CN104292338A

CN104292338A - Recombinant protein containing SARS virus N antigen and baculovirus displaying N protein

Info

Publication number: CN104292338A
Application number: CN201310301846.4A
Authority: CN
Inventors: 张耀洲; 闫晶晶; 舒特俊; 陈剑清; 盖其静
Original assignee: TEFEI (TIANJIN) BIOLOGICAL MEDICAL TECHNOLOGY Co Ltd
Current assignee: TEFEI (TIANJIN) BIOLOGICAL MEDICAL TECHNOLOGY Co Ltd
Priority date: 2013-07-18
Filing date: 2013-07-18
Publication date: 2015-01-21
Anticipated expiration: 2033-07-18
Also published as: CN104292338B

Abstract

The invention discloses a recombinant protein containing an SARS virus N antigen and a baculovirus displaying an N protein. The recombinant protein SP-N-TM is formed by connecting an N- end of the N protein of an SARS virus with a signal peptide SP of a baculovirus envelope protein GP64, and connecting a C- end with a transmembrane domain TM of the baculovirus envelope protein GP64. The recombinant baculovirus having the surface displaying the SARS antigen N protein is the recombinant baculovirus obtained by the steps of inserting a cording gene of the SP-N-TM into a donor plasmid, carrying out homologous recombination with a genome of a shuttle vector Bacmid through transposition to obtain a recombinant baculovirus genome, then transfecting a bombyx mori cell with the recombinant baculovirus genome, and packaging in the cell to obtain the recombinant baculovirus. The recombinant baculovirus allows an N protein gene of the SARS virus to be fused with a bombyx mori baculovirus envelope protein GP64 gene, realizes display of the N protein on the surface of a viral capsid, and has good immunogenicity and large application value.

Description

Containing the recombinant protein of SARS virus N antigen and the baculovirus of displaying N protein

Technical field

The present invention relates to biomedicine technical field, be specifically related to a kind of recombinant protein containing SARS virus N antigen, and show the recombinant baculovirus of N protein.

Background technology

Severe acute respiratory syndrome (Severe Acute Respiratory Syndromes), also known as severe acute respiratory syndrome, is called for short SARS, is a kind of because infecting the new respiratory system communicable disease that sars coronavirus causes.Mainly through closely air droplet transmission, to generate heat, to have a headache, the few phlegm of sore muscle, weak, dry cough etc. for main clinical manifestation, can respiratory distress be there is in severe patient.This disease has stronger infectivity, has significant clustering phenomena in family and hospital.The first case, is also that the whole world is the first, appears at Foshan, and form epidemic status rapidly in November, 2002.5, on Augusts of in November, 2002 to 2003,29 national report clinically diagnosed cases totally 8422 examples, dead 916 examples.The average mortality of reported cases is 9.3%.This virus probably derives from animal, crosses over germline barrier and is transmitted to the mankind, and achieve interpersonal propagation due to the change of external environment and the adaptive increase of virus.

Although SARS is controlled, SARS virus is unlikely in a short time by " elimination " or automatically disappear, and the possibility that SARS again occurs in crowd is very large.Again there is the time of SARS epidemic situation, main relevant with the time of virus attack human body, not necessarily show as Winter-Spring occurred frequently.The time that animal takes viruliferous Seasonal Distribution, epidemic situation is all occurred again by the chance etc. of people's contact infection animal for impact.Animal remains may originating of virus, and crowd is to SARS virus still general susceptible, and its vaccine is still current research emphasis.

Current SARS vaccine comprises therapeutic vaccine, inactivated vaccine, DNA vaccination, polyepitope vaccines etc., existing certain progress, but also there is corresponding problem, specifically sees the following form.

Table 1

	Advantage	Shortcoming
			Therapeutic vaccine	Host is not needed to identify the Fc section of antibody	Need antibody humanization
Inactivated virus vaccine	Time is short; Cheap; Technology is easier; Vaccine is relatively stable; Do not need refrigeration; Be easy to transport	Production safety condition is high; There is safety issue; Need multiple injection; Immunne response low effort
			Nucleic acid vaccine (gene vaccine or DNA vaccination)	Preparation is simple; Easily a large amount of production; Security is good, can simultaneously elicit humoral immune and cellullar immunologic response; Can continuous expression in vivo	Continuous expression external source may produce some adverse consequencess; Affecting nucleic acid vaccine, to bring out the uncertain factor of immune response a lot
Polyepitope vaccines	Can combine with dissimilar MHC molecule, realize efficiently offering, and very strong cellular immunization can be induced	Lack understanding in depth SARS-CoV Protein Epitopes, particularly conformational epitope; The polypeptide of synthesis only can cover the linear epitope of minority, can not induce and produce high-caliber humoral immunoresponse(HI)

Urgently study a kind of new SARS vaccine and overcome the problems referred to above.

Summary of the invention

In order to overcome the above-mentioned defect of prior art vaccine, the invention provides a kind of recombinant protein SP-N-TM containing SARS virus N antigen, utilizing this recombinant protein to build the recombinant baculovirus of surface display SARS antigen N protein, there is good immunogenicity.

Should containing the recombinant protein SP-N-TM of SARS virus N antigen, be hold by the N-of the N protein of SARS virus the signal peptide SP connecting shaft-like viral envelope proteins GP64, the membrane-spanning domain TM that C-end connects shaft-like viral envelope proteins GP64 is formed.

Preferably, the above-mentioned recombinant protein SP-N-TM containing SARS virus N antigen, its aminoacid sequence is as shown in SEQ ID NO:1.

Present invention also offers the encoding gene of the above-mentioned recombinant protein SP-N-TM containing SARS virus N antigen, its nucleotide sequence is as shown in SEQ ID NO:2.

Present invention also offers a kind of recombinant baculovirus of surface display SARS antigen N protein, be inserted into donor plasmid by the encoding gene of above-mentioned recombinant protein SP-N-TM and carry out homologous recombination by the genome of swivel base and shuttle vectors Bacmid, obtain recombinant baculovirus genomic dna, then by recombinant baculovirus genomic dna transfection bombyx mori cell, the recombinant baculovirus of described surface display SARS antigen N protein is obtained in bombyx mori cell internal packing.

Shuttle vectors Bacmid(and Baculovirus plasmid) be plasmid with Baculovirus Gene group, can shuttle back and forth between bacterium and insect cell, one of member of Bac-to-bac baculovirus expression system, this system also comprises donor plasmid and helper plasmid and intestinal bacteria, is prior art.

Preferably, the recombinant baculovirus of above-mentioned surface display SARS antigen N protein, described donor plasmid is pFastBacDual, under the encoding gene of recombinant protein SP-N-TM is inserted into the p10 promotor of donor plasmid pFastBacDual, after being built into restructuring swivel base plasmid, carry out homologous recombination with the genome of shuttle vectors Bacmid again.

Wherein, carrier pFastBacDual is the donor plasmid of Bac-to-bac expression system, can insert foreign gene and under the transposase effect of helper plasmid coding, is inserted in Bacmid by foreign gene.Carrier pFastBacDual commercialization.

Preferably, the recombinant baculovirus of above-mentioned surface display SARS antigen N protein, described bombyx mori cell is Bombyx noriN cell.

Present invention also offers the preparation method of the recombinant baculovirus of above-mentioned surface display SARS antigen N protein, step is as follows:

(1) pcr amplification obtains the encoding gene of baculovirus envelope protein GP64 signal peptide SP, the encoding gene of N protein of SARS virus and the encoding gene of the membrane-spanning domain TM of baculovirus envelope protein GP64;

(2) three kinds of gene orders that method splicing step (1) increased by over-lap PCR is obtained, obtain the encoding gene of recombinant protein SP-N-TM, under again encoding gene segment being connected to the p10 promotor of carrier pFastBacDual, be built into restructuring swivel base plasmid;

(3) swivel base Plastid transformation of recombinating contains the intestinal bacteria DH10Bac competent cell of baculovirus shuttle vector Bacmid, carry out homologous recombination, LB culture plate containing kantlex, gentamicin, tsiklomitsin, X-gal and IPTG carries out blue hickie screening, picking hickie after lucifuge cultivation 40 ~ 48h, after hickie continues cultivation 24 ~ 48h, extracting recombinant baculovirus genomic dna carries out PCR qualification;

(4) get step (3) and identify that correct recombinant baculovirus genomic dna is by liposome mediated-method transfection bombyx mori cell, generation viral suspension is obtained after morbidity, extract viral genome and again carry out PCR qualification, identify the correct recombinant baculovirus being surface display SARS antigen N protein;

Described PCR qualification uses the primer sequence as shown in SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:9.

Preferably, the preparation method of the recombinant baculovirus of above-mentioned surface display SARS antigen N protein, the primer nucleotide sequences that in step (1), the encoding gene of amplification baculovirus envelope protein GP64 signal peptide SP uses is as shown in SEQ ID NO:4 ~ 5; The primer nucleotide sequences of the encoding gene use of amplification SARS Nucleocapsid is as shown in SEQ ID NO:6 ~ 7; The primer nucleotide sequences of the encoding gene use of the membrane-spanning domain TM of amplification baculovirus envelope protein GP64 is as shown in SEQ ID NO:8 ~ 9.

Present invention also offers the application of recombinant baculovirus in preparation SARS vaccine of above-mentioned surface display SARS antigen N protein.

Compared with prior art, the present invention has following beneficial effect:

By analyzing the genome structure of SARS virus, finding that N protein is containing 422 amino acid, is present in the core of virion with the form be combined with RNA, participating in the Transcription and replication of virus, than other albumen as S, M etc. are conservative.There is the sequence FYYLGTGP(SEQ ID NO:10 of a high conservative in the N-terminal of N protein), this sequence all has existence in every other coronavirus N protein.Therefore successfully N gene vaccine can induce generation strong, wide spectrum, the T cell immunne response of lasting neutralizing antibody and protectiveness.

Silkworm baculovirus envelope protein GP64 contains Liang Ge very hydrophobic district: the secretion signal peptide (SP) of N-end and the membrane spaning domain (TM) of C-end, what be connected with membrane spaning domain is hydrophilic domain, the glycoprotein in virus envelope and host cell membrane can be linked together.The present invention, by the N protein gene of SARS virus and silkworm baculovirus envelope protein GP64 gene fusion, realizes the surface display of object N protein on viral capsid.

The recombinant baculovirus of the surface display SARS antigen N protein that the present invention builds, Bombyx noriN cell can be utilized as bio-reactor, be there is by baculovirus expression vector system high expression the N protein of the SARS virus of high clinical value, it can prepare vaccine, also can prepare vaccine by direct recombinant virus, be applicable to scale operation, can reduce costs, improve output, the SARS vaccine using value of producing is large.

SARS vaccine there is no and utilizes baculovirus surface display technologies to produce, and baculovirus expression vector system is eukaryotic expression, has posttranslational modification function.The immunogenicity of N protein is relevant with its correct configuration, utilizes eukaryotic expression can possess good immunogenicity.

Accompanying drawing explanation

Fig. 1: the structural representation of carrier pFastBacDual.

Fig. 2: the restructuring swivel base plasmid pFstBacDual-gp64-N containing gp64-N builds schematic diagram, wherein p10: polyhedron promoter; The signal peptide sequence of SP:gp64 gene; N protein: Nucleocapsid protein(nucleocapsid protein); The transmembrane domain of TM:gp64 gene; sma , kpn : restriction enzyme site.

Fig. 3: SP-N-TM gene PCR amplified production, wherein M:10kb DNA molecular amount standard, 1:SP-N-TM gene PCR amplified production, sequence for the purpose of arrow locations, 1458bp.

Fig. 4: the PCR of restructuring swivel base plasmid pFastBacDual-gp64-N identifies electrophorogram, wherein M:10kb DNA molecular amount standard, 1:SP-N-TM goal gene, 2:pFastBacDual-gp64-N double digestion product.

The PCR primer electroresis appraisal result of Fig. 5: recombinant baculovirus genome Bacmid-gp64-N, wherein, M:10kb DNA molecular amount standard, 1: blank, 2:Psp-F and Ptm-R is the 1458bp fragment of primer amplification, 3:Psp-F and M13F is the 4107bp fragment of primer amplification.

The PCR primer electroresis appraisal result of Fig. 6: recombinant baculovirus Bmp64-N, wherein, M:10kb DNA molecular amount standard, 1: blank, 2: negative control, 3:Psp-F and Ptm-R is the 1458bp fragment of primer amplification, 4:Psp-F and M13F is the 4107bp fragment of primer amplification.

The N protein Western Blot detected result (the anti-detection of N protein rabbit) of Fig. 7: recombinant baculovirus Bmp64-N, M: Protein Marker, 1: prokaryotic expression N protein, 2: negative control supernatant, 3: negative control precipitates, 4:Bmgp64-N supernatant, 5:Bmgp64-N precipitates.

The N protein function Western Blot detected result (N protein mouse-anti is as probe) of Fig. 8: recombinant baculovirus Bmp64-N, M: Protein Marker, 1: prokaryotic expression N protein, 2:Bmgp64-N.

Embodiment

Below in conjunction with specific embodiment, the invention will be further described, and to make those skilled in the art the present invention may be better understood and can be implemented, but illustrated embodiment is not as a limitation of the invention.

The present invention obtains the coding gene sequence of SARS major antigen N protein by pcr amplification, the encoding gene of the encoding gene of amplification baculovirus envelope protein GP64 signal peptide SP and the membrane-spanning domain TM of baculovirus envelope protein GP64 simultaneously, pass through over-lap PCR, obtain SP-N-TM recombination fragment, and under being inserted into the p10 promotor of insect cell expression vector pFastBacDual, obtain restructuring swivel base plasmid (called after pFastBacDual-gp64-N), restructuring swivel base Plastid transformation is containing the intestinal bacteria DH10Bac competent cell of baculovirus shuttle vector Bacmid, carry out homologous recombination, obtain recombinant baculovirus genomic dna (recombinant plasmid called after Bacmid-gp64-N), passed through liposome transfection Bombyx noriN cell, in cell, assembling forms the recombinant baculovirus (called after Bmgp64-N) of surface display SARS antigen N protein, and copy amplification, Bombyx noriN cell is inoculated with third generation Bmgp64-N, virus liquid is collected after 3 ~ 5 days, centrifugal, separation and purification, make SARS vaccine.Elaborate particular content of the present invention below.

Embodiment 1 is recombinated the structure of swivel base plasmid pFastBacDual-gp64-N

1. the acquisition of gp64-N sequence

With silkworm baculovirus gp64 sequence (SEQ ID NO:11) for template, pcr amplification is carried out respectively with primer Psp-F, Psp-R and the Ptm-F shown in table 2, Ptm-R, obtain signal peptide (SP) sequence and cross-film district (TM) sequence of gp64, with the N protein gene order of SARS virus (SEQ ID NO:12) for template, Pn-F, Pn-R are primer, and pcr amplification obtains N protein gene order.PCR primer obtains SP gene order by over-lap PCR, the restructuring object fragment SP-N-TM that N gene order and TM gene order are connected successively, under restructuring object fragment is inserted into the p10 promotor of carrier pFastBacDual, build restructuring swivel base plasmid pFastBacDual-gp64-N, this polyhedron promoter is utilized to start the expression of N gene, fusion rotein N is held there is signal peptide (SP), C end has cross-film district (TM), because this promotor belongs to pole late gene promoter and for strong promoter, even if fusion rotein is to baculovirus and the virose albumen of host cell, owing to being formed with virus particle during this promotor startup track fusion, so fusion rotein also can obtain efficiently, express in large quantities.

Table 2 SP-N-TM aligning primer sequences Design

Psp-F	ACA CCCGGGATGGTAGGCGCTATTG（SEQ ID NO:4）
		Psp-R	TATCAGACATCGCCGCAAAG（SEQ ID NO:5）
Pn-F	CTTTGCGGCG ATGTCTGATAATGGAC（SEQ ID NO:6）
		Pn-R	CTTCAGCCAT TGCCTGAGTTGA（SEQ ID NO:7）
Ptm-F	AACTCAGGCAATGGCTGAAGGC（SEQ ID NO:8）
		Ptm-R	GCC GGTACCTTAATATTGTCTACTATTACGG（SEQ ID NO:9）

In table 2, underscore place is sma , Kpn restriction enzyme site.

(1) amplification of gp64 signal peptide (SP) gene

With silkworm baculovirus gp64 sequence (SEQ ID NO:11) for template, Psp-F and Psp-R is primer, carries out pcr amplification.The reaction system of PCR is 50 μ L, and concrete composition is: each 1 μ L of Psp-F and Psp-R of the dNTPs 5 μ L of 10 × PCR Buffer 5 μ L, 2.5 mmol/mL, 0.01nmol/ μ L, template 2 μ L, Taq archaeal dna polymerase 2 μ L, ddH ₂o 34 μ L.After each component mixing, put into PCR instrument, PCR reaction parameter: 95 DEG C of denaturation 5min, 95 DEG C of sex change 30s, 58 DEG C of annealing 30s, 72 DEG C extend 30s, 30 circulations, and 72 DEG C extend 5min.After question response terminates, electroresis appraisal amplified production segment, object segment size is 60bp, cuts glue simultaneously and reclaims object segment.

(2) amplification of gp64 membrane-spanning domain (TM)

With silkworm baculovirus gp64 sequence (SEQ ID NO:11) for template, Ptm-F and Ptm-R is primer, carries out pcr amplification.PCR reaction system 50 μ L, concrete component is: each 1 μ L of Ptm-F 1 μ L and Ptm-R of the dNTPs 5 μ L of 10 × PCR Buffer 5 μ L, 2.5 mmol/mL, 0.01nmol/ μ L, template 2 μ L, Taq archaeal dna polymerase 2 μ L, ddH ₂o 34 μ L.After each component mixing, put into PCR instrument, PCR reaction parameter: 95 DEG C of denaturation 5min, 95 DEG C of sex change 30s, 56 DEG C of annealing 30s, 72 DEG C extend 30s, 30 circulations, and 72 DEG C extend 5min.After question response terminates, electroresis appraisal amplified production segment, object segment size is 132bp, cuts glue simultaneously and reclaims object segment.

(3) the N gene amplification of SARS virus

With the N protein gene order of SARS virus (SEQ ID NO:12) for template, Pn-F and Pn-R is primer, carries out pcr amplification.PCR reaction system 50 μ L, concrete component is: each 1 μ L of Pn-F and Pn-R of the dNTPs 5 μ L of 10 × PCR Buffer 5 μ L, 2.5 mmol/mL, 0.01nmol/ μ L, template 2 μ L, Taq archaeal dna polymerase 2 μ L, ddH ₂o 34 μ L.After each component mixing, put into PCR instrument, PCR reaction parameter: 95 DEG C of denaturation 5min, 95 DEG C of sex change 30s, 53 DEG C of annealing 30s, 72 DEG C extend 30s, 30 circulations, and 72 DEG C extend 5min.After question response terminates, electroresis appraisal am-plified fragments, object segment size is that 1266bp(deletes terminator), cut glue simultaneously and reclaim object segment.

(4) acquisition of gp64-N

The SP gene order, N gene order and the TM gene order that obtain with step (1) to (3), for template, carry out pcr amplification simultaneously.Amplification system is 50 μ L, and composition is: the dNTPs 5 μ L of 10 × PCR Buffer 5 μ L, 2.5 mmol/mL, SP gene order 3 μ L, N gene order 3 μ L, TM gene order 3 μ L, Taq archaeal dna polymerase 2 μ L, ddH ₂o 29 μ L.After each component mixing, put into PCR instrument, PCR reaction parameter: 95 DEG C of denaturation 5min, 95 DEG C of sex change 40s, 50 DEG C of renaturation 40s, 72 DEG C extend 1min35s, 35 circulations, and 72 DEG C extend 10min.Design 35 circulations by above-mentioned reaction parameter, obtain overlapping object fragment SP-N-TM(called after gp64-N).After question response terminates, electroresis appraisal am-plified fragments, object segment size is that 1458bp(is see Fig. 3), cut glue simultaneously and reclaim object segment.

(5) amplification of gp64-N

With overlapping PCR products SP-N-TM for template, Psp-F and Ptm-R is primer, carries out pcr amplification.Amplification system is 50 μ L, and composition is: each 1 μ L of Psp-F and Ptm-R of the dNTPs 5 μ L of 10 × PCR Buffer 5 μ L, 2.5 mmol/mL, 0.01nmol/ μ L, template 2 μ L, Taq archaeal dna polymerase 2 μ L, ddH ₂o 34 μ L.After each component mixing, put into PCR instrument, PCR reaction parameter: 95 DEG C of denaturation 5min, 95 DEG C of sex change 45s, 50 DEG C of renaturation 45s, 72 DEG C extend 1min35s, 30 circulations, and 72 DEG C extend 10min.30 circulations are designed by above-mentioned reaction parameter.After question response terminates, electroresis appraisal am-plified fragments, cuts glue simultaneously and reclaims object segment.

2. the structure of restructuring swivel base plasmid pFstBacDual-gp64-N

Gp64-N(and SP-N-TM by above-mentioned pcr amplification obtains) sequence is respectively by restriction enzyme sma with kpn (purchased from Fermentas company) carries out double digestion, digestion products inserts simultaneously through the p10 promotor multicloning sites downstream upstream and downstream two ends of the pFastBacDual carrier (purchased from Invitrogen company) of double digestion, build the restructuring swivel base plasmid containing gp64-N sequence, called after pFstBacDual-gp64-N.After the restructuring swivel base plasmid built is correct by restriction analysis and two-way order-checking identified gene sequence, the success of restructuring swivel base plasmid construction.Fig. 4 is that the PCR of restructuring swivel base plasmid pFastBacDual-gp64-N identifies electrophorogram.

The acquisition of embodiment 2 silkworm with recombinant baculovirus Bmgp64-N

The swivel base plasmid pFastBacDual-gp64-N that qualification restructuring successfully recombinated transforms the intestinal bacteria DH10Bac competent cell (purchased from Invitrogen company) containing baculovirus shuttle vector Bacmid, containing kantlex, gentamicin, tsiklomitsin, the LB culture plate of X-gal and IPTG is (purchased from Shanghai Sheng Gong biotech firm, operate to specifications) upper cultivation, blue hickie screening is carried out after carrying out homologous recombination (the gp64-N sequence on pFastBacDual-gp64-N to be inserted into the multiple clone site of Bacmid by homology swivel base) by swivel base, picking hickie after lucifuge cultivation 48h, hickie continues containing tsiklomitsin, kantlex, gentamicin, shake in the LB nutrient solution of X-gal and IPTG after bacterium cultivates 48h and use Virahol extracting recombinant baculovirus genomic dna, use M13 universal primer, Psp-F and Ptm-R inserts situation by goal gene in pcr amplification qualification restructuring Bacmid, insert successful plasmid called after Bacmid-gp64-N(and recombinant baculovirus genome).Fig. 5 is the PCR qualification result of genome Bacmid-gp64-N.

Wherein, M13 universal primer sequence:

M13F：TGTAAAACGACGGCCAGT（SEQ ID NO:3）。

Identify that successful plasmid Bacmid-gp64-N is by liposome mediated-method transfection Bombyx noriN cell (purchased from Invitrogen company), transfection uses Invitrogen company lipofectamine Cellfectin II Reagent, transfection method with reference to this transfection reagent specification sheets, transfection concrete steps:

The plasmid Bacmid-gp64-N of 6 μ L and 8 μ L transfection reagents are added in the serum free medium of 76 μ L by evening before that day, incubated at room 20min, liposome is made fully to wrap up plasmid Bacmid-gp64-N, then joined in the well-grown Bombyx noriN cell of 1mL, insert incubator overnight incubation, serum free medium siphons away by the next morning, has changed blood serum medium into and has cultivated 5 ~ 7 days, treated that cell is fallen ill.

Cell morbidity rear (microscopic examination) obtains generation viral suspension 4 DEG C preservation, extract viral genome M13F, Psp-F, Ptm-R to identify, qualification result is shown in Fig. 6, wherein negative control is wild baculovirus, result shows virus formulation success, obtain the recombinant baculovirus of surface display SARS antigen N protein, called after Bmgp64-N.

Embodiment 3 N protein is in the expression of Bombyx noriN cell

By recombinant baculovirus Bmgp64-N with 3 × 10 ^-6the dosage infected silkworm BmN cell of pfu/cell carries out virus amplification, infect after 3 ~ 5 days, collect virus liquid, through separation and purification, get 10 μ L supernatant liquors and add isopyknic 2 × protein sample-loading buffer (100Mm Tris-HCl, 4%SDS, 0.15% tetrabromophenol sulfonphthalein, 10% glycerine), 100 DEG C of heating 10min, get the mixed solution after heating 10 μ L and carry out SDS-PAGE analysis, result shows, this silkworm with recombinant baculovirus expresses N protein, and protein sequencing result shows, and its aminoacid sequence is as shown in SEQ ID NO:1.

Embodiment 4 is separation and purification Bmgp64-N virus from Bombyx noriN cell

(1) the Bombyx noriN cell virus liquid that 200mL infects through Bmgp64-N is got;

(2) added by virus liquid in 50mL centrifuge tube, the centrifugal 30min of 8000rpm, gets supernatant, in triplicate to remove cell residue;

(3) pour the centrifuged supernatant that step (2) obtains into 50mL centrifuge tube, the centrifugal 60min of 15000rpm, gets supernatant, in triplicate;

(4) by the centrifuged supernatant that step (3) obtains, carry out ultrafiltration, constantly add sterilized water with the hollow-fibre membrane that molecular weight cut-off is 100KD, sterilized water volume used is about 10 times of sample, and whole ultra-filtration process all operates under 4 DEG C of environment, repeats 5 times;

(5) supernatant after the ultrafiltration of step (4) film bag, super clean bench is sub-packed in the ultra-filtration centrifuge tube of sterilizing, bubble in pipe is driven away with syringe, put into Hitachi CP70MX whizzer with the centrifugal 40min of rotating speed 50000rpm, gained black group ultrafiltrated (i.e. phosphoric acid buffer PBS) is resuspended, degerming with the membrane filtration of 0.22 μm, obtain the recombinant baculovirus of purifying.

The expression (the anti-detection of rabbit by N protein) of recombinant baculovirus N protein is detected by Western Blot, the results are shown in Figure 7, wherein swimming lane 1 is that the N protein of prokaryotic expression is as positive control, use by gene constructed for N protein on pET-28a, the protein product of expressing with e. coli bl21; Swimming lane 2 and 3 is negative control results, and negative control uses wild baculovirus; Swimming lane 4 and 5 is Bmgp64-N vial supernatant and the precipitation of purifying respectively.

Carry out Function Identification by Western Blot to the immunogen of recombinant baculovirus Bmgp64-N using N protein mouse-anti as probe, detected result is shown in Fig. 8.

The effect of embodiment 5 SARS vaccine

The recombinant baculovirus strain Bmgp64-N infected silkworm BmN clone that embodiment 2 obtains; go down to posterity after 3 times and gather in the crops virus; carry out animal body neutralization test; immune animal is that BALB/c mouse (to be easy to get experimental article company limited purchased from Tianjin Austria; 5 week age; 20 ± 2g); subcutaneous injection; injected dose is 5 μ g/20g; antibody titer is detected after 4 weeks; its protection antibody titer is greater than 1:150, and challenge test result shows this dosage (5 μ g/20g) vaccine and can produce neutralizing antibody and have obviously to antiviral effect.

The above embodiment is only that protection scope of the present invention is not limited thereto in order to absolutely prove the preferred embodiment that the present invention lifts.The equivalent alternative or conversion that those skilled in the art do on basis of the present invention, all within protection scope of the present invention.Protection scope of the present invention is as the criterion with claims.

SEQUENCE LISTING

<110> Tefei (Tianjin) Biomedicine and Technology Limited Company

The recombinant protein of <120> containing SARS virus N antigen and the baculovirus of displaying N protein

<130> 131180-I-CP-TJYU

<160> 12

<170> PatentIn version 3.3

<210> 1

<211> 485

<212> PRT

<213> artificial sequence

<400> 1

Met Val Gly Ala Ile Val Leu Tyr Val Leu Leu Ala Ala Ala His Ser

1 5 10 15

Ala Phe Ala Ala Met Ser Asp Asn Gly Pro Gln Ser Asn Gln Arg Ser

20 25 30

Ala Pro Arg Ile Thr Phe Gly Gly Pro Thr Asp Ser Thr Asp Asn Asn

35 40 45

Gln Asn Gly Gly Arg Asn Gly Ala Arg Pro Lys Gln Arg Arg Pro Gln

50 55 60

Gly Leu Pro Asn Asn Thr Ala Ser Trp Phe Thr Ala Leu Thr Gln His

65 70 75 80

Gly Lys Glu Glu Leu Arg Phe Pro Arg Gly Gln Gly Val Pro Ile Asn

85 90 95

Thr Asn Ser Gly Pro Asp Asp Gln Ile Gly Tyr Tyr Arg Arg Ala Thr

100 105 110

Arg Arg Val Arg Gly Gly Asp Gly Lys Met Lys Glu Leu Ser Pro Arg

115 120 125

Trp Tyr Phe Tyr Tyr Leu Gly Thr Gly Pro Glu Ala Ser Leu Pro Tyr

130 135 140

Gly Ala Asn Lys Glu Gly Ile Val Trp Val Ala Thr Glu Gly Ala Leu

145 150 155 160

Asn Thr Pro Lys Asp His Ile Gly Thr Arg Asn Pro Asn Asn Asn Ala

165 170 175

Ala Thr Val Leu Gln Leu Pro Gln Gly Thr Thr Leu Pro Lys Gly Phe

180 185 190

Tyr Ala Glu Gly Ser Arg Gly Gly Ser Gln Ala Ser Ser Arg Ser Ser

195 200 205

Ser Arg Ser Arg Gly Asn Ser Arg Asn Ser Thr Pro Gly Ser Ser Arg

210 215 220

Gly Asn Ser Pro Ala Arg Met Ala Ser Gly Gly Gly Glu Thr Ala Leu

225 230 235 240

Ala Leu Leu Leu Leu Asp Arg Leu Asn Gln Leu Glu Ser Lys Val Ser

245 250 255

Gly Lys Gly Gln Gln Gln Gln Gly Gln Thr Val Thr Lys Lys Ser Ala

260 265 270

Ala Glu Ala Ser Lys Lys Pro Arg Gln Lys Arg Thr Ala Thr Lys Gln

275 280 285

Tyr Asn Val Thr Gln Ala Phe Gly Arg Arg Gly Pro Glu Gln Thr Gln

290 295 300

Gly Asn Phe Gly Asp Gln Asp Leu Ile Arg Gln Gly Thr Asp Tyr Lys

305 310 315 320

His Trp Pro Gln Ile Ala Gln Phe Ala Pro Ser Ala Ser Ala Phe Phe

325 330 335

Gly Met Ser Arg Ile Gly Met Glu Val Thr Pro Ser Gly Thr Trp Leu

340 345 350

Thr Tyr His Gly Ala Ile Lys Leu Asp Asp Lys Asp Pro Gln Phe Lys

355 360 365

Asp Asn Val Ile Leu Leu Asn Lys His Ile Asp Ala Tyr Lys Thr Phe

370 375 380

Pro Pro Thr Glu Pro Lys Lys Asp Lys Lys Lys Lys Thr Asp Glu Ala

385 390 395 400

Gln Pro Leu Pro Gln Arg Gln Lys Lys Gln Pro Thr Val Thr Leu Leu

405 410 415

Pro Ala Ala Asp Met Asp Asp Phe Ser Arg Gln Leu Gln Asn Ser Met

420 425 430

Ser Gly Ala Ser Ala Asp Ser Thr Gln Ala Met Ala Glu Gly Glu Leu

435 440 445

Ala Ala Lys Leu Thr Ser Phe Met Phe Gly His Val Ala Thr Phe Val

450 455 460

Ile Val Phe Ile Val Ile Leu Phe Leu Tyr Cys Met Val Arg Asn Arg

465 470 475 480

Asn Ser Arg Gln Tyr

485

<210> 2

<211> 1458

<212> DNA

<213> artificial sequence

<400> 2

atggtaggcg ctattgtttt atacgtgctt ttggcggcgg cgcattctgc ctttgcggcg 60

atgtctgata atggacccca atcaaaccaa cgtagtgccc cccgcattac atttggtgga 120

cccacagatt caactgacaa taaccagaat ggaggacgca atggggcaag gccaaaacag 180

cgccgacccc aaggtttacc caataatact gcgtcttggt tcacagctct cactcagcat 240

ggcaaggagg aacttagatt ccctcgaggc cagggcgttc caatcaacac caatagtggt 300

ccagatgacc aaattggcta ctaccgaaga gctacccgac gagttcgtgg tggtgacggc 360

aaaatgaaag agctcagccc cagatggtac ttctattacc taggaactgg cccagaagct 420

tcacttccct acggcgctaa caaagaaggc atcgtatggg ttgcaactga gggagccttg 480

aatacaccca aagaccacat tggcacccgc aatcctaata acaatgctgc caccgtgcta 540

caacttcctc aaggaacaac attgccaaaa ggcttctacg cagagggaag cagaggcggc 600

agtcaagcct cttctcgctc ctcatcacgt agtcgcggta attcaagaaa ttcaactcct 660

ggcagcagta ggggaaattc tcctgctcga atggctagcg gaggtggtga aactgccctc 720

gcgctattgc tgctagacag attgaaccag cttgagagca aagtttctgg taaaggccaa 780

caacaacaag gccaaactgt cactaagaaa tctgctgctg aggcatctaa aaagcctcgc 840

caaaaacgta ctgccacaaa acagtacaac gtcactcaag catttgggag acgtggtcca 900

gaacaaaccc aaggaaattt cggggaccaa gacctaatca gacaaggaac tgattacaaa 960

cattggccgc aaattgcaca atttgctcca agtgcctctg cattctttgg aatgtcacgc 1020

attggcatgg aagtcacacc ttcgggaaca tggctgactt atcatggagc cattaaattg 1080

gatgacaaag atccacaatt caaagacaac gtcatactgc tgaacaagca cattgacgca 1140

tacaaaacat tcccaccaac agagcctaaa aaggacaaaa agaaaaagac tgatgaagct 1200

cagcctttgc cgcagagaca aaagaagcag cccactgtga ctcttcttcc tgcggctgac 1260

atggatgatt tctccagaca acttcaaaat tccatgagtg gagcttctgc tgattcaact 1320

caggcaatgg ctgaaggcga attggccgcc aaattgactt cgttcatgtt tggtcatgta 1380

gccacttttg taattgtatt tattgtaatt ttatttttgt actgtatggt tagaaaccgt 1440

aatagtagac aatattaa 1458

<210> 3

<211> 18

<212> DNA

<213> artificial sequence

<400> 3

tgtaaaacga cggccagt 18

<210> 4

<211> 25

<212> DNA

<213> artificial sequence

<400> 4

acacccggga tggtaggcgc tattg 25

<210> 5

<211> 20

<212> DNA

<213> artificial sequence

<400> 5

tatcagacat cgccgcaaag 20

<210> 6

<211> 26

<212> DNA

<213> artificial sequence

<400> 6

ctttgcggcg atgtctgata atggac 26

<210> 7

<211> 22

<212> DNA

<213> artificial sequence

<400> 7

cttcagccat tgcctgagtt ga 22

<210> 8

<211> 22

<212> DNA

<213> artificial sequence

<400> 8

aactcaggca atggctgaag gc 22

<210> 9

<211> 31

<212> DNA

<213> artificial sequence

<400> 9

gccggtacct taatattgtc tactattacg g 31

<210> 10

<211> 8

<212> PRT

<213> artificial sequence

<400> 10

Phe Tyr Tyr Leu Gly Thr Gly Pro

1 5

<210> 11

<211> 1593

<212> DNA

<213> artificial sequence

<400> 11

atgctactag taaatcagtc ataccaaggc ttcgataaga aacacacaag cgagatggta 60

ggcgctattg ttttatacgt gcttttggcg gcggcgcatt ctgcctttgc ggcggagcac 120

tgcaacgcgc aaatgaaaac gggtccgtac aaaattaaaa acttggacat taccccgccc 180

aaggaaacgc tgcaaaagga cgtggaaatc accatcgtgg agacggacta caacgaaaac 240

gtgattattg gctacaaggg gtactaccag gcgtatgcgt acaacggagg ctcgctggat 300

cccaacacac gcgtcgaaga atccatgaaa acgctgactg tgggcaaaga agatttgctc 360

atgtggggta tcaggcagca gtgcgaggtg ggcgaagagt taatcgaccg ttggggcagt 420

gacagcgaag agtgttttcg cgacaacgaa ggccgcggcc agtgggtcaa aggcaaagag 480

ttggtgaaac ggcagaataa caatcacttt gcgtaccaca cgtgcaacaa atcgtggcga 540

tgcggcgttt ctacttcgaa aatgtacagc aggctcgagt gccacgacga caccgacgag 600

tgtcaggtat acattttgga cgctgagggc aaccccatta acgtgaccgt ggacactgcg 660

cttcatcgag acggcgtgag tatgattctc aaacaaaagt ctacgttcac cacgcgccaa 720

gtaaaagctg cgtgtctgct cattaaagat gacaaaaata accccgaatc ggtgacacgc 780

gaacactgtt tgatcgacaa tgatatatat gatctttcta aaaacacgtg gaattgcagg 840

tttaacagat gcattaaacg taaagtcgag caccaagtca agaaacggcc acccacttgg 900

cgccacaacg ttagagccaa gtacacagaa ggagacactg ccaccaaagg cgacctgatg 960

catattcaag aggagctgat gtacgaaaac gatttgctga aaatgaacat tgagctgatg 1020

catgcgcata tcaacaagat aaacaatatg ctgcacgacc tgatagtttc cgtggccaag 1080

gtggacgagc gtttgattgg caatctcatg aacaattctg tttcttcaac atttttgtcg 1140

gacgacacgt ttttgctgat gccgtgcacc aatccgccgg cacacaccag taattgctac 1200

aacaacagca tttacaaaga agggcgttgg gtggccaaca cggactcgtc gcaatgcata 1260

gattttagca actacaagga actagcaatc gacgacgacg tcgaattttg gattccgacc 1320

atcggcaaca caacctatca cgacagttgg aaagatgcca gcggttggtc gtttattgcc 1380

caacaaaaaa gcaatctcat aaccaccatg gagaacacca agtttggcgg cgtcggcacc 1440

agtctgaacg acatcacttc catggctgaa ggcgaattgg ccgccaaatt gacttcgttc 1500

atgtttggtc atgtagccac ttttgtaatt gtatttattg taattttatt tttgtactgt 1560

atggttagaa accgtaatag tagacaatat taa 1593

<210> 12

<211> 1269

<212> DNA

<213> artificial sequence

<400> 12

atgtctgata atggacccca atcaaaccaa cgtagtgccc cccgcattac atttggtgga 60

cccacagatt caactgacaa taaccagaat ggaggacgca atggggcaag gccaaaacag 120

cgccgacccc aaggtttacc caataatact gcgtcttggt tcacagctct cactcagcat 180

ggcaaggagg aacttagatt ccctcgaggc cagggcgttc caatcaacac caatagtggt 240

ccagatgacc aaattggcta ctaccgaaga gctacccgac gagttcgtgg tggtgacggc 300

aaaatgaaag agctcagccc cagatggtac ttctattacc taggaactgg cccagaagct 360

tcacttccct acggcgctaa caaagaaggc atcgtatggg ttgcaactga gggagccttg 420

aatacaccca aagaccacat tggcacccgc aatcctaata acaatgctgc caccgtgcta 480

caacttcctc aaggaacaac attgccaaaa ggcttctacg cagagggaag cagaggcggc 540

agtcaagcct cttctcgctc ctcatcacgt agtcgcggta attcaagaaa ttcaactcct 600

ggcagcagta ggggaaattc tcctgctcga atggctagcg gaggtggtga aactgccctc 660

gcgctattgc tgctagacag attgaaccag cttgagagca aagtttctgg taaaggccaa 720

caacaacaag gccaaactgt cactaagaaa tctgctgctg aggcatctaa aaagcctcgc 780

caaaaacgta ctgccacaaa acagtacaac gtcactcaag catttgggag acgtggtcca 840

gaacaaaccc aaggaaattt cggggaccaa gacctaatca gacaaggaac tgattacaaa 900

cattggccgc aaattgcaca atttgctcca agtgcctctg cattctttgg aatgtcacgc 960

attggcatgg aagtcacacc ttcgggaaca tggctgactt atcatggagc cattaaattg 1020

gatgacaaag atccacaatt caaagacaac gtcatactgc tgaacaagca cattgacgca 1080

tacaaaacat tcccaccaac agagcctaaa aaggacaaaa agaaaaagac tgatgaagct 1140

cagcctttgc cgcagagaca aaagaagcag cccactgtga ctcttcttcc tgcggctgac 1200

atggatgatt tctccagaca acttcaaaat tccatgagtg gagcttctgc tgattcaact 1260

caggcataa 1269

Claims

1. the recombinant protein SP-N-TM containing SARS virus N antigen, it is characterized in that, this albumen holds by the N-of the N protein of SARS virus the signal peptide SP connecting shaft-like viral envelope proteins GP64, and the membrane-spanning domain TM that C-end connects shaft-like viral envelope proteins GP64 is formed.

2. the recombinant protein SP-N-TM containing SARS virus N antigen according to claim 1, it is characterized in that, aminoacid sequence is as shown in SEQ ID NO:1.

3. the encoding gene of the recombinant protein SP-N-TM containing SARS virus N antigen according to claim 2, it is characterized in that, nucleotide sequence is as shown in SEQ ID NO:2.

4. the recombinant baculovirus of a surface display SARS antigen N protein, it is characterized in that, this virus is inserted into donor plasmid by the encoding gene of recombinant protein SP-N-TM described in claim 3 and carries out homologous recombination by the genome of swivel base and shuttle vectors Bacmid, obtain recombinant baculovirus genomic dna, then by recombinant baculovirus genomic dna transfection bombyx mori cell, the recombinant baculovirus of described surface display SARS antigen N protein is obtained in bombyx mori cell internal packing.

5. the recombinant baculovirus of surface display SARS antigen N protein according to claim 4, it is characterized in that, described donor plasmid is pFastBacDual, under the encoding gene of recombinant protein SP-N-TM is inserted into the p10 promotor of donor plasmid pFastBacDual, after being built into restructuring swivel base plasmid, carry out homologous recombination with the genome of shuttle vectors Bacmid again.

6. the recombinant baculovirus of surface display SARS antigen N protein according to claim 5, it is characterized in that, described bombyx mori cell is Bombyx noriN cell.

7. the preparation method of the recombinant baculovirus of the arbitrary described surface display SARS antigen N protein of claim 4 ~ 6, it is characterized in that, step is as follows:

8. the preparation method of the recombinant baculovirus of surface display SARS antigen N protein according to claim 7, it is characterized in that, the primer nucleotide sequences that in step (1), the encoding gene of amplification baculovirus envelope protein GP64 signal peptide SP uses is as shown in SEQ ID NO:4 ~ 5; The primer nucleotide sequences of the encoding gene use of amplification SARS Nucleocapsid is as shown in SEQ ID NO:6 ~ 7; The primer nucleotide sequences of the encoding gene use of the membrane-spanning domain TM of amplification baculovirus envelope protein GP64 is as shown in SEQ ID NO:8 ~ 9.

9. the application of recombinant baculovirus in preparation SARS vaccine of the arbitrary described surface display SARS antigen N protein of claim 4 ~ 6.