CN104292338B

CN104292338B - Recombinant protein containing SARS virus N antigen and baculovirus displaying N protein

Info

Publication number: CN104292338B
Application number: CN201310301846.4A
Authority: CN
Inventors: 张耀洲; 闫晶晶; 舒特俊; 陈剑清; 盖其静
Original assignee: TEFEI (TIANJIN) BIOLOGICAL MEDICAL TECHNOLOGY Co Ltd
Current assignee: TEFEI (TIANJIN) BIOLOGICAL MEDICAL TECHNOLOGY Co Ltd
Priority date: 2013-07-18
Filing date: 2013-07-18
Publication date: 2017-02-15
Anticipated expiration: 2033-07-18
Also published as: CN104292338A

Abstract

The invention discloses a recombinant protein containing an SARS virus N antigen and a baculovirus displaying an N protein. The recombinant protein SP-N-TM is formed by connecting an N- end of the N protein of an SARS virus with a signal peptide SP of a baculovirus envelope protein GP64, and connecting a C- end with a transmembrane domain TM of the baculovirus envelope protein GP64. The recombinant baculovirus having the surface displaying the SARS antigen N protein is the recombinant baculovirus obtained by the steps of inserting a cording gene of the SP-N-TM into a donor plasmid, carrying out homologous recombination with a genome of a shuttle vector Bacmid through transposition to obtain a recombinant baculovirus genome, then transfecting a bombyx mori cell with the recombinant baculovirus genome, and packaging in the cell to obtain the recombinant baculovirus. The recombinant baculovirus allows an N protein gene of the SARS virus to be fused with a bombyx mori baculovirus envelope protein GP64 gene, realizes display of the N protein on the surface of a viral capsid, and has good immunogenicity and large application value.

Description

The recombinant protein of the antigen of N containing SARS virus and the baculoviral showing N protein

Technical field

The present invention relates to biomedicine technical field is and in particular to a kind of recombinant protein of N containing SARS virus antigen, and exhibition Show the recombinant baculovirus of N protein.

Background technology

Serious acute respiratory syndrome（Severe Acute Respiratory Syndromes）, also known as infectiousness SARS Type pneumonia, abbreviation SARS, is a kind of new respiratory system communicable disease causing because of infection sars coronavirus.Mainly pass through Closely air droplet transmission, with heating, headache, DOMS, weak, few phlegm of dry cough etc. as main clinical manifestation, severe patient May occur in which respiratory distress.This disease has stronger infectiousness, has significant clustering phenomena in family and hospital.The first case, It is that the whole world is the first, occur in Foshan in November, 2002, and quickly form epidemic status.In November, 2002 was to 2003 8 Months 5 days, 29 national report clinically diagnosed cases totally 8422, dead 916.The average mortality of reported cases is 9.3%. This virus likely originates from animal, is crossed over germline barrier and is infected due to change and adaptive the increasing of virus of external environment Give people class, and achieve interpersonal propagation.

Although SARS is controlled, SARS virus is unlikely " to be eliminated " or automatic disappearance in a short time, and SARS exists The possibility occurring again in crowd is very big.There is the time of SARS epidemic situation again, the main time with virus attack human body has Close, be not necessarily characterized as Winter-Spring occurred frequently.Animal takes viruliferous Seasonal Distribution, people is infected by contact with chance of animal etc. by shadow Ring the time that epidemic situation occurs again.Animal remains the possible source of virus, and crowd is still generally susceptible to SARS virus, its epidemic disease Seedling is still current research emphasis.

SARS vaccine includes therapeutic vaccine, inactivated vaccine, DNA vaccination, polyepitope vaccines etc. at present, has necessarily to enter Exhibition, but there is also corresponding problem, specifically see table.

Table 1

	Advantage	Shortcoming
			Therapeutic vaccine	It is not required to the Fc that host identifies antibody Section	Need antibody humanization
Inactivated virus vaccine	Time is short；Inexpensively；Technology is easier to； Vaccine is relatively stable；Do not need cold Hide；It is easy to transport	Production safety condition is high；There is safety issue；Need to repeatedly note Penetrate；Immune response low effort
			Nucleic acid vaccine（Base Because of vaccine or DNA Vaccine）	Preparation is simple；Easily produce in a large number； Security is good, can inductor simultaneously Liquid immunity and cellullar immunologic response； Can continuous expression in vivo	Continuous expression external source may produce some adverse consequences；Impact core The uncertain factor that sour vaccine induces immune response is a lot
Polyepitope vaccines	Can divide with different types of MHC Son combines, and realizes efficiently offering, And inducible very strong cell Immunity	Lack to SARS-CoV Protein Epitopes, particularly conformation table Position understand in depth；The polypeptide of synthesis is only capable of covering the line of minority Property epitope it is impossible to induction produce high-caliber body fluid exempt from Epidemic disease response

Urgently study a kind of new SARS vaccine and overcome the problems referred to above.

Content of the invention

In order to overcome the drawbacks described above of prior art vaccine, the invention provides a kind of restructuring of N containing SARS virus antigen Protein S P-N-TM, is built the recombinant baculovirus of surface display SARS antigen N protein, has good using this recombinant protein Immunogenicity.

This contains the recombinant protein SP-N-TM of SARS virus N antigen, is shaft-like by the N- end connection of the N protein of SARS virus The signal peptide SP of viral envelope proteins GP64, the membrane-spanning domain TM that C- end connects shaft-like viral envelope proteins GP64 is constituted.

Preferably, the recombinant protein SP-N-TM of the above-mentioned antigen of N containing SARS virus, its amino acid sequence such as SEQ ID NO:1 Shown.

Present invention also offers the encoding gene of the recombinant protein SP-N-TM of the above-mentioned antigen of N containing SARS virus, its nucleotides Sequence such as SEQ ID NO:Shown in 2.

Present invention also offers a kind of recombinant baculovirus of surface display SARS antigen N protein, it is by above-mentioned restructuring egg The encoding gene of white SP-N-TM is inserted into donor plasmid and carries out homology weight by the genome of swivel base and shuttle vector Bacmid Group, obtains recombinant baculovirus genomic DNA, then recombinant baculovirus genomic DNA is transfected bombyx mori cell, thin in silkworm Intracellular is packaged to be the recombinant baculovirus of described surface display SARS antigen N protein.

Shuttle vector Bacmid（I.e. Baculovirus plasmid）It is the plasmid with Baculovirus Gene group, can be Shuttle between bacterium and insect cell, be one of member of Bac-to-bac baculovirus expression system, this system also includes supplying Physique grain and helper plasmid and Escherichia coli, are prior art.

Preferably, the recombinant baculovirus of above-mentioned surface display SARS antigen N protein, described donor plasmid is The encoding gene of pFastBacDual, recombinant protein SP-N-TM is inserted into the p10 promoter of donor plasmid pFastBacDual Under, carry out homologous recombination with the genome of shuttle vector Bacmid again after being built into restructuring swivel base plasmid.

Wherein, carrier pFastBacDual is the donor plasmid of Bac-to-bac expression system, may be inserted into foreign gene And under the swivel base enzyme effect of helper plasmid coding, foreign gene is inserted in Bacmid.Carrier pFastBacDual is Commercialization.

Preferably, the recombinant baculovirus of above-mentioned surface display SARS antigen N protein, described bombyx mori cell is silkworm BmN Cell.

Present invention also offers the preparation method of the recombinant baculovirus of above-mentioned surface display SARS antigen N protein, step As follows：

（1）PCR amplification obtains the encoding gene of baculoviral envelope protein GP64 signal peptide SP, the N protein of SARS virus Encoding gene and baculoviral envelope protein GP64 membrane-spanning domain TM encoding gene；

（2）Step is spliced by the method that over-lap PCR expands（1）The three kinds of gene orders obtaining, obtain recombinant protein SP- The encoding gene of N-TM, then encoding gene segment is connected under the p10 promoter of carrier pFastBacDual, it is built into restructuring Swivel base plasmid；

（3）The Escherichia coli DH10Bac competence containing baculovirus shuttle vector Bacmid for the restructuring swivel base plasmid conversion is thin Born of the same parents, carry out homologous recombination, carry out on containing kanamycins, gentamicin, tetracycline, the LB culture plate of X-gal and IPTG Blue hickie screening, lucifuge cultivates picking hickie after 40 ~ 48h, and hickie extracts recombinant baculovirus gene after continuing culture 24 ~ 48h Group DNA enters performing PCR identification；

（4）Take step（3）Identify that correct recombinant baculovirus genomic DNA transfects silkworm by liposome mediated-method thin Born of the same parents, obtain generation viral suspension after morbidity, extract viral genome and enter performing PCR identification again, identification is correctly surface exhibition Show the recombinant baculovirus of SARS antigen N protein；

Described PCR identification is using as SEQ ID NO:3、SEQ ID NO:4 and SEQ ID NO:Primer sequence shown in 9.

Preferably, the preparation method of the recombinant baculovirus of above-mentioned surface display SARS antigen N protein, step（1）Middle expansion Increase the primer nucleotide sequences such as SEQ ID NO that the encoding gene of baculoviral envelope protein GP64 signal peptide SP uses:4 ~ 5 institutes Show；The primer nucleotide sequences such as SEQ ID NO that the encoding gene of amplification SARS Nucleocapsid uses:Shown in 6 ~ 7；Amplification bar The primer nucleotide sequences such as SEQ ID NO that the encoding gene of the membrane-spanning domain TM of shape viral envelope proteins GP64 uses:8 ~ 9 institutes Show.

Present invention also offers the recombinant baculovirus of above-mentioned surface display SARS antigen N protein are in preparation SARS vaccine Application.

Compared with prior art, the invention has the advantages that：

By analyzing the genome structure of SARS virus, find that N protein contains 422 amino acid, in the form of being combined with RNA It is present in the core of virion, participate in transcription and the duplication of virus, guard than other albumen such as S, M etc..The N of N protein There is highly conserved sequence FYYLGTGP in end（SEQ ID NO:10）, this sequence is in every other coronavirus N egg Bai Zhongjun has presence.Therefore successfully N gene vaccine can induce strong, wide spectrum, the lasting neutralizing antibody of generation and protectiveness T cell immune response.

Silkworm baculovirus envelope protein GP64 contains Liang Ge very hydrophobic area：The secretory signal peptide of N- end（SP）With The membrane spaning domain (TM) of C- end, be connected with membrane spaning domain is hydrophilic domain, can be virus envelope and host Glycoprotein in cell membrane links together.The present invention is by the N protein gene of SARS virus and silkworm baculovirus envelope protein GP64 Gene Fusion, realizes surface display on viral capsid for the purpose N protein.

The recombinant baculovirus of the surface display SARS antigen N protein that the present invention builds, it is possible to use Bombyx noriN cell is made For bioreactor, there is by baculovirus expression vector system high efficient expression the SARS virus of high clinical value N protein, it can prepare vaccine it is also possible to directly prepare vaccine with recombinant virus it is adaptable to mass produce, it is possible to decrease becomes This, improve yield, and the SARS vaccine using value being produced is big.

SARS vaccine be there is no and produced using baculoviral surface display technologies, and baculovirus expression vector system is eucaryon table Reach, there is posttranslational modification function.The immunogenicity of N protein is relevant with its correct configuration, can be possessed relatively using eukaryotic expression Good immunogenicity.

Brief description

Fig. 1：The structural representation of carrier pFastBacDual.

Fig. 2：Restructuring swivel base plasmid pFstBacDual-gp64-N containing gp64-N builds schematic diagram, wherein p10：Polygonal Body promoter；SP：The signal peptide sequence of gp64 gene；N protein：Nucleocapsid protein（Nucleocapsid protein）；TM： The transmembrane domain of gp64 gene；Sma 、Kpn ：Restriction enzyme site.

Fig. 3：SP-N-TM gene PCR amplified production, wherein M：10kb DNA molecular amount standard, 1：SP-N-TM gene PCR Amplified production, arrow locations are purpose sequence, 1458bp.

Fig. 4：The PCR identification electrophoretogram of restructuring swivel base plasmid pFastBacDual-gp64-N, wherein M：10kb DNA molecular Amount standard, 1：SP-N-TM genes of interest, 2：PFastBacDual-gp64-N double digestion product.

Fig. 5:The PCR primer electroresis appraisal result of recombinant baculovirus genome Bacmid-gp64-N, wherein, M：10kb DNA molecular amount standard, 1：Blank, 2：Psp-F and Ptm-R is the 1458bp fragment of primer amplification, 3：Psp-F and M13F be The 4107bp fragment of primer amplification.

Fig. 6：The PCR primer electroresis appraisal result of recombinant baculovirus Bmp64-N, wherein, M：10kb DNA molecular amount mark Standard, 1：Blank, 2：Negative control, 3：Psp-F and Ptm-R is the 1458bp fragment of primer amplification, 4：Psp-F and M13F be The 4107bp fragment of primer amplification.

Fig. 7:The N protein Western Blot testing result of recombinant baculovirus Bmp64-N（The anti-detection of N protein rabbit）, M： Protein Marker, 1：Prokaryotic expression N protein, 2：Negative control supernatant, 3：Negative control precipitates, and 4：Bmgp64-N supernatant, 5：Bmgp64-N precipitates.

Fig. 8：The N protein function Western Blot testing result of recombinant baculovirus Bmp64-N（The anti-conduct of N protein mouse Probe）, M:Protein Marker, 1：Prokaryotic expression N protein, 2：Bmgp64-N.

Specific embodiment

With reference to specific embodiment, the invention will be further described, so that those skilled in the art can be preferably Understand the present invention and can be practiced, but illustrated embodiment is not as a limitation of the invention.

The present invention expands the coding gene sequence obtaining SARS major antigen N protein by PCR, expands baculoviral simultaneously The encoding gene of the membrane-spanning domain TM of the encoding gene of envelope protein GP64 signal peptide SP and baculoviral envelope protein GP64, passes through Over-lap PCR, obtains SP-N-TM recombination fragment, and is inserted into the p10 of insect cell expression vector pFastBacDual and opens Under mover, obtain restructuring swivel base plasmid（It is named as pFastBacDual-gp64-N）, restructuring swivel base plasmid conversion is containing baculoviral The Escherichia coli DH10Bac competent cell of shuttle vector Bacmid, carries out homologous recombination, obtains recombinant baculovirus genome DNA（Recombinant plasmid is named as Bacmid-gp64-N）, passed through liposome transfection Bombyx noriN cell, assembled shape in the cell Become the recombinant baculovirus of surface display SARS antigen N protein（It is named as Bmgp64-N）, and replicate amplification, use the third generation Bmgp64-N inoculates Bombyx noriN cell, collects virus liquid, be centrifuged, isolate and purify, make SARS vaccine after 3 ~ 5 days.Detailed below The thin particular content illustrating the present invention.

The structure of embodiment 1 restructuring swivel base plasmid pFastBacDual-gp64-N

1. the acquisition of gp64-N sequence

With silkworm baculovirus gp64 sequence（SEQ ID NO:11）For template, use respectively the primer Psp-F shown in table 2, Psp-R and Ptm-F, Ptm-R enter performing PCR amplification, obtain signal peptide (SP) sequence and transmembrane region (TM) sequence of gp64, with The N protein gene order of SARS virus（SEQ ID NO:12）For template, Pn-F, Pn-R are primer, and PCR amplification obtains N protein Gene order.PCR primer obtains, by over-lap PCR, the restructuring that SP gene order, N gene order and TM gene order are sequentially connected Purpose fragment SP-N-TM, restructuring purpose fragment is inserted under the p10 promoter of carrier pFastBacDual, builds restructuring and turns Seat plasmid pFastBacDual-gp64-N, is started the expression of N gene, so that fusion protein N-terminal is had using this polyhedron promoter Signal peptide (SP), C-terminal has transmembrane region (TM), due to this promoter belong to pole late gene promoter and be strong promoter, that is, Fusion protein is made to be to baculoviral and the virose albumen of host cell, during due to starting track fusion with this promoter Virion has been formed, so fusion protein can also obtain efficiently, express in large quantities.

Table 2 SP-N-TM aligning primer sequences Design

Psp-F	ACACCCGGGATGGTAGGCGCTATTG（SEQ ID NO:4）
		Psp-R	TATCAGACATCGCCGCAAAG（SEQ ID NO:5）
Pn-F	CTTTGCGGCG ATGTCTGATAATGGAC（SEQ ID NO:6）
		Pn-R	CTTCAGCCAT TGCCTGAGTTGA（SEQ ID NO:7）
Ptm-F	AACTCAGGCAATGGCTGAAGGC（SEQ ID NO:8）
		Ptm-R	GCCGGTACCTTAATATTGTCTACTATTACGG（SEQ ID NO:9）

In table 2 at underscore it isSma , Kpn Restriction enzyme site.

(1) amplification of gp64 signal peptide (SP) gene

With silkworm baculovirus gp64 sequence（SEQ ID NO:11）For template, Psp-F and Psp-R is primer, carries out PCR expands.The reaction system of PCR is 50 μ L, and concrete composition is：10 × PCR Buffer 5 μ L, the dNTPs of 2.5 mmol/mL The each 1 μ L of Psp-F and Psp-R, the template 2 μ L of 5 μ L, 0.01nmol/ μ L, Taq archaeal dna polymerase 2 μ L, ddH₂O 34μL.Respectively After component mixes, put in PCR instrument, PCR response parameter：95 DEG C of denaturations 5min, 95 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C extend 30s, 30 circulation, 72 DEG C extension 5min.After question response terminates, electroresis appraisal amplified production segment, purpose segment is big Little for 60bp, cut glue reclaim purpose segment simultaneously.

(2) amplification of gp64 membrane-spanning domain (TM)

With silkworm baculovirus gp64 sequence（SEQ ID NO:11）For template, Ptm-F and Ptm-R is primer, carries out PCR expands.PCR reaction system 50 μ L, concrete component is：The dNTPs 5 μ L of 10 × PCR Buffer 5 μ L, 2.5 mmol/mL, The each 1 μ L of Ptm-F 1 μ L and Ptm-R, the template 2 μ L of 0.01nmol/ μ L, Taq archaeal dna polymerase 2 μ L, ddH₂O 34μL.Respectively After component mixes, put in PCR instrument, PCR response parameter：95 DEG C of denaturations 5min, 95 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C extend 30s, 30 circulation, 72 DEG C extension 5min.After question response terminates, electroresis appraisal amplified production segment, purpose segment is big Little for 132bp, cut glue reclaim purpose segment simultaneously.

(3) the N gene magnification of SARS virus

N protein gene order with SARS virus（SEQ ID NO:12）For template, Pn-F and Pn-R is primer, carries out PCR expands.PCR reaction system 50 μ L, concrete component is：The dNTPs 5 μ L of 10 × PCR Buffer 5 μ L, 2.5 mmol/mL, The each 1 μ L of Pn-F and Pn-R, the template 2 μ L of 0.01nmol/ μ L, Taq archaeal dna polymerase 2 μ L, ddH₂O 34μL.Each component is mixed After even, put in PCR instrument, PCR response parameter：95 DEG C of denaturations 5min, 95 DEG C of denaturation 30s, 53 DEG C of annealing 30s, 72 DEG C of extensions 30s, 30 circulations, 72 DEG C of extension 5min.After question response terminates, electroresis appraisal am-plified fragments, purpose segment size is 1266bp （Delete terminator）, cut glue reclaim purpose segment simultaneously.

(4) acquisition of gp64-N

Simultaneously with step（1）Extremely（3）SP gene order, N gene order and the TM gene order obtaining is template, carries out PCR expands.Amplification system is 50 μ L, and composition is：The dNTPs 5 μ L of 10 × PCR Buffer 5 μ L, 2.5 mmol/mL, SP base Because of sequence 3 μ L, N gene order 3 μ L, TM gene order 3 μ L, Taq archaeal dna polymerase 2 μ L, ddH₂O 29μL.Each component mixes Afterwards, put in PCR instrument, PCR response parameter：95 DEG C of denaturations 5min, 95 DEG C of denaturation 40s, 50 DEG C of renaturation 40s, 72 DEG C of extensions 1min35s, 35 circulations, 72 DEG C of extension 10min.Design 35 circulations by above-mentioned response parameter, obtain overlapping purpose fragment SP- N-TM（It is named as gp64-N）.After question response terminates, electroresis appraisal am-plified fragments, purpose segment size is 1458bp（Referring to figure 3）, cut glue reclaim purpose segment simultaneously.

(5) amplification of gp64-N

With overlapping PCR products SP-N-TM as template, Psp-F and Ptm-R is primer, enters performing PCR amplification.Amplification system is 50 μ L, composition is：The dNTPs 5 μ L of 10 × PCR Buffer 5 μ L, 2.5 mmol/mL, the Psp-F of 0.01nmol/ μ L and The each 1 μ L of Ptm-R, template 2 μ L, Taq archaeal dna polymerase 2 μ L, ddH₂O 34μL.After each component mixes, put in PCR instrument, PCR Response parameter：95 DEG C of denaturations 5min, 95 DEG C of denaturation 45s, 50 DEG C of renaturation 45s, 72 DEG C of extension 1min35s, 30 circulations, 72 DEG C Extend 10min.Design 30 circulations by above-mentioned response parameter.After question response terminates, electroresis appraisal am-plified fragments, cut glue simultaneously and return Receive purpose segment.

2. the structure of restructuring swivel base plasmid pFstBacDual-gp64-N

The gp64-N that above-mentioned PCR amplification is obtained（I.e. SP-N-TM）Sequence passes through restriction enzyme respectivelySma WithKpn (purchased from Fermentas company) carries out double digestion, and digestion products insertion is simultaneously through the pFastBacDual carrier of double digestion （Purchased from Invitrogen company）P10 promoter multicloning sites downstream upstream and downstream two ends, build containing gp64-N sequence Restructuring swivel base plasmid, is named as pFstBacDual-gp64-N.Build the restructuring swivel base plasmid that completes and pass through restriction analysis and double To sequencing identification gene order correct after, restructuring swivel base plasmid construction success.Fig. 4 is restructuring swivel base plasmid pFastBacDual- The PCR identification electrophoretogram of gp64-N.

The acquisition of embodiment 2 silkworm with recombinant baculovirus Bmgp64-N

By identification restructuring, successfully restructuring swivel base plasmid pFastBacDual-gp64-N conversion contains baculovirus shuttle vector The Escherichia coli DH10Bac competent cell of Bacmid（Purchased from Invitrogen company）, mould greatly containing kanamycins, celebrating Element, tetracycline, the LB culture plate of X-gal and IPTG（Purchased from Shanghai Sheng Gong biotech firm, operated to specifications）On Culture, carries out homologous recombination by swivel base（Gp64-N sequence on pFastBacDual-gp64-N is inserted into by homology swivel base The MCS of Bacmid）After carry out blue hickie screening, picking hickie after lucifuge culture 48h, hickie continue containing tetracycline, Extract, with isopropanol, shaft-like disease of recombinating after shaking bacterium culture 48h in kanamycins, gentamicin, the LB nutrient solution of X-gal and IPTG Virus gene group DNA, with M13 universal primer, Psp-F and Ptm-R by genes of interest insertion in PCR amplification identification restructuring Bacmid Situation, inserts successful plasmid and is named as Bacmid-gp64-N（I.e. recombinant baculovirus genome）.Fig. 5 is genome The PCR qualification result of Bacmid-gp64-N.

Wherein, M13 universal primer sequence：

M13F：TGTAAAACGACGGCCAGT（SEQ ID NO:3）.

Identify that successful plasmid Bacmid-gp64-N transfects Bombyx noriN cell by liposome mediated-method（It is purchased from Invitrogen company）, transfect and use Invitrogen company lipofectamine Cellfectin II Reagent, turn Dyeing method, with reference to this transfection reagent specification, transfects concrete steps：

The plasmid Bacmid-gp64-N of 6 μ L and 8 μ L transfection reagents are added to the serum free medium of 76 μ L by evening before that day In, incubated at room 20min, make liposome fully wrap up plasmid Bacmid-gp64-N, be then added into 1mL well-grown Bombyx noriN cell in, insert incubator overnight incubation, serum free medium is siphoned away by the next morning, changed into serum training Foster base is cultivated 5 ~ 7 days, treats that cell is fallen ill.

After cell morbidity（Micro- sem observation）Obtain 4 DEG C of generation viral suspension to preserve, extraction viral genome M13F, Psp-F, Ptm-R identify, qualification result is shown in Fig. 6, and wherein negative control is wild baculoviral, and result shows that virus formulation becomes Work(, obtains the recombinant baculovirus of surface display SARS antigen N protein, is named as Bmgp64-N.

Embodiment 3 N protein is in the expression of Bombyx noriN cell

By recombinant baculovirus Bmgp64-N with 3 × 10^-6The dosage infected silkworm BmN cell of pfu/cell carries out virus expansion Increase, after infecting 3 ~ 5 days, collect virus liquid, separated purifying, take 10 μ L of supernatant liquid to add isopyknic 2 × protein loadings to delay Rush liquid (100Mm Tris-HCl, 4%SDS, 0.15% bromophenol blue, 10% glycerine), 100 DEG C of heating 10min, take the mixing after heating Liquid 10 μ L carries out SDS-PAGE analysis, and result shows, this silkworm with recombinant baculovirus has expressed N protein, and protein sequencing result shows Show, its amino acid sequence such as SEQ ID NO:Shown in 1.

Embodiment 4 isolates and purifies Bmgp64-N virus from Bombyx noriN cell

（1）Take the Bombyx noriN cell virus liquid that 200mL infects through Bmgp64-N；

（2）Virus liquid is added in 50mL centrifuge tube, 8000rpm is centrifuged 30min, takes supernatant, thin to remove in triplicate Born of the same parents' residue；

（3）By step（2）The centrifuged supernatant obtaining pours 50mL centrifuge tube into, and 15000rpm is centrifuged 60min, takes supernatant, In triplicate；

（4）By step（3）The centrifuged supernatant obtaining, the hollow-fibre membrane being 100KD with molecular cut off carries out ultrafiltration, It is continuously added sterilized water, aseptic water volume used is about 10 times of sample, and whole ultra-filtration process operates all under 4 DEG C of environment, weight Multiple 5 times；

（5）Step（4）Supernatant after film bag ultrafiltration, in the ultra-filtration centrifuge tube being sub-packed in sterilizing on super-clean bench, with injection Bubble in pipe driven away by device, puts into Hitachi's CP70MX centrifuge and is centrifuged 40min, gained black group ultrafiltrate with rotating speed 50000rpm （I.e. phosphate buffer PBS）Resuspended, the membrane filtration with 0.22 μm is degerming, obtains the recombinant baculovirus purifying.

Detect the expression of recombinant baculovirus N protein by Western Blot（With the anti-detection of the rabbit of N protein）, knot Fruit sees Fig. 7, and wherein swimming lane 1, for the N protein of prokaryotic expression as positive control, is to use gene constructed for N protein in pET-28a On, with the protein product of e. coli bl21 expression；Swimming lane 2 and 3 is negative control result, and negative control uses wild bar Shape virus；Swimming lane 4 and 5 is the Bmgp64-N vial supernatant purifying and precipitation respectively.

By Western Blot, the immunogene of recombinant baculovirus Bmgp64-N is carried out so that N protein mouse is anti-as probe Function Identification, testing result is shown in Fig. 8.

The effect of embodiment 5 SARS vaccine

The recombinant baculovirus strain Bmgp64-N infected silkworm BmN clone that embodiment 2 obtains, passes on 3 times and harvests disease afterwards Poison, carries out animal body neutralization test, and immune animal is BALB/c mouse（It is easy to get experimental article Co., Ltd purchased from Tianjin Austria, 5 Week old, 20 ± 2g）, hypodermic injection, injection dosage is 5 μ g/20g, detection antibody potency after 4 weeks, and its protection antibody titer is more than 1：150, challenge test result shows this dosage（5μg/20g）Vaccine can produce neutralizing antibody and have the obvious effect resisting virus Really.

Embodiment described above is only the preferred embodiment lifted for absolutely proving the present invention, the protection model of the present invention Enclose not limited to this.Equivalent substitute or conversion that those skilled in the art are made on the basis of the present invention, all in the present invention Protection domain within.Protection scope of the present invention is defined by claims.

SEQUENCE LISTING

<110>Te Fei（Tianjin）Biological medicine Science and Technology Ltd.

<120>The recombinant protein of the antigen of N containing SARS virus and the baculoviral showing N protein

<130> 131180-I-CP-TJYU

<160> 12

<170> PatentIn version 3.3

<210> 1

<211> 485

<212> PRT

<213>Artificial sequence

<400> 1

Met Val Gly Ala Ile Val Leu Tyr Val Leu Leu Ala Ala Ala His Ser

1 5 10 15

Ala Phe Ala Ala Met Ser Asp Asn Gly Pro Gln Ser Asn Gln Arg Ser

20 25 30

Ala Pro Arg Ile Thr Phe Gly Gly Pro Thr Asp Ser Thr Asp Asn Asn

35 40 45

Gln Asn Gly Gly Arg Asn Gly Ala Arg Pro Lys Gln Arg Arg Pro Gln

50 55 60

Gly Leu Pro Asn Asn Thr Ala Ser Trp Phe Thr Ala Leu Thr Gln His

65 70 75 80

Gly Lys Glu Glu Leu Arg Phe Pro Arg Gly Gln Gly Val Pro Ile Asn

85 90 95

Thr Asn Ser Gly Pro Asp Asp Gln Ile Gly Tyr Tyr Arg Arg Ala Thr

100 105 110

Arg Arg Val Arg Gly Gly Asp Gly Lys Met Lys Glu Leu Ser Pro Arg

115 120 125

Trp Tyr Phe Tyr Tyr Leu Gly Thr Gly Pro Glu Ala Ser Leu Pro Tyr

130 135 140

Gly Ala Asn Lys Glu Gly Ile Val Trp Val Ala Thr Glu Gly Ala Leu

145 150 155 160

Asn Thr Pro Lys Asp His Ile Gly Thr Arg Asn Pro Asn Asn Asn Ala

165 170 175

Ala Thr Val Leu Gln Leu Pro Gln Gly Thr Thr Leu Pro Lys Gly Phe

180 185 190

Tyr Ala Glu Gly Ser Arg Gly Gly Ser Gln Ala Ser Ser Arg Ser Ser

195 200 205

Ser Arg Ser Arg Gly Asn Ser Arg Asn Ser Thr Pro Gly Ser Ser Arg

210 215 220

Gly Asn Ser Pro Ala Arg Met Ala Ser Gly Gly Gly Glu Thr Ala Leu

225 230 235 240

Ala Leu Leu Leu Leu Asp Arg Leu Asn Gln Leu Glu Ser Lys Val Ser

245 250 255

Gly Lys Gly Gln Gln Gln Gln Gly Gln Thr Val Thr Lys Lys Ser Ala

260 265 270

Ala Glu Ala Ser Lys Lys Pro Arg Gln Lys Arg Thr Ala Thr Lys Gln

275 280 285

Tyr Asn Val Thr Gln Ala Phe Gly Arg Arg Gly Pro Glu Gln Thr Gln

290 295 300

Gly Asn Phe Gly Asp Gln Asp Leu Ile Arg Gln Gly Thr Asp Tyr Lys

305 310 315 320

His Trp Pro Gln Ile Ala Gln Phe Ala Pro Ser Ala Ser Ala Phe Phe

325 330 335

Gly Met Ser Arg Ile Gly Met Glu Val Thr Pro Ser Gly Thr Trp Leu

340 345 350

Thr Tyr His Gly Ala Ile Lys Leu Asp Asp Lys Asp Pro Gln Phe Lys

355 360 365

Asp Asn Val Ile Leu Leu Asn Lys His Ile Asp Ala Tyr Lys Thr Phe

370 375 380

Pro Pro Thr Glu Pro Lys Lys Asp Lys Lys Lys Lys Thr Asp Glu Ala

385 390 395 400

Gln Pro Leu Pro Gln Arg Gln Lys Lys Gln Pro Thr Val Thr Leu Leu

405 410 415

Pro Ala Ala Asp Met Asp Asp Phe Ser Arg Gln Leu Gln Asn Ser Met

420 425 430

Ser Gly Ala Ser Ala Asp Ser Thr Gln Ala Met Ala Glu Gly Glu Leu

435 440 445

Ala Ala Lys Leu Thr Ser Phe Met Phe Gly His Val Ala Thr Phe Val

450 455 460

Ile Val Phe Ile Val Ile Leu Phe Leu Tyr Cys Met Val Arg Asn Arg

465 470 475 480

Asn Ser Arg Gln Tyr

485

<210> 2

<211> 1458

<212> DNA

<213>Artificial sequence

<400> 2

atggtaggcg ctattgtttt atacgtgctt ttggcggcgg cgcattctgc ctttgcggcg 60

atgtctgata atggacccca atcaaaccaa cgtagtgccc cccgcattac atttggtgga 120

cccacagatt caactgacaa taaccagaat ggaggacgca atggggcaag gccaaaacag 180

cgccgacccc aaggtttacc caataatact gcgtcttggt tcacagctct cactcagcat 240

ggcaaggagg aacttagatt ccctcgaggc cagggcgttc caatcaacac caatagtggt 300

ccagatgacc aaattggcta ctaccgaaga gctacccgac gagttcgtgg tggtgacggc 360

aaaatgaaag agctcagccc cagatggtac ttctattacc taggaactgg cccagaagct 420

tcacttccct acggcgctaa caaagaaggc atcgtatggg ttgcaactga gggagccttg 480

aatacaccca aagaccacat tggcacccgc aatcctaata acaatgctgc caccgtgcta 540

caacttcctc aaggaacaac attgccaaaa ggcttctacg cagagggaag cagaggcggc 600

agtcaagcct cttctcgctc ctcatcacgt agtcgcggta attcaagaaa ttcaactcct 660

ggcagcagta ggggaaattc tcctgctcga atggctagcg gaggtggtga aactgccctc 720

gcgctattgc tgctagacag attgaaccag cttgagagca aagtttctgg taaaggccaa 780

caacaacaag gccaaactgt cactaagaaa tctgctgctg aggcatctaa aaagcctcgc 840

caaaaacgta ctgccacaaa acagtacaac gtcactcaag catttgggag acgtggtcca 900

gaacaaaccc aaggaaattt cggggaccaa gacctaatca gacaaggaac tgattacaaa 960

cattggccgc aaattgcaca atttgctcca agtgcctctg cattctttgg aatgtcacgc 1020

attggcatgg aagtcacacc ttcgggaaca tggctgactt atcatggagc cattaaattg 1080

gatgacaaag atccacaatt caaagacaac gtcatactgc tgaacaagca cattgacgca 1140

tacaaaacat tcccaccaac agagcctaaa aaggacaaaa agaaaaagac tgatgaagct 1200

cagcctttgc cgcagagaca aaagaagcag cccactgtga ctcttcttcc tgcggctgac 1260

atggatgatt tctccagaca acttcaaaat tccatgagtg gagcttctgc tgattcaact 1320

caggcaatgg ctgaaggcga attggccgcc aaattgactt cgttcatgtt tggtcatgta 1380

gccacttttg taattgtatt tattgtaatt ttatttttgt actgtatggt tagaaaccgt 1440

aatagtagac aatattaa 1458

<210> 3

<211> 18

<212> DNA

<213>Artificial sequence

<400> 3

tgtaaaacga cggccagt 18

<210> 4

<211> 25

<212> DNA

<213>Artificial sequence

<400> 4

acacccggga tggtaggcgc tattg 25

<210> 5

<211> 20

<212> DNA

<213>Artificial sequence

<400> 5

tatcagacat cgccgcaaag 20

<210> 6

<211> 26

<212> DNA

<213>Artificial sequence

<400> 6

ctttgcggcg atgtctgata atggac 26

<210> 7

<211> 22

<212> DNA

<213>Artificial sequence

<400> 7

cttcagccat tgcctgagtt ga 22

<210> 8

<211> 22

<212> DNA

<213>Artificial sequence

<400> 8

aactcaggca atggctgaag gc 22

<210> 9

<211> 31

<212> DNA

<213>Artificial sequence

<400> 9

gccggtacct taatattgtc tactattacg g 31

<210> 10

<211> 8

<212> PRT

<213>Artificial sequence

<400> 10

Phe Tyr Tyr Leu Gly Thr Gly Pro

1 5

<210> 11

<211> 1593

<212> DNA

<213>Artificial sequence

<400> 11

atgctactag taaatcagtc ataccaaggc ttcgataaga aacacacaag cgagatggta 60

ggcgctattg ttttatacgt gcttttggcg gcggcgcatt ctgcctttgc ggcggagcac 120

tgcaacgcgc aaatgaaaac gggtccgtac aaaattaaaa acttggacat taccccgccc 180

aaggaaacgc tgcaaaagga cgtggaaatc accatcgtgg agacggacta caacgaaaac 240

gtgattattg gctacaaggg gtactaccag gcgtatgcgt acaacggagg ctcgctggat 300

cccaacacac gcgtcgaaga atccatgaaa acgctgactg tgggcaaaga agatttgctc 360

atgtggggta tcaggcagca gtgcgaggtg ggcgaagagt taatcgaccg ttggggcagt 420

gacagcgaag agtgttttcg cgacaacgaa ggccgcggcc agtgggtcaa aggcaaagag 480

ttggtgaaac ggcagaataa caatcacttt gcgtaccaca cgtgcaacaa atcgtggcga 540

tgcggcgttt ctacttcgaa aatgtacagc aggctcgagt gccacgacga caccgacgag 600

tgtcaggtat acattttgga cgctgagggc aaccccatta acgtgaccgt ggacactgcg 660

cttcatcgag acggcgtgag tatgattctc aaacaaaagt ctacgttcac cacgcgccaa 720

gtaaaagctg cgtgtctgct cattaaagat gacaaaaata accccgaatc ggtgacacgc 780

gaacactgtt tgatcgacaa tgatatatat gatctttcta aaaacacgtg gaattgcagg 840

tttaacagat gcattaaacg taaagtcgag caccaagtca agaaacggcc acccacttgg 900

cgccacaacg ttagagccaa gtacacagaa ggagacactg ccaccaaagg cgacctgatg 960

catattcaag aggagctgat gtacgaaaac gatttgctga aaatgaacat tgagctgatg 1020

catgcgcata tcaacaagat aaacaatatg ctgcacgacc tgatagtttc cgtggccaag 1080

gtggacgagc gtttgattgg caatctcatg aacaattctg tttcttcaac atttttgtcg 1140

gacgacacgt ttttgctgat gccgtgcacc aatccgccgg cacacaccag taattgctac 1200

aacaacagca tttacaaaga agggcgttgg gtggccaaca cggactcgtc gcaatgcata 1260

gattttagca actacaagga actagcaatc gacgacgacg tcgaattttg gattccgacc 1320

atcggcaaca caacctatca cgacagttgg aaagatgcca gcggttggtc gtttattgcc 1380

caacaaaaaa gcaatctcat aaccaccatg gagaacacca agtttggcgg cgtcggcacc 1440

agtctgaacg acatcacttc catggctgaa ggcgaattgg ccgccaaatt gacttcgttc 1500

atgtttggtc atgtagccac ttttgtaatt gtatttattg taattttatt tttgtactgt 1560

atggttagaa accgtaatag tagacaatat taa 1593

<210> 12

<211> 1269

<212> DNA

<213>Artificial sequence

<400> 12

atgtctgata atggacccca atcaaaccaa cgtagtgccc cccgcattac atttggtgga 60

cccacagatt caactgacaa taaccagaat ggaggacgca atggggcaag gccaaaacag 120

cgccgacccc aaggtttacc caataatact gcgtcttggt tcacagctct cactcagcat 180

ggcaaggagg aacttagatt ccctcgaggc cagggcgttc caatcaacac caatagtggt 240

ccagatgacc aaattggcta ctaccgaaga gctacccgac gagttcgtgg tggtgacggc 300

aaaatgaaag agctcagccc cagatggtac ttctattacc taggaactgg cccagaagct 360

tcacttccct acggcgctaa caaagaaggc atcgtatggg ttgcaactga gggagccttg 420

aatacaccca aagaccacat tggcacccgc aatcctaata acaatgctgc caccgtgcta 480

caacttcctc aaggaacaac attgccaaaa ggcttctacg cagagggaag cagaggcggc 540

agtcaagcct cttctcgctc ctcatcacgt agtcgcggta attcaagaaa ttcaactcct 600

ggcagcagta ggggaaattc tcctgctcga atggctagcg gaggtggtga aactgccctc 660

gcgctattgc tgctagacag attgaaccag cttgagagca aagtttctgg taaaggccaa 720

caacaacaag gccaaactgt cactaagaaa tctgctgctg aggcatctaa aaagcctcgc 780

caaaaacgta ctgccacaaa acagtacaac gtcactcaag catttgggag acgtggtcca 840

gaacaaaccc aaggaaattt cggggaccaa gacctaatca gacaaggaac tgattacaaa 900

cattggccgc aaattgcaca atttgctcca agtgcctctg cattctttgg aatgtcacgc 960

attggcatgg aagtcacacc ttcgggaaca tggctgactt atcatggagc cattaaattg 1020

gatgacaaag atccacaatt caaagacaac gtcatactgc tgaacaagca cattgacgca 1080

tacaaaacat tcccaccaac agagcctaaa aaggacaaaa agaaaaagac tgatgaagct 1140

cagcctttgc cgcagagaca aaagaagcag cccactgtga ctcttcttcc tgcggctgac 1200

atggatgatt tctccagaca acttcaaaat tccatgagtg gagcttctgc tgattcaact 1260

caggcataa 1269

Claims

1. a kind of recombinant protein SP-N-TM of the antigen of N containing SARS virus is it is characterised in that this albumen is by the N egg of SARS virus White N- end connects the signal peptide SP of shaft-like viral envelope proteins GP64, and C- end connects the cross-film of shaft-like viral envelope proteins GP64 Domain TM is constituted；The amino acid sequence of described recombinant protein SP-N-TM such as SEQ ID NO:Shown in 1.

2. the encoding gene of the recombinant protein SP-N-TM of the antigen of N containing SARS virus described in claim 1 is it is characterised in that core Nucleotide sequence such as SEQ ID NO:Shown in 2.

3. a kind of recombinant baculovirus of surface display SARS antigen N protein are it is characterised in that this virus is by claim 2 The encoding gene of described recombinant protein SP-N-TM is inserted into donor plasmid the genome by swivel base and shuttle vector Bacmid Carry out homologous recombination, obtain recombinant baculovirus genomic DNA, then will be thin for recombinant baculovirus genomic DNA transfection silkworm Born of the same parents, in the intracellular recombinant baculovirus being packaged to be described surface display SARS antigen N protein of silkworm.

4. the recombinant baculovirus of surface display SARS antigen N protein according to claim 3 are it is characterised in that described Donor plasmid is pFastBacDual, and the encoding gene of recombinant protein SP-N-TM is inserted into donor plasmid pFastBacDual's Under p10 promoter, after being built into restructuring swivel base plasmid, carry out homologous recombination with the genome of shuttle vector Bacmid again.

5. the recombinant baculovirus of surface display SARS antigen N protein according to claim 4 are it is characterised in that described Bombyx mori cell is Bombyx noriN cell.

6. the preparation method of the arbitrary described recombinant baculovirus of surface display SARS antigen N protein of claim 3 ~ 5, it is special Levy and be, step is as follows：

（1）PCR amplification obtains the encoding gene of baculoviral envelope protein GP64 signal peptide SP, the volume of the N protein of SARS virus The encoding gene of the membrane-spanning domain TM of code gene and baculoviral envelope protein GP64；

（2）Step is spliced by the method that over-lap PCR expands（1）The three kinds of gene orders obtaining, obtain recombinant protein SP-N-TM Encoding gene, then encoding gene segment is connected under the p10 promoter of carrier pFastBacDual, is built into restructuring swivel base Plasmid；

（3）The Escherichia coli DH10Bac competent cell containing baculovirus shuttle vector Bacmid for the restructuring swivel base plasmid conversion, enters Row homologous recombination, carries out blue hickie on containing kanamycins, gentamicin, tetracycline, the LB culture plate of X-gal and IPTG Screening, lucifuge cultivates picking hickie after 40 ~ 48h, and after hickie continues culture 24 ~ 48h, extracting recombinant baculovirus genomic DNA enters Performing PCR is identified；

（4）Take step（3）Identify that correct recombinant baculovirus genomic DNA transfects bombyx mori cell by liposome mediated-method, Obtain generation viral suspension after morbidity, extract viral genome and enter performing PCR identification again, identification is correctly surface display The recombinant baculovirus of SARS antigen N protein；

7. the preparation method of the recombinant baculovirus of surface display SARS antigen N protein according to claim 6, its feature It is, step（1）The primer nucleotide sequences that the encoding gene of middle amplification baculoviral envelope protein GP64 signal peptide SP uses As SEQ ID NO:Shown in 4 ~ 5；The primer nucleotide sequences such as SEQ ID that the encoding gene of amplification SARS Nucleocapsid uses NO:Shown in 6 ~ 7；The primer nucleotide sequences that the encoding gene of the membrane-spanning domain TM of amplification baculoviral envelope protein GP64 uses are such as SEQ ID NO:Shown in 8 ~ 9.

8. the recombinant baculovirus of the arbitrary described surface display SARS antigen N protein of claim 3 ~ 5 are in preparation SARS vaccine In application.