn

85 90 95

Thr Asn Ser Gly Pro Asp Asp Gln Ile Gly Tyr Tyr Arg Arg Ala Thr

100 105 110

Arg Arg Val Arg Gly Gly Asp Gly Lys Met Lys Glu Leu Ser Pro Arg

115 120 125

Trp Tyr Phe Tyr Tyr Leu Gly Thr Gly Pro Glu Ala Ser Leu Pro Tyr

130 135 140

Gly Ala Asn Lys Glu Gly Ile Val Trp Val Ala Thr Glu Gly Ala Leu

145 150 155 160

Asn Thr Pro Lys Asp His Ile Gly Thr Arg Asn Pro Asn Asn Asn Ala

165 170 175

Ala Thr Val Leu Gln Leu Pro Gln Gly Thr Thr Leu Pro Lys Gly Phe

180 185 190

Tyr Ala Glu Gly Ser Arg Gly Gly Ser Gln Ala Ser Ser Arg Ser Ser

195 200 205

Ser Arg Ser Arg Gly Asn Ser Arg Asn Ser Thr Pro Gly Ser Ser Arg

210 215 220

Gly Asn Ser Pro Ala Arg Met Ala Ser Gly Gly Gly Glu Thr Ala Leu

225 230 235 240

Ala Leu Leu Leu Leu Asp Arg Leu Asn Gln Leu Glu Ser Lys Val Ser

245 250 255

Gly Lys Gly Gln Gln Gln Gln Gly Gln Thr Val Thr Lys Lys Ser Ala

260 265 270

Ala Glu Ala Ser Lys Lys Pro Arg Gln Lys Arg Thr Ala Thr Lys Gln

275 280 285

Tyr Asn Val Thr Gln Ala Phe Gly Arg Arg Gly Pro Glu Gln Thr Gln

290 295 300

Gly Asn Phe Gly Asp Gln Asp Leu Ile Arg Gln Gly Thr Asp Tyr Lys

305 310 315 320

His Trp Pro Gln Ile Ala Gln Phe Ala Pro Ser Ala Ser Ala Phe Phe

325 330 335

Gly Met Ser Arg Ile Gly Met Glu Val Thr Pro Ser Gly Thr Trp Leu

340 345 350

Thr Tyr His Gly Ala Ile Lys Leu Asp Asp Lys Asp Pro Gln Phe Lys

355 360 365

Asp Asn Val Ile Leu Leu Asn Lys His Ile Asp Ala Tyr Lys Thr Phe

370 375 380

Pro Pro Thr Glu Pro Lys Lys Asp Lys Lys Lys Lys Thr Asp Glu Ala

385 390 395 400

Gln Pro Leu Pro Gln Arg Gln Lys Lys Gln Pro Thr Val Thr Leu Leu

405 410 415

Pro Ala Ala Asp Met Asp Asp Phe Ser Arg Gln Leu Gln Asn Ser Met

420 425 430

Ser Gly Ala Ser Ala Asp Ser Thr Gln Ala Met Ala Glu Gly Glu Leu

435 440 445

Ala Ala Lys Leu Thr Ser Phe Met Phe Gly His Val Ala Thr Phe Val

450 455 460

Ile Val Phe Ile Val Ile Leu Phe Leu Tyr Cys Met Val Arg Asn Arg

465 470 475 480

Asn Ser Arg Gln Tyr

485

<210> 2

<211> 403

<212> PRT

<213>Artificial sequence

<400> 2

Met Val Gly Ala Ile Val Leu Tyr Val Leu Leu Ala Ala Ala His Ser

1 5 10 15

Ala Phe Ala Ala Met Gly Phe Asn Thr Leu Lys Pro Ile Phe Lys Leu

20 25 30

Pro Leu Gly Ile Asn Ile Thr Asn Phe Arg Ala Ile Leu Thr Ala Phe

35 40 45

Ser Pro Ala Gln Asp Ile Trp Gly Thr Ser Ala Ala Ala Tyr Phe Val

50 55 60

Gly Tyr Leu Lys Pro Thr Thr Phe Met Leu Lys Tyr Asp Glu Asn Gly

65 70 75 80

Thr Ile Thr Asp Ala Val Asp Cys Ser Gln Asn Pro Leu Ala Glu Leu

85 90 95

Lys Cys Ser Val Lys Ser Phe Glu Ile Asp Lys Gly Ile Tyr Gln Thr

100 105 110

Ser Asn Phe Arg Val Val Pro Ser Gly Asp Val Val Arg Phe Pro Asn

115 120 125

Ile Thr Asn Leu Cys Pro Phe Gly Glu Val Phe Asn Ala Thr Lys Phe

130 135 140

Pro Ser Val Tyr Ala Trp Glu Arg Lys Lys Ile Ser Asn Cys Val Ala

145 150 155 160

Asp Tyr Ser Val Leu Tyr Asn Ser Thr Phe Phe Ser Thr Phe Lys Cys

165 170 175

Tyr Gly Val Ser Ala Thr Lys Leu Asn Asp Leu Cys Phe Ser Asn Val

180 185 190

Tyr Ala Asp Ser Phe Val Val Lys Gly Asp Asp Val Arg Gln Ile Ala

195 200 205

Pro Gly Gln Thr Gly Val Ile Ala Asp Tyr Asn Tyr Lys Leu Pro Asp

210 215 220

Asp Phe Met Gly Cys Val Leu Ala Trp Asn Thr Arg Asn Ile Asp Ala

225 230 235 240

Thr Ser Thr Gly Asn Tyr Asn Tyr Lys Tyr Arg Tyr Leu Arg His Gly

245 250 255

Lys Leu Arg Pro Phe Glu Arg Asp Ile Ser Asn Val Pro Phe Ser Pro

260 265 270

Asp Gly Lys Pro Cys Thr Pro Pro Ala Leu Asn Cys Tyr Trp Pro Leu

275 280 285

Asn Asp Tyr Gly Phe Tyr Thr Thr Thr Gly Ile Gly Tyr Gln Pro Tyr

290 295 300

Arg Val Val Val Leu Ser Phe Glu Leu Leu Asn Ala Pro Ala Thr Val

305 310 315 320

Cys Gly Pro Lys Leu Ser Thr Asp Leu Ile Lys Asn Gln Cys Val Asn

325 330 335

Phe Asn Phe Asn Gly Leu Thr Gly Thr Gly Val Leu Thr Pro Ser Ser

340 345 350

Lys Arg Phe Gln Pro Phe Gln Gln Met Ala Glu Gly Glu Leu Ala Ala

355 360 365

Lys Leu Thr Ser Phe Met Phe Gly His Val Ala Thr Phe Val Ile Val

370 375 380

Phe Ile Val Ile Leu Phe Leu Tyr Cys Met Val Arg Asn Arg Asn Ser

385 390 395 400

Arg Gln Tyr

<210> 3

<211> 1458

<212> DNA

<213>Artificial sequence

<400> 3

atggtaggcg ctattgtttt atacgtgctt ttggcggcgg cgcattctgc ctttgcggcg 60

atgtctgata atggacccca atcaaaccaa cgtagtgccc cccgcattac atttggtgga 120

cccacagatt caactgacaa taaccagaat ggaggacgca atggggcaag gccaaaacag 180

cgccgacccc aaggtttacc caataatact gcgtcttggt tcacagctct cactcagcat 240

ggcaaggagg aacttagatt ccctcgaggc cagggcgttc caatcaacac caatagtggt 300

ccagatgacc aaattggcta ctaccgaaga gctacccgac gagttcgtgg tggtgacggc 360

aaaatgaaag agctcagccc cagatggtac ttctattacc taggaactgg cccagaagct 420

tcacttccct acggcgctaa caaagaaggc atcgtatggg ttgcaactga gggagccttg 480

aatacaccca aagaccacat tggcacccgc aatcctaata acaatgctgc caccgtgcta 540

caacttcctc aaggaacaac attgccaaaa ggcttctacg cagagggaag cagaggcggc 600

agtcaagcct cttctcgctc ctcatcacgt agtcgcggta attcaagaaa ttcaactcct 660

ggcagcagta ggggaaattc tcctgctcga atggctagcg gaggtggtga aactgccctc 720

gcgctattgc tgctagacag attgaaccag cttgagagca aagtttctgg taaaggccaa 780

caacaacaag gccaaactgt cactaagaaa tctgctgctg aggcatctaa aaagcctcgc 840

caaaaacgta ctgccacaaa acagtacaac gtcactcaag catttgggag acgtggtcca 900

gaacaaaccc aaggaaattt cggggaccaa gacctaatca gacaaggaac tgattacaaa 960

cattggccgc aaattgcaca atttgctcca agtgcctctg cattctttgg aatgtcacgc 1020

attggcatgg aagtcacacc ttcgggaaca tggctgactt atcatggagc cattaaattg 1080

gatgacaaag atccacaatt caaagacaac gtcatactgc tgaacaagca cattgacgca 1140

tacaaaacat tcccaccaac agagcctaaa aaggacaaaa agaaaaagac tgatgaagct 1200

cagcctttgc cgcagagaca aaagaagcag cccactgtga ctcttcttcc tgcggctgac 1260

atggatgatt tctccagaca acttcaaaat tccatgagtg gagcttctgc tgattcaact 1320

caggcaatgg ctgaaggcga attggccgcc aaattgactt cgttcatgtt tggtcatgta 1380

gccacttttg taattgtatt tattgtaatt ttatttttgt actgtatggt tagaaaccgt 1440

aatagtagac aatattaa 1458

<210> 4

<211> 1212

<212> DNA

<213>Artificial sequence

<400> 4

atggtaggcg ctattgtttt atacgtgctt ttggcggcgg cgcattctgc ctttgcggcg 60

atgggtttta acactttgaa acctattttt aagttgcctc ttggtattaa cattacaaat 120

tttagagcca ttcttacagc cttttcacct gctcaagaca tttggggcac gtcagctgca 180

gcctattttg ttggctattt aaagccaact acatttatgc tcaagtatga tgaaaatggt 240

acaatcacag atgctgttga ttgttctcaa aatccacttg ctgaactcaa atgctctgtt 300

aagagctttg agattgacaa aggaatttac cagacctcta atttcagggt tgttccctca 360

ggagatgttg tgagattccc taatattaca aacttgtgtc cttttggaga ggtttttaat 420

gctactaaat tcccttctgt ctatgcatgg gagagaaaaa aaatttctaa ttgtgttgct 480

gattactctg tgctctacaa ctcaacattt ttttcaacct ttaagtgcta tggcgtttct 540

gccactaagt tgaatgatct ttgcttctcc aatgtctatg cagattcttt tgtagtcaag 600

ggagatgatg taagacaaat agcgccagga caaactggtg ttattgctga ttataattat 660

aaattgccag atgatttcat gggttgtgtc cttgcttgga atactaggaa cattgatgct 720

acttcaactg gtaattataa ttataaatat aggtatctta gacatggcaa gcttaggccc 780

tttgagagag acatatctaa tgtgcctttc tcccctgatg gcaaaccttg caccccacct 840

gctcttaatt gttattggcc attaaatgat tatggttttt acaccactac tggcattggc 900

taccaacctt acagagttgt agtactttct tttgaacttt taaatgcacc ggccacggtt 960

tgtggaccaa aattatccac tgaccttatt aagaaccagt gtgtcaattt taattttaat 1020

ggactcactg gtactggtgt gttaactcct tcttcaaaga gatttcaacc atttcaacaa 1080

atggctgaag gcgaattggc cgccaaattg acttcgttca tgtttggtca tgtagccact 1140

tttgtaattg tatttattgt aattttattt ttgtactgta tggttagaaa ccgtaatagt 1200

agacaatatt aa 1212

<210> 5

<211> 18

<212> DNA

<213>Artificial sequence

<400> 5

tgtaaaacga cggccagt 18

<210> 6

<211> 18

<212> DNA

<213>Artificial sequence

<400> 6

caggaaacag ctatgacc 18

<210> 7

<211> 25

<212> DNA

<213>Artificial sequence

<400> 7

acacccggga tggtaggcgc tattg 25

<210> 8

<211> 20

<212> DNA

<213>Artificial sequence

<400> 8

tatcagacat cgccgcaaag 20

<210> 9

<211> 26

<212> DNA

<213>Artificial sequence

<400> 9

ctttgcggcg atgtctgata atggac 26

<210> 10

<211> 22

<212> DNA

<213>Artificial sequence

<400> 10

cttcagccat tgcctgagtt ga 22

<210> 11

<211> 22

<212> DNA

<213>Artificial sequence

<400> 11

aactcaggca atggctgaag gc 22

<210> 12

<211> 31

<212> DNA

<213>Artificial sequence

<400> 12

gccggtacct taatattgtc tactattacg g 31

<210> 13

<211> 22

<212> DNA

<213>Artificial sequence

<400> 13

cggatccatg gtaggcgcta tt 22

<210> 14

<211> 20

<212> DNA

<213>Artificial sequence

<400> 14

taaaacccat cgccgcaaag 20

<210> 15

<211> 26

<212> DNA

<213>Artificial sequence

<400> 15

ctttgcggcg atgggtttta acactt 26

<210> 16

<211> 23

<212> DNA

<213>Artificial sequence

<400> 16

cttcagccat ttgttgaaat ggt 23

<210> 17

<211> 22

<212> DNA

<213>Artificial sequence

<400> 17

atttcaacaa atggctgaag gc 22

<210> 18

<211> 25

<212> DNA

<213>Artificial sequence

<400> 18

gccactagtt taatattgtc tacta 25

<210> 19

<211> 1593

<212> DNA

<213>Artificial sequence

<400> 19

atgctactag taaatcagtc ataccaaggc ttcgataaga aacacacaag cgagatggta 60

ggcgctattg ttttatacgt gcttttggcg gcggcgcatt ctgcctttgc ggcggagcac 120

tgcaacgcgc aaatgaaaac gggtccgtac aaaattaaaa acttggacat taccccgccc 180

aaggaaacgc tgcaaaagga cgtggaaatc accatcgtgg agacggacta caacgaaaac 240

gtgattattg gctacaaggg gtactaccag gcgtatgcgt acaacggagg ctcgctggat 300

cccaacacac gcgtcgaaga atccatgaaa acgctgactg tgggcaaaga agatttgctc 360

atgtggggta tcaggcagca gtgcgaggtg ggcgaagagt taatcgaccg ttggggcagt 420

gacagcgaag agtgttttcg cgacaacgaa ggccgcggcc agtgggtcaa aggcaaagag 480

ttggtgaaac ggcagaataa caatcacttt gcgtaccaca cgtgcaacaa atcgtggcga 540

tgcggcgttt ctacttcgaa aatgtacagc aggctcgagt gccacgacga caccgacgag 600

tgtcaggtat acattttgga cgctgagggc aaccccatta acgtgaccgt ggacactgcg 660

cttcatcgag acggcgtgag tatgattctc aaacaaaagt ctacgttcac cacgcgccaa 720

gtaaaagctg cgtgtctgct cattaaagat gacaaaaata accccgaatc ggtgacacgc 780

gaacactgtt tgatcgacaa tgatatatat gatctttcta aaaacacgtg gaattgcagg 840

tttaacagat gcattaaacg taaagtcgag caccaagtca agaaacggcc acccacttgg 900

cgccacaacg ttagagccaa gtacacagaa ggagacactg ccaccaaagg cgacctgatg 960

catattcaag aggagctgat gtacgaaaac gatttgctga aaatgaacat tgagctgatg 1020

catgcgcata tcaacaagat aaacaatatg ctgcacgacc tgatagtttc cgtggccaag 1080

gtggacgagc gtttgattgg caatctcatg aacaattctg tttcttcaac atttttgtcg 1140

gacgacacgt ttttgctgat gccgtgcacc aatccgccgg cacacaccag taattgctac 1200

aacaacagca tttacaaaga agggcgttgg gtggccaaca cggactcgtc gcaatgcata 1260

gattttagca actacaagga actagcaatc gacgacgacg tcgaattttg gattccgacc 1320

atcggcaaca caacctatca cgacagttgg aaagatgcca gcggttggtc gtttattgcc 1380

caacaaaaaa gcaatctcat aaccaccatg gagaacacca agtttggcgg cgtcggcacc 1440

agtctgaacg acatcacttc catggctgaa ggcgaattgg ccgccaaatt gacttcgttc 1500

atgtttggtc atgtagccac ttttgtaatt gtatttattg taattttatt tttgtactgt 1560

atggttagaa accgtaatag tagacaatat taa 1593

<210> 20

<211> 1269

<212> DNA

<213>Artificial sequence

<400> 20

atgtctgata atggacccca atcaaaccaa cgtagtgccc cccgcattac atttggtgga 60

cccacagatt caactgacaa taaccagaat ggaggacgca atggggcaag gccaaaacag 120

cgccgacccc aaggtttacc caataatact gcgtcttggt tcacagctct cactcagcat 180

ggcaaggagg aacttagatt ccctcgaggc cagggcgttc caatcaacac caatagtggt 240

ccagatgacc aaattggcta ctaccgaaga gctacccgac gagttcgtgg tggtgacggc 300

aaaatgaaag agctcagccc cagatggtac ttctattacc taggaactgg cccagaagct 360

tcacttccct acggcgctaa caaagaaggc atcgtatggg ttgcaactga gggagccttg 420

aatacaccca aagaccacat tggcacccgc aatcctaata acaatgctgc caccgtgcta 480

caacttcctc aaggaacaac attgccaaaa ggcttctacg cagagggaag cagaggcggc 540

agtcaagcct cttctcgctc ctcatcacgt agtcgcggta attcaagaaa ttcaactcct 600

ggcagcagta ggggaaattc tcctgctcga atggctagcg gaggtggtga aactgccctc 660

gcgctattgc tgctagacag attgaaccag cttgagagca aagtttctgg taaaggccaa 720

caacaacaag gccaaactgt cactaagaaa tctgctgctg aggcatctaa aaagcctcgc 780

caaaaacgta ctgccacaaa acagtacaac gtcactcaag catttgggag acgtggtcca 840

gaacaaaccc aaggaaattt cggggaccaa gacctaatca gacaaggaac tgattacaaa 900

cattggccgc aaattgcaca atttgctcca agtgcctctg cattctttgg aatgtcacgc 960

attggcatgg aagtcacacc ttcgggaaca tggctgactt atcatggagc cattaaattg 1020

gatgacaaag atccacaatt caaagacaac gtcatactgc tgaacaagca cattgacgca 1080

tacaaaacat tcccaccaac agagcctaaa aaggacaaaa agaaaaagac tgatgaagct 1140

cagcctttgc cgcagagaca aaagaagcag cccactgtga ctcttcttcc tgcggctgac 1200

atggatgatt tctccagaca acttcaaaat tccatgagtg gagcttctgc tgattcaact 1260

caggcataa 1269

<210> 21

<211> 1023

<212> DNA

<213>Artificial sequence

<400> 21

atgggtttta acactttgaa acctattttt aagttgcctc ttggtattaa cattacaaat 60

tttagagcca ttcttacagc cttttcacct gctcaagaca tttggggcac gtcagctgca 120

gcctattttg ttggctattt aaagccaact acatttatgc tcaagtatga tgaaaatggt 180

acaatcacag atgctgttga ttgttctcaa aatccacttg ctgaactcaa atgctctgtt 240

aagagctttg agattgacaa aggaatttac cagacctcta atttcagggt tgttccctca 300

ggagatgttg tgagattccc taatattaca aacttgtgtc cttttggaga ggtttttaat 360

gctactaaat tcccttctgt ctatgcatgg gagagaaaaa aaatttctaa ttgtgttgct 420

gattactctg tgctctacaa ctcaacattt ttttcaacct ttaagtgcta tggcgtttct 480

gccactaagt tgaatgatct ttgcttctcc aatgtctatg cagattcttt tgtagtcaag 540

ggagatgatg taagacaaat agcgccagga caaactggtg ttattgctga ttataattat 600

aaattgccag atgatttcat gggttgtgtc cttgcttgga atactaggaa cattgatgct 660

acttcaactg gtaattataa ttataaatat aggtatctta gacatggcaa gcttaggccc 720

tttgagagag acatatctaa tgtgcctttc tcccctgatg gcaaaccttg caccccacct 780

gctcttaatt gttattggcc attaaatgat tatggttttt acaccactac tggcattggc 840

taccaacctt acagagttgt agtactttct tttgaacttt taaatgcacc ggccacggtt 900

tgtggaccaa aattatccac tgaccttatt aagaaccagt gtgtcaattt taattttaat 960

ggactcactg gtactggtgt gttaactcct tcttcaaaga gatttcaacc atttcaacaa 1020

taa 1023

<210> 22

<211> 8

<212> PRT

<213>Artificial sequence

<400> 22

Phe Tyr Tyr Leu Gly Thr Gly Pro

1 5

Claims (7)

1. a kind of recombinant baculovirus of surface display SARS bivalent antigens, it is characterised in that the virus is by recombinant protein SP- N-TM and SP-RBD-TM encoding gene is inserted into donor plasmid and carried out together by swivel base and shuttle vector Bacmid genome Source is recombinated, and obtains recombinant baculovirus genomic DNA, and recombinant baculovirus genomic DNA then is transfected into bombyx mori cell, is in Silkworm is packaged to be the recombinant baculovirus of described surface display SARS antigen N genes and RBD genes into the cell；

Wherein, the recombinant protein SP-N-TM is to connect shaft-like viral envelope proteins GP64 by the N- ends of the N protein of SARS virus Signal peptide SP, C- ends connect shaft-like viral envelope proteins GP64 membrane-spanning domain TM and form；

The recombinant protein SP-RBD-TM is to connect shaft-like viral envelope proteins GP64 by the N- ends of the RBD albumen of SARS virus Signal peptide SP, C- ends connect shaft-like viral envelope proteins GP64 membrane-spanning domain TM and form,

Wherein, the donor plasmid is pFastBacDual, and recombinant protein SP-N-TM encoding gene is inserted into donor plasmid Under pFastBacDual p10 promoters, recombinant protein SP-RBD-TM encoding gene is inserted into donor plasmid Under pFastBacDual pPolh promoters, it is built into the genome after restructuring swivel base plasmid again with shuttle vector Bacmid and enters Row homologous recombination；

Wherein, the amino acid sequence of the recombinant protein SP-N-TM such as SEQ ID NO:Shown in 1；The recombinant protein SP-RBD- TM amino acid sequence such as SEQ ID NO:Shown in 2.

2. the recombinant baculovirus of surface display SARS bivalent antigens according to claim 1, it is characterised in that described heavy Histone SP-N-TM encoding gene nucleotide sequence such as SEQ ID NO:Shown in 3；The volume of the recombinant protein SP-RBD-TM Code gene nucleotide series such as SEQ ID NO:Shown in 4.

3. the recombinant baculovirus of surface display SARS bivalent antigens according to claim 2, it is characterised in that the family Silkworm cell is Bombyx noriN cell.

4. the preparation method of the recombinant baculovirus of any described surface display SARS bivalent antigens of claim 1 ~ 3, it is special Sign is that step is as follows：

（1）The volume of PCR amplification acquisition baculoviral envelope protein GP64 signal peptides SP encoding gene, the N protein of SARS virus Code gene, SARS virus RBD albumen encoding gene and baculoviral envelope protein GP64 membrane-spanning domain TM encoding gene；

（2）The method expanded by over-lap PCR obtains the encoding gene by SP encoding gene, the encoding gene of N protein and TM The recombination SP-N-TM being sequentially connected, and introduced respectively at its 5 ' and 3 ' endSmaI andKpnI restriction enzyme sites；Over-lap PCR obtains The recombination SP-RBD-TM being sequentially connected by SP encoding gene, the encoding gene of RBD albumen and TM encoding gene is obtained, And introduced respectively at its 5 ' and 3 ' endBamHI andSpeI restriction enzyme sites；Recombination SP-N-TM is connected to carrier Under pFastBacDual p10 promoters, SP-RBD-TM is connected under carrier pFastBacDual pPolh promoters, structure Into restructuring swivel base plasmid；

（3）Swivel base plasmid conversion Bacmid containing baculovirus shuttle vector Escherichia coli DH10Bac competent cells are recombinated, are entered Row homologous recombination, blue hickie is carried out on the LB culture plates containing kanamycins, gentamicin, tetracycline, X-gal and IPTG Screen, picking hickie after 40 ~ 48h of lucifuge culture, extracting recombinant baculovirus genomic DNA enters after hickie continues 24 ~ 48h of culture Performing PCR is identified；

（4）Take step（3）Identify that correct recombinant baculovirus genomic DNA transfects bombyx mori cell by liposome mediated-method, Generation viral suspension is obtained after morbidity, extraction viral genome enters performing PCR identification again, and identification is correctly surface display The recombinant baculovirus of SARS bivalent antigens；

The PCR identifications use two groups of primers, respectively SEQ ID NO:5、SEQ ID NO:7 and SEQ ID NO:12 compositions Primer sets, and SEQ ID NO:6、SEQ ID NO:13 and SEQ ID NO:18 primer sets formed.

5. the preparation method of the recombinant baculovirus of surface display SARS bivalent antigens according to claim 4, its feature It is, step（1）The primer nucleotide sequences that middle amplification baculoviral envelope protein GP64 signal peptides SP encoding gene uses Such as SEQ ID NO:Shown in 7 ~ 8；The primer nucleotide sequences such as SEQ ID that the encoding gene of amplification SARS Nucleocapsid uses NO:Shown in 9 ~ 10；The primer nucleotide sequences that amplification baculoviral envelope protein GP64 membrane-spanning domain TM encoding gene uses Such as SEQ ID NO:Shown in 11 ~ 12.

6. the preparation method of the recombinant baculovirus of surface display SARS bivalent antigens according to claim 4, its feature It is, step（1）The primer nucleotide sequences that middle amplification baculoviral envelope protein GP64 signal peptides SP encoding gene uses Such as SEQ ID NO:Shown in 13 ~ 14；The primer nucleotide sequences such as SEQ that the encoding gene of amplification SARS virus RBD albumen uses ID NO:Shown in 15 ~ 16；The prime nucleotide that amplification baculoviral envelope protein GP64 membrane-spanning domain TM encoding gene uses Sequence such as SEQ ID NO:Shown in 17 ~ 18.

7. the recombinant baculovirus of any described surface display SARS bivalent antigens of claim 1 ~ 3 is in SARS vaccines are prepared Application.