CN110066827B - Recombinant baculovirus transfer vector containing porcine pseudorabies virus gB protein gene, recombinant baculovirus, preparation method and application - Google Patents

Recombinant baculovirus transfer vector containing porcine pseudorabies virus gB protein gene, recombinant baculovirus, preparation method and application Download PDF

Info

Publication number
CN110066827B
CN110066827B CN201910354221.1A CN201910354221A CN110066827B CN 110066827 B CN110066827 B CN 110066827B CN 201910354221 A CN201910354221 A CN 201910354221A CN 110066827 B CN110066827 B CN 110066827B
Authority
CN
China
Prior art keywords
ala
val
arg
gly
leu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201910354221.1A
Other languages
Chinese (zh)
Other versions
CN110066827A (en
Inventor
钱平
李祥敏
李江龙
陈焕春
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Huazhong Agricultural University
Original Assignee
Huazhong Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Huazhong Agricultural University filed Critical Huazhong Agricultural University
Priority to CN201910354221.1A priority Critical patent/CN110066827B/en
Publication of CN110066827A publication Critical patent/CN110066827A/en
Application granted granted Critical
Publication of CN110066827B publication Critical patent/CN110066827B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • A61P31/22—Antivirals for DNA viruses for herpes viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/14011—Baculoviridae
    • C12N2710/14021—Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/14011—Baculoviridae
    • C12N2710/14041—Use of virus, viral particle or viral elements as a vector
    • C12N2710/14043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vectore
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16711—Varicellovirus, e.g. human herpesvirus 3, Varicella Zoster, pseudorabies
    • C12N2710/16722—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16711—Varicellovirus, e.g. human herpesvirus 3, Varicella Zoster, pseudorabies
    • C12N2710/16734—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Virology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Immunology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Physics & Mathematics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Communicable Diseases (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention provides a recombinant baculovirus transfer vector containing a porcine pseudorabies virus gB protein gene, a recombinant baculovirus, a preparation method and application thereof, and belongs to the technical field of veterinary vaccines. A recombinant baculovirus transfer vector containing a porcine pseudorabies virus gB protein gene is respectively inserted into a restriction enzyme cutting site between BamHI and EcoRI and a restriction enzyme cutting site between XbaI and HindIII of the baculovirus transfer vector by taking GP67 signal peptide-gB-His label or GP67 signal peptide-gB-IgGFc-His label as an exogenous gene; the gB is a gene encoding gB protein with a C-terminal transmembrane region segment deleted. The vector promotes the secretory expression of the gB protein and the gB-IgGFc fusion protein of the porcine pseudorabies virus. The single subunit vaccine prepared by the gB protein and the gB-IgGFc fusion protein has the characteristics of good safety, strong specificity and high virus attack protection rate.

Description

Recombinant baculovirus transfer vector containing porcine pseudorabies virus gB protein gene, recombinant baculovirus, preparation method and application
Technical Field
The invention belongs to the technical field of veterinary vaccines, and particularly relates to a recombinant baculovirus transfer vector containing a porcine pseudorabies virus gB protein gene, a recombinant baculovirus, a preparation method and an application.
Background
Porcine Pseudorabies (PR, also known as Aujeszky's disease, AD) is an infectious disease caused by porcine Pseudorabies Virus (PRV). Except that pigs and cattle of various ages are susceptible, animals such as sheep, dogs, cats, rabbits, mice, minks, foxes and the like are infected and attacked under natural conditions, and great economic loss is easily caused to the livestock breeding industry. Porcine Pseudorabies virus (PRV) is also called as porcine herpesvirus type I, infectious bulbar palsy virus, severe itching syndrome virus and Orientszky's disease virus, and is easy to cause symptoms such as fever, severe itching (except for pigs) and encephalomyelitis of various domestic animals such as cows, sheep, pigs, dogs and cats and wild animals. The clinical symptoms of the disease are similar to rabies, so the disease name of pseudorabies is used.
The infection characteristics of the porcine pseudorabies virus comprise two types, one type is latent infection, and the other type is recessive infection. Latent infection is a condition in which an infected pig does not show clinical symptoms, but infectious viruses exist in a latent state for a long period of time in the pig, and the viruses are not isolated, but the presence of viral genomic DNA can be detected by a polymerase probe method, and the latent viruses can be converted into infectious viruses when immunity is weakened due to external adverse environmental stimuli and the like. The recessive infection is that after a pig herd is inoculated with a vaccine or naturally infected with a small amount of virus, the pig is only partially immunized, and recessive infection pigs and pigs with subclinical symptoms can occur, and the virus elimination of the pig with the virus can last for more than one year. In response to the infection characteristics of porcine pseudorabies virus, attempts have been made to control the outbreak of disease in pigs using improved live and inactivated vaccine immunization. Live attenuated vaccines generally have long-term immune effects but risk insufficient attenuation and genetic instability. Inactivated vaccines are not as effective as attenuated vaccines, and repeated vaccination is required, which greatly increases the amount of inactivated vaccine used. Subunit vaccines carrying a single gene of PRV have not been presented.
Disclosure of Invention
In view of the above, the present invention aims to provide a recombinant baculovirus transfer vector containing a porcine pseudorabies virus gB protein gene, which promotes secretory expression of the porcine pseudorabies virus gB protein.
The invention also aims to provide a recombinant baculovirus expressing the gB protein or the gB-IgGFc fusion protein of the porcine pseudorabies virus, and the virus has the characteristic of secreting and expressing the gB protein or the gB-IgGFc fusion protein.
The invention also aims to provide the subunit vaccine for the porcine pseudorabies, which has the characteristics of high safety, strong specificity, high immunity efficiency and the like.
The invention provides a recombinant baculovirus transfer vector containing porcine pseudorabies virus gB protein gene, which is characterized in that GP67 signal peptide-gB-His label is taken as an exogenous gene and is respectively inserted into a restriction enzyme cutting site between BamHI and EcoRI and a restriction enzyme cutting site between XbaI and HindIII of the baculovirus transfer vector;
the gB is a gene for coding gB protein with a deleted C-terminal transmembrane region segment; the nucleotide sequence of the gene of the gB protein with the coding C-terminal transmembrane region fragment deleted is shown as SEQ ID No. 1.
The invention provides a recombinant baculovirus transfer vector containing a porcine pseudorabies virus gB-IgGFc fusion protein gene, wherein a GP67 signal peptide-gB-IgGFc fusion protein-His label is taken as an exogenous gene and is respectively inserted into a restriction enzyme cutting site between BamHI and EcoRI and a restriction enzyme cutting site between XbaI and HindIII;
the nucleotide sequence of the gB-IgGFc fusion protein is obtained by connecting a gene of gB protein with a coding sequence of IgGFc protein, wherein the gene of gB protein is deleted from a C-end transmembrane region segment; the nucleotide sequence of the gene of the gB protein with the coding C-terminal transmembrane region fragment deleted is shown as SEQ ID No. 1; the nucleotide sequence of the IgGFc protein coding sequence is shown as SEQ ID No. 2.
The invention provides a construction method of the recombinant baculovirus transfer vector, which comprises the following steps:
(1) PCR amplifying gB segment with C end transmembrane region segment deletion by using PRV genome as template;
(2) connecting the gB segment with the deleted C-terminal transmembrane region segment with a basic vector to obtain a gB-containing recombinant vector;
(3) performing PCR amplification by using a gB-containing recombinant vector as a template and a first primer pair to obtain a first PCR amplification product which is a GP67 signal peptide-gB-His tag target fragment;
taking the first PCR amplification product as a template, and respectively adding enzyme cutting sites to obtain a GP67 signal peptide-gB-His label target fragment with two ends respectively connected with BamHI and EcoRI enzyme cutting sites and a GP67 signal peptide-gB-His label target fragment with two ends respectively connected with XbaI and HindIII enzyme cutting sites;
(4) and connecting the GP67 signal peptide-gB-His label target fragment with the two ends respectively connected with BamHI enzyme cutting sites and EcoRI enzyme cutting sites and the GP67 signal peptide-gB-His label target fragment with the two ends respectively connected with XbaI enzyme cutting sites and HindIII enzyme cutting sites to a baculovirus transfer vector to obtain the recombinant baculovirus transfer vector containing the porcine pseudorabies virus gB protein gene.
Preferably, the first primer pair comprises a forward primer adding GP67 signal peptide to the 5 'end of gB and a reverse primer adding His tag to the 3' end of gB, and the nucleotide sequence of the forward primer is shown as SEQ ID No.3 and SEQ ID No. 4; the nucleotide sequence of the reverse primer is shown as SEQ ID No. 5.
Preferably, the method for obtaining the GP67 signal peptide-gB-His label target fragment with BamHI and EcoRI enzyme cutting sites connected at two ends by adding the enzyme cutting sites comprises the steps of carrying out PCR amplification by adopting SEQ ID No.6 and SEQ ID No. 7;
the method for obtaining the GP67 signal peptide-gB-His label target fragment with the two ends respectively connected with the XbaI enzyme cutting sites and the HindIII enzyme cutting sites by adding the enzyme cutting sites comprises the step of carrying out PCR amplification by adopting SEQ ID No.8 and SEQ ID No. 9.
The invention provides a construction method of a gene recombinant baculovirus transfer vector containing porcine pseudorabies virus gB-IgGFc fusion protein, which comprises the following steps:
(1) using PRV genome as template, PCR amplifying gB segment with C end transmembrane region segment deletion and artificially synthesizing IgGFc-His segment;
(2) connecting the gB segment or the IgGFc-His segment deleted from the C-end transmembrane region segment with a basic vector respectively to obtain a gB-containing recombinant vector or an IgGFc-His-containing recombinant vector;
(3) performing PCR amplification by using a gB-containing recombinant vector as a template and a first primer pair to obtain a first PCR amplification product which is a GP67 signal peptide-gB-His tag target fragment;
(4) performing fusion PCR amplification by using the GP67 signal peptide-gB-His tag target segment and a recombinant vector containing IgGFc-His as templates and using a second primer pair to obtain a second PCR amplification product which is the GP67 signal peptide-gB-IgGFc-His tag target segment;
taking the second PCR amplification product as a template, and respectively adding enzyme cutting sites to obtain a GP67 signal peptide-gB-IgGFc-His label target fragment with two ends respectively connected with BamHI and EcoRI enzyme cutting sites and a GP67 signal peptide-gB-His label target fragment with two ends respectively connected with XbaI and HindIII enzyme cutting sites;
(5) and connecting the GP67 signal peptide-gB-IgGFc-His label target fragment with the two ends respectively connected with BamHI and EcoRI enzyme cutting sites and the GP67 signal peptide-gB-IgGFc-His label target fragment with the two ends respectively connected with XbaI and HindIII enzyme cutting sites to a baculovirus transfer vector to obtain the recombinant baculovirus transfer vector containing the porcine pseudorabies virus gB-IgGFc fusion protein gene.
Preferably, the second primer pair comprises a forward primer with the 5 'end of gB added with a GP67 signal peptide sequence as shown in SEQ ID No.10, a reverse primer with the 3' end of gB added with a homology arm sequence as shown in SEQ ID No.11, a forward primer with the 5 'end of IgGFc added with a homology arm sequence as shown in SEQ ID No.12 and a reverse primer with the 3' end of IgGFc added with a His tag sequence as shown in SEQ ID No. 13.
In the invention, the method for obtaining the GP67 signal peptide-gB-IgGFc-His label target fragment with BamHI and EcoRI enzyme cutting sites connected at two ends by respectively adding enzyme cutting sites by taking the second PCR amplification product as a template preferably comprises the step of carrying out PCR amplification by adopting SEQ ID No.6 and SEQ ID No. 7. Adding a BamHI enzyme cutting site to the 5' end of a GP67 signal peptide-gB-IgGFc-His tag target fragment by using a primer shown in SEQ ID No. 6; the primers shown in SEQ ID No.7 add EcoRI cleavage sites to the 3' end of the GP67 signal peptide-gB-IgGFc-His tag target fragment.
In the invention, the method for obtaining the GP67 signal peptide-gB-IgGFc-His label target fragment with the two ends respectively connected with the XbaI and HindIII enzyme cutting sites by adding the enzyme cutting sites preferably comprises the step of carrying out PCR amplification by adopting SEQ ID No.8 and SEQ ID No. 9. The primers shown in SEQ ID No.8 add XbaI cleavage site to the 5' end of GP67 signal peptide-gB-IgGFc-His tag target fragment. The primers shown in SEQ ID No.9 add HindIII cleavage sites to the 3' end of the GP67 signal peptide-gB-IgGFc-His tag target fragment.
The invention provides a recombinant baculovirus expressing porcine pseudorabies virus gB protein, which is obtained by transfecting a recombinant baculovirus transfer vector to insect cells, culturing until the cells have pathological changes and collecting supernatant.
The invention provides a recombinant baculovirus expressing porcine pseudorabies virus gB-IgGFc fusion protein, which is obtained by transfecting a recombinant baculovirus transfer vector to an insect cell, culturing until the cell has pathological changes, and collecting supernatant.
The recombinant baculovirus transfer vector or the recombinant baculovirus obtained by the construction method of the recombinant baculovirus transfer vector or the application of the recombinant baculovirus in producing the vaccine of porcine pseudorabies is provided.
The invention provides a subunit vaccine for preventing and treating porcine pseudorabies, which comprises an adjuvant and one of the following proteins: the porcine pseudorabies virus gB protein expressed by the recombinant baculovirus and the gB-IgGFc fusion protein expressed by the recombinant baculovirus.
Preferably, the concentration of the porcine pseudorabies virus gB protein is 200-300 mug/ml; the concentration of the gB-IgGFc fusion protein is 150-200 mu g/ml.
The invention provides a recombinant baculovirus transfer vector containing porcine pseudorabies virus gB protein gene, GP67 signal peptide-gB-His label is an exogenous gene which is respectively inserted into BamHI and EcoRI enzyme cutting sites and XbaI and HindIII enzyme cutting sites of the baculovirus transfer vector; the gB is a gene encoding gB protein with a deleted transmembrane region segment. The gB sequence is a DNA sequence of coding gB protein with deletion of a coding transmembrane region segment in an epidemic dominant strain in China, the gB protein is glycoprotein of PRV (PRV), and comprises 2082bp, the deletion of the transmembrane region is more beneficial to the secretory expression of the gB protein, and meanwhile, a GP67 signal peptide-gB-His label is placed under a promoter in a baculovirus transfer vector in a 2-copy mode in the recombinant baculovirus transfer vector, so that the expression quantity of a target gene can be improved, and convenience is provided for subsequent separation and purification and in-vitro expression of the protein.
The invention provides a recombinant baculovirus transfer vector containing a porcine pseudorabies virus gB-IgGFc fusion protein gene, wherein GP67 signal peptide-gB-IgGFc fusion protein-His label is an exogenous gene which is respectively inserted into a BamHI enzyme cutting site and an EcoRI enzyme cutting site and an XbaI enzyme cutting site and a HindIII enzyme cutting site of the baculovirus transfer vector; the gB-IgGFc fusion protein is obtained by connecting a gene of gB protein with a coding sequence of the IgGFc protein through a connecting sequence, wherein the gene is used for coding the gB protein with a transmembrane region segment deleted. The protein coded by the gB-IgGFc is a gB and rat-derived IgGFc fusion protein of PRV, the total length is 3231 bases, 1077 amino acids are coded, deletion of a gB transmembrane region is more beneficial to secretory expression of the gB-IgGFc protein, and meanwhile, fusion of PRV glycoprotein gB and IgGFc can enhance protective immunity to PRV, and an IgG2a Fc fragment plays a potential molecular adjuvant role. Meanwhile, the GP67 signal peptide-gB-IgGFc fusion protein-His label is placed under a promoter of a baculovirus transfer vector in a 2-copy mode, so that the expression quantity of a target gene is improved, and convenience is provided for subsequent separation and purification and in-vitro expression of the protein.
The recombinant baculovirus transfer vector or the recombinant baculovirus obtained by the construction method of the recombinant baculovirus transfer vector or the application of the recombinant baculovirus in producing the vaccine of porcine pseudorabies is provided. Because the gB protein expressed by the porcine pseudorabies virus gB protein recombinant baculovirus and the gB-IgGFc fusion protein expressed by the gB-IgGFc fusion protein recombinant baculovirus are not all viruses, the subunit vaccine prepared by the method has no risk of virus diffusion, and the production process is safer. After the prepared gB protein and gB-IgGFc fusion protein immunize organisms, the antibody has the characteristics of strong antigen specificity diagnosis, high sensitivity and rapid diagnosis; can realize the high-efficiency production of genetic engineering vaccines. In addition, compared with the gB protein, the antigen immunogenicity of the obtained gB-IgGFc fusion protein is better, and the protection rate to mice is higher. Therefore, the IgG2a Fc fragment serves as a molecular adjuvant to be fused with an antigen, and plays a role in improving the immunogenicity of the antigen.
Drawings
FIG. 1 shows the restriction enzyme cleavage identification map of recombinant baculovirus transfer vectors PFBD-2-PRVgB and PFBD-2-PRVgB-IgGFc;
FIG. 2 is an electrophoresis diagram of Western blot and SDA-PAGE analysis for recombinant baculovirus AC-2-PRV-gB protein expression;
FIG. 3 is an electrophoresis diagram of Western blot and SDA-PAGE analysis for recombinant baculovirus AC-2-PRV-gB-IgG2aFc protein expression;
FIG. 4 is a graph of antibody level measurements against PRV at different time points after immunization of mice with two subunit vaccines;
FIG. 5 shows the measurement of cytokine levels induced by mice immunized with two subunit vaccines;
FIG. 6 shows the survival rate of mice immunized with the two subunit vaccines after challenge.
Detailed Description
The invention provides a recombinant baculovirus transfer vector containing porcine pseudorabies virus gB protein gene, which is characterized in that GP67 signal peptide-gB-His label is taken as an exogenous gene and is respectively inserted into a restriction enzyme cutting site between BamHI and EcoRI and a restriction enzyme cutting site between XbaI and HindIII of the baculovirus transfer vector;
the gB is a gene for coding gB protein with a deleted C-terminal transmembrane region segment; the nucleotide sequence of the gene of the gB protein with the coding C-terminal transmembrane region fragment deleted is shown as SEQ ID No. 1. The total length of the gB gene is 2745bp (SEQ ID No.14), and the amino acid sequence of the protein expressed by the gB gene is shown in SEQ ID No. 15.
In the invention, the gene of the gB protein which is deleted by the C-terminal transmembrane region segment is not limited to the nucleotide sequence shown in SEQ ID No.1, and also comprises a nucleotide sequence which is complementary with the SEQ ID No.1 and a sequence which is obtained by simply adding, deleting and replacing one or more nucleotides on the basis of the SEQ ID No.1, thereby achieving the purpose of the invention and belonging to the protection scope of the invention. In the embodiment of the invention, the nucleotide sequence of the GP67 signal peptide-gB-His tag is shown as SEQ ID No. 16. The coding sequence of GP67 signal peptide-gB-His label is shown in SEQ ID No. 17. The amino acid sequence of the GP67 signal peptide-gB-His tag is shown in SEQ ID No. 18.
The source of the baculovirus transfer vector in the present invention is not particularly limited, and baculovirus transfer vectors known in the art may be used. To illustrate the recombinant baculovirus transfer vector composition, recombinant baculovirus was prepared using the PFBDHmHNM1P10 efp plasmid as a recombinant baculovirus transfer vector in the examples in the art. The PFBDHmHNM1P10eEFP plasmid was provided by the present laboratory construct (patent No.: ZL 200910063217.6). The core of the recombinant baculovirus transfer vector is that GP67 signal peptide-gB-His label is an exogenous gene, but the type of the baculovirus transfer vector is not specific, and the baculovirus transfer vector only contains two or more multiple cloning sites. The kind of the multiple cloning site is not limited, but not limited to the cleavage site between BamHI and EcoRI and the cleavage site between XbaI and HindIII.
The nucleotide sequence of the GP67 signal peptide is not particularly limited in the present invention, and the nucleotide sequence of GP67 signal peptide known in the art can be adopted. In the embodiment of the invention, the sequence of the GP67 signal peptide is shown in SEQ ID No.3 and SEQ ID No.4 in the construction method. The nucleotide sequence of the His tag is not particularly limited in the present invention, and a nucleotide sequence of a His tag known in the art may be used. In the embodiment of the invention, the sequence of the His tag is shown in SEQ ID No.5 in the construction method.
The invention provides a recombinant baculovirus transfer vector containing a porcine pseudorabies virus gB-IgGFc fusion protein gene, wherein GP67 signal peptide-gB-IgGFc fusion protein-His label is an exogenous gene which is respectively inserted into a restriction enzyme cutting site between BamHI and EcoRI and a restriction enzyme cutting site between XbaI and HindIII of the baculovirus transfer vector; the nucleotide sequence of the gB-IgGFc fusion protein is obtained by connecting a gene of gB protein with a coding sequence of IgGFc protein, wherein the gene of gB protein is deleted from a C-end transmembrane region segment; the nucleotide sequence of the gene of the gB protein with the coding C-terminal transmembrane region fragment deleted is shown as SEQ ID No. 1; the nucleotide sequence of the IgGFc protein coding sequence is shown as SEQ ID No. 2.
In the present invention, the sequence encoding the gB protein with the C-terminal transmembrane region segment deleted is described above, and is not described herein again. The IgGFc protein is selected from mouse-derived IgGFc protein, preferably mouse-derived IgG2aFc protein, but not other IgG subtypes, because IgG2a Fc has higher affinity with mouse-derived Fc gamma RI receptor, and the Fc gamma RI receptor is a high-affinity receptor of immunoglobulin, which is favorable for forming fusion protein with stronger specificity. The IgGFc protein coding sequence is not limited to the nucleotide sequence shown in SEQ ID No.2, and also comprises a nucleotide sequence complementary with the SEQ ID No.2 and a sequence obtained by simply adding, deleting and replacing one or more nucleotides on the basis of the SEQ ID No.2, which can achieve the purpose of the invention and belongs to the protection scope of the invention. The connecting sequence is used for connecting the 5 'end of the nucleotide sequence of the IgGFc protein and the 3' end of the gB protein. The linker sequence has high flexibility and can be used as a linker sequence for ligation as is well known in the art. In the embodiment of the present invention, the specific nucleotide sequence of the connecting sequence may be found in the following construction method, wherein the reverse primer is a reverse primer in which a homology arm sequence is added to the 3 'end of gB as shown in SEQ ID No.8 or the forward primer is a forward primer in which a homology arm sequence is added to the 5' end of IgGFc as shown in SEQ ID No. 9. The kind of the baculovirus transfer vector is the same as the gene recombinant baculovirus transfer vector containing porcine pseudorabies virus gB protein, and details are not repeated herein.
In the invention, the nucleotide sequence of the coding sequence of the GP67 signal peptide-gB-IgGFc fusion protein-His label is shown as SEQ ID No.19, the nucleotide sequence of the gB-IgG2aFc gene is 2970bp in total, and 989 amino acids are coded; the protein sequence coded by the gB-IgG2aFc gene is shown as SEQ ID No. 20.
The invention provides a construction method of the recombinant baculovirus transfer vector, which comprises the following steps:
(1) PCR amplifying gB segment with C end transmembrane region segment deletion by using PRV genome as template;
(2) connecting the gB segment with the deleted C-terminal transmembrane region segment with a basic vector to obtain a gB-containing recombinant vector;
(3) performing PCR amplification by using a first primer pair by using a gB recombinant vector as a template to obtain a first PCR amplification product which is a GP67 signal peptide-gB-His label target fragment;
taking the first PCR amplification product as a template, and respectively adding enzyme cutting sites to obtain a GP67 signal peptide-gB-His label target fragment with two ends respectively connected with BamHI and EcoRI enzyme cutting sites and a GP67 signal peptide-gB-His label target fragment with two ends respectively connected with XbaI and HindIII enzyme cutting sites;
(4) and connecting the GP67 signal peptide-gB-His label target fragment with the two ends respectively connected with BamHI enzyme cutting sites and EcoRI enzyme cutting sites and the GP67 signal peptide-gB-His label target fragment with the two ends respectively connected with XbaI enzyme cutting sites and HindIII enzyme cutting sites to a baculovirus transfer vector to obtain the recombinant baculovirus transfer vector containing the porcine pseudorabies virus gB protein gene.
The invention uses PRV genome as template, PCR amplifies gB segment with C end transmembrane region segment deletion. The gB segment with the C-terminal transmembrane region segment deleted comprises a genome of the porcine pseudorabies virus serving as a template, and is obtained by performing PCR amplification. The forward primer for PCR amplification comprises gcggccgtgacgcgggccgcctcggcctcgcc (SEQ ID No. 21); the reverse primer for PCR amplification includes gttgtggtccaccttgaccacgcggtcaatg, (SEQ ID No. 22). The procedure for the PCR amplification was as follows: 4 ℃, 5 min; (94 ℃, 30 s; 60 ℃, 30 s; 72 ℃, 1kb/min) for 30 cycles; 72 ℃ for 5 min; the total system of PCR amplification is 50 μ l: 10X buffer (containing Mg)2+) 5 mul; dNTP,6 ul; 10 μ M primer1, 2 μ l; 10 μ M primer2, 2 μ l; template, 200 ng; taq enzyme, 0.5. mu.l; ddH2And O is used for supplementing the system.
After a gB segment with a deleted C-terminal transmembrane segment is obtained, the gB segment with the deleted C-terminal transmembrane segment is connected with a basic vector to obtain a gB-containing recombinant vector.
In the present invention, the kind of the base vector is not particularly limited, and a base vector well known in the art may be used. In the examples of the present invention, the basic vector is pEASYBLUNT vector for illustrating the ligation process. The pEASYBLUNT vector and the gB fragment with the deletion of the transmembrane region fragment are mixed and reacted for 5min at room temperature, and are connected through a blunt end.
The method comprises the steps of carrying out PCR amplification by using a first primer pair by using a gB recombinant vector as a template to obtain a first PCR amplification product which is a GP67 signal peptide-gB-His tag target fragment; and (3) adding enzyme cutting sites respectively by taking the first PCR amplification product as a template to obtain a GP67 signal peptide-gB-His label target fragment with two ends respectively connected with BamHI enzyme cutting sites and EcoRI enzyme cutting sites and a GP67 signal peptide-gB-His label target fragment with two ends respectively connected with XbaI enzyme cutting sites and HindIII enzyme cutting sites.
In the present invention, the first primer pair preferably comprises a forward primer in which a GP67 signal peptide is added to the 5' end of gB and a forward primer in which gB is addedA reverse primer of His label is added at the 3' end, and the nucleotide sequence of the forward primer is shown as SEQ ID No.3 and SEQ ID No. 4; the nucleotide sequence of the reverse primer is shown as SEQ ID No. 5. The reaction system for PCR amplification of the first primer pair is 50 μ l: 10 × buffer (containing Mg)2+) 5 mul; dNTP, 6. mu.l; 10 μ M forward primer, 2 μ l; 10. mu.M reverse primer, 2. mu.l; template, 200 ng; taq, 0.5. mu.l; ddH2O complement system; the reaction program of PCR amplification of the first primer pair is 94 ℃ and 5 min; (94 ℃, 30 s; 65 ℃, 30 s; 72 ℃, 1kb/min) for 30 cycles; 72 ℃ for 5 min.
In the invention, the method for obtaining the GP67 signal peptide-gB-His tag target fragment with BamHI and EcoRI enzyme cutting sites connected at two ends by adding the enzyme cutting sites preferably comprises the step of carrying out PCR amplification by adopting SEQ ID No.6 and SEQ ID No. 7. Adding a BamHI enzyme cutting site to the 5' end of a GP67 signal peptide-gB-His label target fragment by using a primer shown in SEQ ID No. 6; the primer shown in SEQ ID No.7 adds an EcoRI cleavage site to the 3' end of the GP67 signal peptide-gB-His tag target fragment. The reaction sequence in the case of PCR amplification with SEQ ID No.6 and SEQ ID No.7 is preferably as follows: 94 ℃ for 5 min; (94 ℃, 30 s; 65 ℃, 30 s; 72 ℃, 1kb/min) for 30 cycles; 72 ℃ for 5 min. The reaction system is the same as above.
In the invention, the method for obtaining the GP67 signal peptide-gB-His label target fragment with the two ends respectively connected with the XbaI enzyme cutting sites and the HindIII enzyme cutting sites by adding the enzyme cutting sites preferably comprises the step of carrying out PCR amplification by adopting SEQ ID No.8 and SEQ ID No. 9. The primers shown in SEQ ID No.8 add XbaI cleavage sites to the 5' end of the GP67 signal peptide-gB-His tag target fragment. The primers shown in SEQ ID No.9 add HindIII cleavage sites to the 3' end of the GP67 signal peptide-gB-His tag target fragment. The reaction sequence in the case of PCR amplification with SEQ ID No.8 and SEQ ID No.9 is preferably as follows: 94 ℃ for 5 min; (94 ℃, 30 s; 65 ℃, 30 s; 72 ℃, 1kb/min) for 30 cycles; 72 ℃ for 5 min. The reaction system is the same as above.
After two fragments are obtained, the invention connects the GP67 signal peptide-gB-His label target fragment with two ends respectively connected with BamHI and EcoRI enzyme cutting sites and the GP67 signal peptide-gB-His label target fragment with two ends respectively connected with XbaI and HindIII enzyme cutting sites into a baculovirus transfer vector to obtain the recombinant baculovirus transfer vector containing the porcine pseudorabies virus gB protein gene.
In the present invention, before the ligation, the baculovirus transfer vector or the above two target fragments are preferably digested with BamHI, EcoRI and XbaI, followed by HindIII enzymes. The ligation method is preferably performed overnight at 16 ℃ using T4DNA ligase.
The invention provides a construction method of a recombinant baculovirus transfer vector containing a porcine pseudorabies virus gB-IgGFc fusion protein gene, which comprises the following steps:
(1) using PRV genome as template, PCR amplifying gB segment with C end transmembrane region segment deletion and artificially synthesizing IgGFc-His segment;
(2) connecting the gB segment or the IgGFc-His segment deleted from the C-end transmembrane region segment with a basic vector respectively to obtain a gB-containing recombinant vector or an IgGFc-His-containing recombinant vector;
(3) performing PCR amplification by using a gB-containing recombinant vector as a template and a first primer pair to obtain a first PCR amplification product which is a GP67 signal peptide-gB-His tag target fragment;
(4) performing fusion PCR amplification by using the GP67 signal peptide-gB-His tag target segment and a recombinant vector containing IgGFc-His as templates and using a second primer pair to obtain a second PCR amplification product which is the GP67 signal peptide-gB-IgGFc-His tag target segment;
taking the second PCR amplification product as a template, and respectively adding enzyme cutting sites to obtain a GP67 signal peptide-gB-IgGFc-His label target fragment with two ends respectively connected with BamHI and EcoRI enzyme cutting sites and a GP67 signal peptide-gB-His label target fragment with two ends respectively connected with XbaI and HindIII enzyme cutting sites;
(5) and connecting the GP67 signal peptide-gB-IgGFc-His label target fragment with the two ends respectively connected with BamHI and EcoRI enzyme cutting sites and the GP67 signal peptide-gB-IgGFc-His label target fragment with the two ends respectively connected with XbaI and HindIII enzyme cutting sites to a baculovirus transfer vector to obtain the recombinant baculovirus transfer vector containing the porcine pseudorabies virus gB-IgGFc fusion protein gene.
In the present invention, the operation method for amplifying gB segment with C-terminal transmembrane region segment deletion and artificially synthesizing IgGFc-His segment by PCR using PRV genome as template is the same as above, and is not repeated herein again.
In the present invention, the method for connecting the gB fragment or IgGFc-His fragment deleted from the C-terminal transmembrane domain fragment with the basic vector is the same as above, and the detailed description thereof is omitted.
In the present invention, the operation method of performing PCR amplification by using the first primer pair with the recombinant vector containing gB as a template is the same as above, and is not described again.
In the present invention, the second primer pair preferably includes a forward primer in which a GP67 signal peptide sequence is added to the 5 'end of gB as shown in SEQ ID No.10, a reverse primer in which a homology arm sequence is added to the 3' end of gB as shown in SEQ ID No.11, a forward primer in which a homology arm sequence is added to the 5 'end of IgGFc as shown in SEQ ID No.12, and a reverse primer in which a His tag sequence is added to the 3' end of IgGFc as shown in SEQ ID No. 13. The second primer pair carries out fusion PCR amplification, and the reaction program comprises the following steps: 94 ℃ for 5 min; (94 ℃, 30 s; 65 ℃, 30 s; 72 ℃, 1kb/min) for 30 cycles; 72 ℃ for 5 min; the reaction system during PCR amplification is as follows: 50 μ l: 10X buffer (containing Mg)2+) 5 mul; dNTP, 6. mu.l; 10 μ M forward primer, 2 μ l; 10. mu.M reverse primer, 2. mu.l; template (HBM-gD-His or IgGFc-His), 200 ng; taq, 0.5. mu.l; ddH2O complement system; amplification System 2: 50 μ l: 10X buffer (containing Mg)2+) 5 mul; dNTP, 6. mu.l; 10 μ M forward primer, 2 μ l; 10. mu.M reverse primer, 2. mu.l; template 1(HBM signal peptide-gD-His), 200 ng; template 2(IgGFc-His), 200 ng; taq, 0.5. mu.l; ddH2O make up the system.
In the invention, the method for obtaining the GP67 signal peptide-gB-IgGFc-His label target fragment with BamHI and EcoRI enzyme cutting sites connected at two ends by respectively adding enzyme cutting sites by taking the second PCR amplification product as a template preferably comprises the step of carrying out PCR amplification by adopting SEQ ID No.6 and SEQ ID No. 7. Adding a BamHI enzyme cutting site to the 5' end of a GP67 signal peptide-gB-IgGFc-His tag target fragment by using a primer shown in SEQ ID No. 6; the primers shown in SEQ ID No.7 add EcoRI cleavage sites to the 3' end of the GP67 signal peptide-gB-IgGFc-His tag target fragment. The reaction sequence in the case of PCR amplification with SEQ ID No.6 and SEQ ID No.7 is preferably as follows: 94 ℃ for 5 min; (94 ℃, 30 s; 65 ℃, 30 s; 72 ℃, 1kb/min), 30 cycles); 72 ℃ for 5 min. The reaction system is the same as above.
In the invention, the method for obtaining the GP67 signal peptide-gB-IgGFc-His label target fragment with the two ends respectively connected with the XbaI and HindIII enzyme cutting sites by adding the enzyme cutting sites preferably comprises the step of carrying out PCR amplification by adopting SEQ ID No.8 and SEQ ID No. 9. The primers shown in SEQ ID No.8 add XbaI cleavage site to the 5' end of GP67 signal peptide-gB-IgGFc-His tag target fragment. The primers shown in SEQ ID No.9 add HindIII cleavage sites to the 3' end of the GP67 signal peptide-gB-IgGFc-His tag target fragment. The reaction sequence in the case of PCR amplification with SEQ ID No.8 and SEQ ID No.9 is preferably as follows: 94 ℃ for 5 min; (94 ℃, 30 s; 65 ℃, 30 s; 72 ℃, 1kb/min), 30 cycles; 72 ℃ for 5 min. The reaction system is the same as above.
The invention provides a recombinant baculovirus expressing porcine pseudorabies virus gB protein or gB-IgGFc fusion protein, which is obtained by transfecting a recombinant baculovirus transfer vector prepared by the construction method to insect cells, culturing until the cells have pathological changes, and collecting supernatant.
In the present invention, the method for transfecting the recombinant baculovirus transfer vector into the insect cell is preferably transfection using liposome-mediated transfection. The present invention is not particularly limited in kind of the insect cell, and insect cells well known in the art may be used. In the present embodiment, the insect cell is preferably an Sf9 insect cell. The method of culturing transfected cells in the present invention is not particularly limited, and a conventional method of culturing transfected cells in the art may be used. After the cells are diseased, collecting the supernatant by adopting a conventional centrifugation method.
The recombinant baculovirus transfer vector or the recombinant baculovirus obtained by the construction method of the recombinant baculovirus transfer vector or the application of the recombinant baculovirus in producing the vaccine of porcine pseudorabies is provided.
In the present invention, the method for producing a vaccine for porcine pseudorabies preferably comprises the steps of: inoculating the recombinant baculovirus expressing the porcine pseudorabies virus gB protein or the gB-IgGFc fusion protein into transfected insect cells at the dose of 0.1MOI, continuously culturing, collecting supernatant when the cells have pathological changes, and detecting gB and gB-IgGFc fusion protein secretion supernatant through Westernblot analysis.
The invention provides a subunit vaccine for preventing and treating porcine pseudorabies, which comprises an adjuvant and one of the following proteins: the porcine pseudorabies virus gB protein expressed by the recombinant baculovirus and the gB-IgGFc fusion protein expressed by the recombinant baculovirus.
In the invention, the concentration of the porcine pseudorabies virus gB protein is preferably 200-300 mug/ml, and more preferably 250 mug/ml; the concentration of the gB-IgGFc fusion protein is 150-200 mu g/ml, and more preferably 180 mu g/ml.
In the present invention, the adjuvant is preferably SEPPIC IMS-1313 adjuvant. The volume ratio of the gB or gB-IgGFc protein to the adjuvant is preferably 7: 3. The nasal drop dose of the subunit vaccine is preferably 20 mug/6-week-old mouse, and the variety of the mouse is Babic. The same dose was boosted once 14 days after the first immunization.
The porcine pseudorabies virus gB protein recombinant baculovirus transfer vector, the recombinant baculovirus, the methods of preparation and the use thereof provided by the present invention are explained in detail below with reference to the examples, but they should not be construed as limiting the scope of the present invention.
Example 1
Construction method of recombinant baculovirus transfer vector PFBD-2-PRVgB containing porcine pseudorabies virus gB protein gene
Artificially synthesizing a gene gB with a deleted C-terminal transmembrane region fragment, connecting the gB with a pEASYBLUNT vector to obtain a pEASYBLUNT-gB recombinant vector, and then carrying out sequencing verification, wherein the result is compared and then is correct for later use.
Plasmid pEASYBLUNT-gB is taken as a template, PCR amplification is respectively carried out through 2 groups of primer pairs to obtain gB gene connected with GP67 signal peptide sequence, and then BamHI, EcoRI, XbaI and HindIII are used for cloning target genes to baculovirus transfer vector PFBDHmHNM1P10eEFP for PFBD (see China patent 200910063217.6 for a recombinant baculovirus expressing H1N1 influenza virus HA-NA-M1 gene synthesized by modification). Specifically, pEASYBLUNT-gB is taken as a template, and a first primer pair is respectively used for PCR amplification to obtain GP67-gB-His label target fragments; and respectively carrying out PCR amplification by using a second primer pair to obtain a GP67 signal peptide-gB-His tag target sequence connected with BamHI and EcoRI enzyme cutting sites and obtain a GP67 signal peptide-gB-His tag target sequence connected with XbaI and HindIII enzyme cutting sites by using a fragment GP67 signal peptide-gB-His tag target sequence obtained by amplification of the first primer pair as a template. Wherein the sequences of the first group of primer pairs are shown as SEQ ID No.3, SEQ ID No.4 and SEQ ID No. 5; primers connected with XbaI and HindIII restriction sites are shown as SEQ ID No.6 and SEQ ID No.7, and primers connected with BamHI and EcoRI restriction sites are shown as SEQ ID No.8 and SEQ ID No. 9; the primer sequences are shown in Table 1.
TABLE 1 primer sequence information List
Figure BDA0002044879830000071
Figure BDA0002044879830000081
The transfer vector obtained was identified by digestion with BamHI and EcoRI, SpeI and HindIII, and the result is shown in A of FIG. 1, where M is 15000bp Marker. The enzyme digestion result shows that the size of the enzyme digestion identification fragment is consistent with the expected result, and the expression transfer vector is successfully constructed. The transfer vector PFBD-2-PRV-gB contained 2 copies of the PRV gB gene sequence.
Example 2
Construction method of recombinant baculovirus AC-2-PRVgB
1 mu g of baculovirus transfer plasmid PFBD-2-PRV-gB is added into DHI0Bac enterobacter competent cells, and ice bath is carried out for 30 minutes. The cells are thermally shocked in water at 42 ℃ for 45 seconds, then are iced for 2 minutes in an ice bath, 900 microliters of SOC liquid culture medium is added, shaking culture is carried out at 37 ℃ for 4 hours, 100 microliters of the SOC liquid culture medium is taken and coated on a three-resistance LB plate (Kan, Gen and Tel), and culture is carried out at 37 ℃ for 24-48 hours. Single white colonies screened by 3 rounds of blue-white screening were picked up and cultured in 10mL LB medium containing kanamycin, gentamicin and tetracycline triple antibodies at 37 ℃ for 16h in a shaker (180 rpm/min). Centrifuging to collect bacteria, adding 0.3mLSolution I for resuspension, adding 0.3mLSolution II for gentle mixing, immediately adding 0.3mLSoution III for mixing, carrying out ice bath for 10min, centrifuging at 4 ℃ and 12000rpm for 10min, transferring supernatant into another sterile blank 1.5mLEP tube, adding 0.5mL of isopropanol for mixing, standing for 10min, centrifuging at 4 ℃ and 12000rpm for 10min, removing supernatant, washing with 75% ethanol, drying, adding 30-50 mu LTE for dissolving, and storing at 4 ℃.
Positive rods were transfected into Sf9 insect cells using liposome-mediated transfection: sf9 cells are inoculated in a six-hole plate, transfection is carried out when the cells grow to 80-90%, and two 1.5mL sterile Ep tubes are taken. And adding 100 mu L of serum-free Grace's culture medium and 8 mu L of Lcellinfection into the tube A, sequentially adding 100 mu L of serum-free Grace's culture medium and 1-2ug of recombinant Bacmid into the tube B, standing at room temperature for 5-10min, gradually dripping the solution in the tube B into the tube A, standing at room temperature for 20min, and then supplementing the serum-free Grace's culture medium to 1 mL. And adding the mixture in the 1.5mLEp tube onto the monolayer cells, culturing for 5-6h in an incubator at 27 ℃, replacing complete Grace's culture solution, continuously culturing for 2-3 d, and collecting culture supernatant after cytopathic effect to obtain the recombinant baculovirus AC-2-PRVgB.
Example 3
Artificially synthesizing a nucleotide sequence gB of a gB protein and an IgG2aFc of a nucleotide sequence of a mouse-derived IgG2aFc protein, wherein the nucleotide sequence gB is deleted from a transmembrane region segment; and mixing the gB or IgG2aFc and the pEASYBLUNT vector according to the volume ratio of 0.5-4: 1, reacting for 5min at room temperature, connecting to obtain pEASYBLUNT-gB and pEASYBLUNT-IgG2aFc recombinant vectors, and carrying out sequencing verification to obtain correct and spare use after the results are compared.
Respectively carrying out PCR amplification by using pEASYBLUNT-gB as a template and the first primer pair in the embodiment 1 to obtain a target fragment connected with a GP67 signal peptide-gB-His label; performing PCR amplification by using a first primer pair to obtain a product GP67-gB-His label and pEASYBLUNT-IgG2aFc as templates, and respectively using a second primer pair to obtain a GP67 signal peptide-gB-IgG 2aFc-His target fragment connected with BamHI and EcoRI enzyme cutting sites; and amplifying a target fragment connected with a GP67 signal peptide-gB-IgG 2aFc-His sequence of BamHI and EcoRI enzyme cutting sites by using a third primer pair and taking fragments GP67-gB-IgG2aFc-His and pEASYBLUNT-IgGFc obtained by amplifying the first primer pair as templates.
Wherein the sequences of the second group of primer pairs are shown as SEQ ID No.10, SEQ ID No.11, SEQ ID No.12 and SEQ ID No. 13; the primer sequences are shown in Table 2.
TABLE 2 primer sequence information List
Sequence of Numbering
gccaccatgctactagtaaatcagtcacaccaag-F SEQ ID No.10
ccacctcctccggacccacccccgcctgatccgttgtggtccaccttgaccacgcggtc-R SEQ ID No.11
ggggtgggtccggaggaggtggctcgggatctgagcccagagggcccacaatcaagccc-F SEQ ID No.12
ctagtgatggtgatggtgatgagagcccgatcc-R SEQ ID No.13
The gB-IgGFc target fragment to which the GP67 signal peptide sequence is linked and to which BamHI and EcoRI cleavage sites are linked, and the gB-IgG2aFc target fragment to which the GP67 signal peptide sequence is linked and to which XbaI and HindIII cleavage sites are linked are ligated to the baculovirus transfer vector PFBDHmHNM1P10eEFP to obtain the baculovirus transfer vector PFBD-2-PRVgB-IgG2 aFc.
The baculovirus transfer vector PFBD-2-PRVgB-IgG2aFc was identified by double digestion. The results are shown in FIG. 1, B, where M is 15000bp Marker. The enzyme digestion result shows that the size of the enzyme digestion identification fragment is consistent with the expected result, and the expression transfer vector is successfully constructed. The enzyme digestion identification result shows that the transfer vector PFBD-2-PRV-gB contains 2 copies of PRV gB gene sequences.
Recombinant baculovirus AC-2-PRVgB-IgG2aFc expressing the gB-IgGFc fusion protein was prepared according to the construction method of example 2.
Example 4
Expression of the gB gene and gB-IgG2aFc fusion gene was detected by Westernblot analysis using the recombinant baculovirus AC-2-PRVgB obtained in example 2 and the recombinant baculovirus AC-2-PRVgB-IgG2aFc obtained in example 3 as targets, respectively
Sf9 cells were seeded in 6-well plates and the recombinant baculovirus of example 2 or 3 was seeded at 0.1MOI dose when the cells grew to 90%. Cell culture supernatant and cells were collected separately 72 hours after seeding. After SDA-PAGE running, the gel was transferred to PVDF membrane, and APPVE2 protein expression was detected by ECL display using commercial His antibody as primary antibody (MBL, USA) and HRP-labeled goat anti-mouse IgG (Wuhan Boston Biotech) as secondary antibody. The experimental results are shown in fig. 2 and the left panel of fig. 3. Wherein a 71KDa band appears in the left diagram of fig. 2 and a 90KDa band appears in the left diagram of fig. 3. Thus, recombinant virus bacillus AC-2-PRVgB and AC-2-PRVgB-IgG2aFc infect gB protein and gB-IgG2aFc fusion protein secretion supernatant expressed by insect cells.
SDA-PAGE detection of purified gB protein and gB-IgG2aFc fusion protein
The recombinant baculovirus AC-2-PRVgB or AC-2-PRVgB-IgG2aFc obtained in example 2 was inoculated with HF cells (1 x 10) at a dose of 0.0001MOI6/ml), harvested 4 days or 5 days after inoculation, and stored at 4 degrees. After harvesting, 10000rpm can be directly used, centrifugation is carried out for 10min, and culture supernatant is obtained. The supernatant was filtered through a 0.45mm or 0.22 μm filter. 20ml of His filler equilibrated with equilibration buffer was added to the filteredIn the clear, stir at 4 ℃ overnight. The gB protein or gB-IgGFc fusion protein, which was bound overnight to the His filler, was placed in a column and allowed to drip freely, and the flow-through was bound again to His, allowing free dripping. Eluting 2 column volumes with 0mm imidazole 10mmTris-200mmNaCl buffer solution, and then eluting 2 column volumes with 20mm imidazole 10mmTris-200mmNaCl buffer solution to wash the hybrid protein. Finally, 200mm imidazole 10mmTris-200mmNaCl buffer solution elutes 2 column volumes, and elution of the target protein is carried out. And (3) carrying out imidazole removal treatment on the eluted protein, and taking 30-50 mu l of sample to carry out SDS-PAGE detection.
SDA-PAGE analysis recombinant baculovirus AC-2-PRV-gB protein expression electrophoretogram is shown in the right picture in figure 2, wherein a specific band purified by about 71KDa appears. SDA-PAGE analysis recombinant baculovirus AC-2-PRV-gB-IgG2aFc protein expression electrophoresis chart is shown in the right chart in figure 3, wherein a specific band purified by about 90KDa appears. Recombinant virus bacillus AC-2-PRVgB and AC-2-PRVgB-IgG2aFc infect gB protein and gB-IgGFc fusion protein secretion supernatant expressed by insect cells.
Example 5
Vaccine for preventing and treating porcine pseudorabies
(I) preparation of recombinant baculovirus AC-2-PRVgB and AC-2-PRVgB-IgG2aFc subunit vaccine
Recombinant baculovirus AC-2-PRVgB obtained in example 2 and AC-2-PRVgB-IgG2aFc prepared in example 3 were used to inoculate HF cells (1 x 10) at a dose of 0.0001MOI6Ml), after 5 days of culture, the supernatant was harvested by centrifugation, purified by nickel column, and examined by SDS-PAGE. Calculating the content of gB and gB-IgG2aFc protein, wherein the concentration of the gB protein in the vaccine is 200 mug/ml; the concentration of gB-IgGFc protein in the vaccine was 300. mu.g/ml. Subunit vaccines were prepared, each immunized with 20. mu.g protein, by emulsification with SEPPIC adjuvant IMS-1313 at a dose of 200. mu.g/ml. The prepared subunit vaccine is stored at 4 ℃ after sterile inspection.
And (II) safety test of subunit vaccines prepared from the recombinant baculovirus AC-2-PRVgB and AC-2-PRVgB-IgG2 aFc.
The subunit vaccines were prepared to immunize 6 week old Babic mice separately, 12 mice were inoculated per batch separately. The inoculation mode is nasal drop immunization. The test result shows that the body temperature, spirit and appetite are all normal after the vaccination. The vaccine was confirmed to be safe for mice.
(III) immunogenicity test of subunit vaccine prepared from recombinant baculovirus AC-2-PRVgB and AC-2-PRVgB-IgG2aFc on mice
In order to systematically evaluate the effectiveness of the subunit vaccine of the above index. 60 mice, 6-7 weeks old, PCR-tested PRV negative, were purchased and randomly divided into 4 groups. The immunization dose is 20 mug/mouse, and the immunization route is nasal drop immunization. The same dose was boosted once 14 days after the first immunization. Collecting blood under eyelid before immunization and before immunization for 14, 28 and 42 days, separating splenic lymphocyte for immunization for 42 days, separating lymphocyte through gD and gB protein stimulation, harvesting supernatant, and determining cytokine content.
1. Detection of specific antibodies produced by the body against PRV
The PRV antibody is detected by an indirect ELISA method, and the operation steps are as follows: the PRgB protein expressed and purified by the recombinant baculovirus of the invention is used for coating an ELISA plate, matrix titration is carried out, each hole is determined to be coated with 0.5 mu g, and the temperature is kept overnight at 4 ℃. Blocking was then performed with 1% BSA at 37 ℃ for 1 h. After washing, 50. mu.L of 100-fold diluted serum to be detected was added to each well and incubated for 1 h. Washing 3 times, adding 50 μ L of 10000 times diluted HRP labeled goat anti-mouse or rabbit IgG to each well, and incubating at 37 ℃ for 1 h. After washing, TMB substrate solution was added and color development was carried out at room temperature for 10 min. 50 mu L of 2mol/LH is added into each hole2SO4The reaction was terminated by terminating the solution, and the OD was measured450The value is obtained. The results show that immunization of the subunit vaccine prepared in this example, all groups except the PBS group produced PRV-specific IgG antibodies at 14, 28, 42dpi and peaked at 42 dpi. Furthermore, the IgG antibody titers of mice vaccinated with gD-IgG2aFc and gB-IgG2aFc were higher than those of mice vaccinated with gD and gB (as shown in FIG. 4). The results demonstrate that subunit vaccines prepared from AC-2-PRVgB and AC-2-PRVgB-IgG2aFc are effective in inducing the production of atopic antibodies against APPV. Clearly, the gB-IgG2aFc immunized group produced significantly higher PRV-specific IgG antibodies than the gD or gB immunized group. These results indicate that fusion of antigen to IgG2aFc is effective in promoting humoral immune responses.
2. Detection of specific cellular immune response produced by body
(1) Is free ofTaking out the mouse spleen, placing the mouse spleen in a dish containing incomplete RPMI-1640, cleaning, transferring the mouse spleen into a sterile homogenizer, adding a little incomplete 1640, lightly grinding, adding the incomplete RPMI-1640, uniformly mixing, and filtering by a cell filter to remove tissue fragments. The filtrate was gently pipetted into a 15ml centrifuge tube and centrifuged at 1000rpm for 10 min. The supernatant was discarded and 5ml of sterile 8.3g/L NH were added4Cl, resting for 5min (red blood cells removed) and centrifuging at 1000rpm for 10 min. The supernatant was discarded, washed with incomplete RPMI-1640 and centrifuged at 1000rpm for 10 min. The supernatant was discarded and the pellet was suspended in complete 2.5ml of RPMI-1640 (10% FBS). Cell counting, trypan blue staining, requires that the cell activity should be above 95%. Adjusting the cell concentration to 1X 106and/mL. After mixing, add 500. mu.L of the mixture into a 12-well plate. Each sample was stimulated with purified gB protein, concanavalin (positive control) and culture broth (negative control), and 3 replicates of each stimulus were made; 12 well cell culture plates were placed at 37 ℃ in 5% CO2The cells were incubated in an incubator for 24 hours and then centrifuged to harvest the supernatant. And (3) detecting the expression levels of IFN-gamma and IL-4 proteins in the supernatant by using commercial mouse IFN-gamma and IL-4ELISA detection kits, wherein the kits adopt double-antibody sandwich ELISA.
The results show that the IL-4 concentration of the four subunit vaccine immunization groups is obviously higher than that of IFN-gamma. Furthermore, the IL-4 concentration in the gB-IgGFc-immunized group was significantly higher than that in the gD or gB group (FIG. 5, in which the left panel shows the change in IL-4 concentration in the three treatment groups and the right panel shows the change in IFN-. gamma.concentration in the three treatment groups). These data indicate that Fc-linked PRVgD or gB proteins can significantly promote cellular immune responses.
(IV) challenge protection experiment of subunit vaccine prepared from recombinant baculovirus AC-2-PRVgB and AC-2-PRVgB-IgG2aFc on mice
To assess the suitability of mouse IgG2aFc fragments as potential molecular adjuvants, all mice were infected intranasally with 100LD50The PRVGX wild strain of (a). During monitoring, the protection rates of the different groups are shown in fig. 6. After challenge, the protection rate of the gB-IgG2aFc group is obviously higher than that of the gB group. Mice immunized with gB-IgG2aFc were all alive without any clinical symptoms; the survival rate of mice immunized with gD-IgG2aFc is 83%; the survival rate of mice immunized with gD is 50%; the survival of mice immunized with gB-IgG2aFc was 67% (as shown in FIG. 6)Shown). These data indicate that the PRVgD or gB proteins expressed by the recombinant baculovirus are able to effectively protect mice from PRV infection. In addition, the best protection effect can be achieved by the fusion of gB and IgG2aFc fragment subunit vaccine.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> university of agriculture in Huazhong
<120> recombinant baculovirus transfer vector containing porcine pseudorabies virus gB protein gene, recombinant baculovirus, preparation method and application
<160> 22
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2082
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gcggccgtga cgcgggccgc ctcggcctcg cccgcgcccg ggacgggcgc caccccagac 60
ggcttctccg cggaggagtc cctcgaggag atcgacgggg ccgtctcccc cggcccctcg 120
gacgcccccg acggcgagta cggcgacctg gacgcgcgca cggccgtgcg cgcggccgcg 180
accgagcggg accgcttcta cgtctgcccg ccgccgtccg gctccacggt ggtgcgcctg 240
gagcccgagc aggcctgccc cgagtactcg caggggcgca acttcacgga ggggatcgcc 300
gtgctcttca aggagaacat cgccccgcac aagttcaagg cccacatcta ctacaagaac 360
gtcatcgtca cgaccgtgtg gtccgggagc acgtacgcgg ccatcacgaa ccgcttcacg 420
gaccgcgtgc ccgtccccgt gcaggagatc acggacgtga tcgaccgccg cggcaagtgc 480
gtctccaagg ccgagtacgt gcgcaacaac cacaaggtga ccgccttcga ccgcgacgag 540
aaccccgtcg aggtggacct gcgcccctcg cgcctgaacg cgctcggcac ccgcggctgg 600
cacaccacca acgacaccta caccaagatc ggcgccgcgg gcttctacca cacgggcacc 660
tccgtcaact gcatcgtcga ggaggtggag gcgcgctccg tgtaccccta cgactccttc 720
gccctgtcca cgggggacat cgtgtacatg tcccccttct acggcctgcg cgagggggcc 780
cacggggagc acatcggcta cgcgcccggg cgcttccagc aggtggagca ctactacccc 840
atcgacctgg actcgcgcct ccgcgcctcc gagagcgtga cgcgcaactt tctgcgcacg 900
ccgcacttca cggtggcctg ggactgggcc cccaagacgc ggcgcgtgtg cagcctggcc 960
aagtggcgcg aggccgagga gatgatccgc gacgagacgc gcgacgggtc cttccgcttc 1020
acgtcgcggg ccctgggcgc ctccttcgtc agcgacgtca cgcagctcga cctgcagcgc 1080
gtgcacctgg gcgactgcgt cctccgcgag gcctcggagg ccatcgacgc catctaccgg 1140
cggcgctaca acaacacgca cgtgctggcc ggcgacaagc ccgaggtgta cctcgcccgc 1200
gggggcttcg tggtggcctt ccgcccgctg atctcgaacg agctggcgca gctgtacgcg 1260
cgcgagctcg agcgcctcgg cctcgccggc gtcgtgggcc ccgcgtcccc cgcggccgcc 1320
cgtcgggccc ggcgctcccc cggcccggcg gggacgcccg agccgccggc cgtcaacggc 1380
acggggcacc tgcgcatcac cacgggctcg gccgagtttg cgcgcctgca gttcacctac 1440
gaccacatcc aggcgcacgt gaacgacatg ctgagccgca tcgcggccgc ctggtgcgag 1500
ctgcagaaca aggaccgcac cctgtggggc gagatgtcgc gcctgaaccc cagcgccgtg 1560
gccacggccg cgctgggcca gcgcgtctcg gcgcgcatgc tcggcgacgt gatggccatc 1620
tcgcggtgcg tggaggtgcg cggcggcgtg tacgtgcaga actccatgcg cgtgcccggc 1680
gagcgcggca cgtgctacag ccgcccgctg gtgaccttcg agcacaacgg cacgggcgtg 1740
atcgagggcc agctcggcga cgacaacgag ctcctcatct cgcgcgacct catcgagccc 1800
tgcaccggca accaccggcg ctactttaag ctgggcggcg ggtacgtgta ctacgaggac 1860
tacagctacg tgcgcatggt ggaggtgccc gagacgatca gcacgcgggt gaccctgaac 1920
ctgacgctgc tcgaggaccg cgagttcctg cccctcgagg tgtacacgcg cgaggagctc 1980
gccgacacgg gcctcctgga ctacagcgag atccagcgcc gcaaccagct gcacgcgctc 2040
aagttctacg acattgaccg cgtggtcaag gtggaccaca ac 2082
<210> 2
<211> 699
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gagcccagag ggcccacaat caagccctgt cctccatgca aatgcccagc acctaacctc 60
ttgggtggac catccgtctt catcttccct ccaaagatca aggatgtact catgatctcc 120
ctgagcccca tagtcacatg tgtggtggtg gatgtgagcg aggatgaccc agatgtccag 180
atcagctggt ttgtgaacaa cgtggaagta cacacagctc agacacaaac ccatagagag 240
gattacaaca gtactctccg ggtggtcagt gccctcccca tccagcacca ggactggatg 300
agtggcaagg agttcaaatg caaggtcaac aacaaagacc tgccagcgcc catcgagaga 360
accatctcaa aacccaaagg gtcagtaaga gctccacagg tatatgtctt gcctccacca 420
gaagaagaga tgactaagaa acaggtcact ctgacctgca tggtcacaga cttcatgcct 480
gaagacattt acgtggagtg gaccaacaac gggaaaacag agctaaacta caagaacact 540
gaaccagtcc tggactctga tggttcttac ttcatgtaca gcaagctgag agtggaaaag 600
aagaactggg tggaaagaaa tagctactcc tgttcagtgg tccacgaggg tctgcacaat 660
caccacacga ctaagagctt ctcccggact ccgggtaaa 699
<210> 3
<211> 76
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
taagcgctat tgttttatat gtgcttttgg cggcggcggc gcattctgcc tttgcggcgg 60
ccgtgacgcg ggccgc 76
<210> 4
<211> 85
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gccaccatgc tactagtaaa tcagtcacac caaggcttca ataaggaaca cacaagcaag 60
atggtaagcg ctattgtttt atatg 85
<210> 5
<211> 59
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ctagtgatgg tgatggtgat gagagcccga tccgcggtgg cgcgagacgc ccggcgcgg 59
<210> 6
<211> 34
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ggatccgcca ccatgctact agtaaatcag tcac 34
<210> 7
<211> 35
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
gaattcctag tgatggtgat ggtgatgaga gcccg 35
<210> 8
<211> 34
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
tctagagcca ccatgctact agtaaatcag tcac 34
<210> 9
<211> 35
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
aagcttctag tgatggtgat ggtgatgaga gcccg 35
<210> 10
<211> 34
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
gccaccatgc tactagtaaa tcagtcacac caag 34
<210> 11
<211> 59
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
ccacctcctc cggacccacc cccgcctgat ccgttgtggt ccaccttgac cacgcggtc 59
<210> 12
<211> 59
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
ggggtgggtc cggaggaggt ggctcgggat ctgagcccag agggcccaca atcaagccc 59
<210> 13
<211> 33
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
ctagtgatgg tgatggtgat gagagcccga tcc 33
<210> 14
<211> 2745
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
atgcccgctg gtggcggtct ttggcgcggg ccccgcgggc atcggcccgg gcaccacggc 60
ggtgctggcc tcggacgtct ttggcctgct ccacaccacg ctgcagctgc gcggggcgcc 120
gtcgcgctag cgctgctgct gctggcgctc gccgcgaccc cgacgtgcgg cgcggcggcc 180
gtgacgcggg ccgcctcggc ctcgcccgcg cccgggacgg gcgccacccc agacggcttc 240
tccgcggagg agtccctcga ggagatcgac ggggccgtct cccccggccc ctcggacgcc 300
cccgacggcg agtacggcga cctggacgcg cgcacggccg tgcgcgcggc cgcgaccgag 360
cgggaccgct tctacgtctg cccgccgccg tccggctcca cggtggtgcg cctggagccc 420
gagcaggcct gccccgagta ctcgcagggg cgcaacttca cggaggggat cgccgtgctc 480
ttcaaggaga acatcgcccc gcacaagttc aaggcccaca tctactacaa gaacgtcatc 540
gtcacgaccg tgtggtccgg gagcacgtac gcggccatca cgaaccgctt cacggaccgc 600
gtgcccgtcc ccgtgcagga gatcacggac gtgatcgacc gccgcggcaa gtgcgtctcc 660
aaggccgagt acgtgcgcaa caaccacaag gtgaccgcct tcgaccgcga cgagaacccc 720
gtcgaggtgg acctgcgccc ctcgcgcctg aacgcgctcg gcacccgcgg ctggcacacc 780
accaacgaca cctacaccaa gatcggcgcc gcgggcttct accacacggg cacctccgtc 840
aactgcatcg tcgaggaggt ggaggcgcgc tccgtgtacc cctacgactc cttcgccctg 900
tccacggggg acatcgtgta catgtccccc ttctacggcc tgcgcgaggg ggcccacggg 960
gagcacatcg gctacgcgcc cgggcgcttc cagcaggtgg agcactacta ccccatcgac 1020
ctggactcgc gcctccgcgc ctccgagagc gtgacgcgca actttctgcg cacgccgcac 1080
ttcacggtgg cctgggactg ggcccccaag acgcggcgcg tgtgcagcct ggccaagtgg 1140
cgcgaggccg aggagatgat ccgcgacgag acgcgcgacg ggtccttccg cttcacgtcg 1200
cgggccctgg gcgcctcctt cgtcagcgac gtcacgcagc tcgacctgca gcgcgtgcac 1260
ctgggcgact gcgtcctccg cgaggcctcg gaggccatcg acgccatcta ccggcggcgc 1320
tacaacaaca cgcacgtgct ggccggcgac aagcccgagg tgtacctcgc ccgcgggggc 1380
ttcgtggtgg ccttccgccc gctgatctcg aacgagctgg cgcagctgta cgcgcgcgag 1440
ctcgagcgcc tcggcctcgc cggcgtcgtg ggccccgcgt cccccgcggc cgcccgtcgg 1500
gcccggcgct cccccggccc ggcggggacg cccgagccgc cggccgtcaa cggcacgggg 1560
cacctgcgca tcaccacggg ctcggccgag tttgcgcgcc tgcagttcac ctacgaccac 1620
atccaggcgc acgtgaacga catgctgagc cgcatcgcgg ccgcctggtg cgagctgcag 1680
aacaaggacc gcaccctgtg gggcgagatg tcgcgcctga accccagcgc cgtggccacg 1740
gccgcgctgg gccagcgcgt ctcggcgcgc atgctcggcg acgtgatggc catctcgcgg 1800
tgcgtggagg tgcgcggcgg cgtgtacgtg cagaactcca tgcgcgtgcc cggcgagcgc 1860
ggcacgtgct acagccgccc gctggtgacc ttcgagcaca acggcacggg cgtgatcgag 1920
ggccagctcg gcgacgacaa cgagctcctc atctcgcgcg acctcatcga gccctgcacc 1980
ggcaaccacc ggcgctactt taagctgggc ggcgggtacg tgtactacga ggactacagc 2040
tacgtgcgca tggtggaggt gcccgagacg atcagcacgc gggtgaccct gaacctgacg 2100
ctgctcgagg accgcgagtt cctgcccctc gaggtgtaca cgcgcgagga gctcgccgac 2160
acgggcctcc tggactacag cgagatccag cgccgcaacc agctgcacgc gctcaagttc 2220
tacgacattg accgcgtggt caaggtggac cacaacgtgg tgctgctgcg cggcatcgcc 2280
aacttcttcc agggcctcgg cgacgtgggc gccgccgtcg gcaaggtggt cctgggcgcc 2340
acgggggccg tgatctcggc cgtcggcggc atggtgtcct tcctgtccaa ccccttcggg 2400
gcgctcgcca tcgggctgct ggtgctggcc ggcctggtcg cggccttcct ggcctaccgg 2460
cacatctcgc gcctgcgccg caaccccatg aaggccctgt accccgtcac gacgaaggcg 2520
ctcaaggagg acggcgtcga agaggacgac gtggacgagg ccaagctgga ccaggcccgg 2580
gacatgatcc ggtacatgtc catcgtgtcg gccctcgagc agcaggagca caaggcgcgc 2640
aagaagaaca gcgggcccgc gctgctggcc agccgcgtcg gggcgatggc cacgcgccgc 2700
cggcactacc agcgcctcga gaacgaggac cccgacgccc cctag 2745
<210> 15
<211> 914
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 15
Met Pro Ala Gly Gly Gly Leu Trp Arg Gly Pro Arg Gly His Arg Pro
1 5 10 15
Gly His His Gly Gly Ala Gly Leu Gly Arg Leu Trp Pro Ala Pro His
20 25 30
His Ala Ala Ala Ala Arg Gly Ala Val Ala Leu Ala Leu Leu Leu Leu
35 40 45
Ala Leu Ala Ala Thr Pro Thr Cys Gly Ala Ala Ala Val Thr Arg Ala
50 55 60
Ala Ser Ala Ser Pro Ala Pro Gly Thr Gly Ala Thr Pro Asp Gly Phe
65 70 75 80
Ser Ala Glu Glu Ser Leu Glu Glu Ile Asp Gly Ala Val Ser Pro Gly
85 90 95
Pro Ser Asp Ala Pro Asp Gly Glu Tyr Gly Asp Leu Asp Ala Arg Thr
100 105 110
Ala Val Arg Ala Ala Ala Thr Glu Arg Asp Arg Phe Tyr Val Cys Pro
115 120 125
Pro Pro Ser Gly Ser Thr Val Val Arg Leu Glu Pro Glu Gln Ala Cys
130 135 140
Pro Glu Tyr Ser Gln Gly Arg Asn Phe Thr Glu Gly Ile Ala Val Leu
145 150 155 160
Phe Lys Glu Asn Ile Ala Pro His Lys Phe Lys Ala His Ile Tyr Tyr
165 170 175
Lys Asn Val Ile Val Thr Thr Val Trp Ser Gly Ser Thr Tyr Ala Ala
180 185 190
Ile Thr Asn Arg Phe Thr Asp Arg Val Pro Val Pro Val Gln Glu Ile
195 200 205
Thr Asp Val Ile Asp Arg Arg Gly Lys Cys Val Ser Lys Ala Glu Tyr
210 215 220
Val Arg Asn Asn His Lys Val Thr Ala Phe Asp Arg Asp Glu Asn Pro
225 230 235 240
Val Glu Val Asp Leu Arg Pro Ser Arg Leu Asn Ala Leu Gly Thr Arg
245 250 255
Gly Trp His Thr Thr Asn Asp Thr Tyr Thr Lys Ile Gly Ala Ala Gly
260 265 270
Phe Tyr His Thr Gly Thr Ser Val Asn Cys Ile Val Glu Glu Val Glu
275 280 285
Ala Arg Ser Val Tyr Pro Tyr Asp Ser Phe Ala Leu Ser Thr Gly Asp
290 295 300
Ile Val Tyr Met Ser Pro Phe Tyr Gly Leu Arg Glu Gly Ala His Gly
305 310 315 320
Glu His Ile Gly Tyr Ala Pro Gly Arg Phe Gln Gln Val Glu His Tyr
325 330 335
Tyr Pro Ile Asp Leu Asp Ser Arg Leu Arg Ala Ser Glu Ser Val Thr
340 345 350
Arg Asn Phe Leu Arg Thr Pro His Phe Thr Val Ala Trp Asp Trp Ala
355 360 365
Pro Lys Thr Arg Arg Val Cys Ser Leu Ala Lys Trp Arg Glu Ala Glu
370 375 380
Glu Met Ile Arg Asp Glu Thr Arg Asp Gly Ser Phe Arg Phe Thr Ser
385 390 395 400
Arg Ala Leu Gly Ala Ser Phe Val Ser Asp Val Thr Gln Leu Asp Leu
405 410 415
Gln Arg Val His Leu Gly Asp Cys Val Leu Arg Glu Ala Ser Glu Ala
420 425 430
Ile Asp Ala Ile Tyr Arg Arg Arg Tyr Asn Asn Thr His Val Leu Ala
435 440 445
Gly Asp Lys Pro Glu Val Tyr Leu Ala Arg Gly Gly Phe Val Val Ala
450 455 460
Phe Arg Pro Leu Ile Ser Asn Glu Leu Ala Gln Leu Tyr Ala Arg Glu
465 470 475 480
Leu Glu Arg Leu Gly Leu Ala Gly Val Val Gly Pro Ala Ser Pro Ala
485 490 495
Ala Ala Arg Arg Ala Arg Arg Ser Pro Gly Pro Ala Gly Thr Pro Glu
500 505 510
Pro Pro Ala Val Asn Gly Thr Gly His Leu Arg Ile Thr Thr Gly Ser
515 520 525
Ala Glu Phe Ala Arg Leu Gln Phe Thr Tyr Asp His Ile Gln Ala His
530 535 540
Val Asn Asp Met Leu Ser Arg Ile Ala Ala Ala Trp Cys Glu Leu Gln
545 550 555 560
Asn Lys Asp Arg Thr Leu Trp Gly Glu Met Ser Arg Leu Asn Pro Ser
565 570 575
Ala Val Ala Thr Ala Ala Leu Gly Gln Arg Val Ser Ala Arg Met Leu
580 585 590
Gly Asp Val Met Ala Ile Ser Arg Cys Val Glu Val Arg Gly Gly Val
595 600 605
Tyr Val Gln Asn Ser Met Arg Val Pro Gly Glu Arg Gly Thr Cys Tyr
610 615 620
Ser Arg Pro Leu Val Thr Phe Glu His Asn Gly Thr Gly Val Ile Glu
625 630 635 640
Gly Gln Leu Gly Asp Asp Asn Glu Leu Leu Ile Ser Arg Asp Leu Ile
645 650 655
Glu Pro Cys Thr Gly Asn His Arg Arg Tyr Phe Lys Leu Gly Gly Gly
660 665 670
Tyr Val Tyr Tyr Glu Asp Tyr Ser Tyr Val Arg Met Val Glu Val Pro
675 680 685
Glu Thr Ile Ser Thr Arg Val Thr Leu Asn Leu Thr Leu Leu Glu Asp
690 695 700
Arg Glu Phe Leu Pro Leu Glu Val Tyr Thr Arg Glu Glu Leu Ala Asp
705 710 715 720
Thr Gly Leu Leu Asp Tyr Ser Glu Ile Gln Arg Arg Asn Gln Leu His
725 730 735
Ala Leu Lys Phe Tyr Asp Ile Asp Arg Val Val Lys Val Asp His Asn
740 745 750
Val Val Leu Leu Arg Gly Ile Ala Asn Phe Phe Gln Gly Leu Gly Asp
755 760 765
Val Gly Ala Ala Val Gly Lys Val Val Leu Gly Ala Thr Gly Ala Val
770 775 780
Ile Ser Ala Val Gly Gly Met Val Ser Phe Leu Ser Asn Pro Phe Gly
785 790 795 800
Ala Leu Ala Ile Gly Leu Leu Val Leu Ala Gly Leu Val Ala Ala Phe
805 810 815
Leu Ala Tyr Arg His Ile Ser Arg Leu Arg Arg Asn Pro Met Lys Ala
820 825 830
Leu Tyr Pro Val Thr Thr Lys Ala Leu Lys Glu Asp Gly Val Glu Glu
835 840 845
Asp Asp Val Asp Glu Ala Lys Leu Asp Gln Ala Arg Asp Met Ile Arg
850 855 860
Tyr Met Ser Ile Val Ser Ala Leu Glu Gln Gln Glu His Lys Ala Arg
865 870 875 880
Lys Lys Asn Ser Gly Pro Ala Leu Leu Ala Ser Arg Val Gly Ala Met
885 890 895
Ala Thr Arg Arg Arg His Tyr Gln Arg Leu Glu Asn Glu Asp Pro Asp
900 905 910
Ala Pro
<210> 16
<211> 2247
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
tctagagcca ccatgctact agtaaatcag tcacaccaag gcttcaataa ggaacacaca 60
agcaagatgg taagcgctat tgttttatat gtgcttttgg cggcggcggc gcattctgcc 120
tttgcggcgg ccgtgacgcg ggccgcctcg gcctcgcccg cgcccgggac gggcgccacc 180
ccagacggct tctccgcgga ggagtccctc gaggagatcg acggggccgt ctcccccggc 240
ccctcggacg cccccgacgg cgagtacggc gacctggacg cgcgcacggc cgtgcgcgcg 300
gccgcgaccg agcgggaccg cttctacgtc tgcccgccgc cgtccggctc cacggtggtg 360
cgcctggagc ccgagcaggc ctgccccgag tactcgcagg ggcgcaactt cacggagggg 420
atcgccgtgc tcttcaagga gaacatcgcc ccgcacaagt tcaaggccca catctactac 480
aagaacgtca tcgtcacgac cgtgtggtcc gggagcacgt acgcggccat cacgaaccgc 540
ttcacggacc gcgtgcccgt ccccgtgcag gagatcacgg acgtgatcga ccgccgcggc 600
aagtgcgtct ccaaggccga gtacgtgcgc aacaaccaca aggtgaccgc cttcgaccgc 660
gacgagaacc ccgtcgaggt ggacctgcgc ccctcgcgcc tgaacgcgct cggcacccgc 720
ggctggcaca ccaccaacga cacctacacc aagatcggcg ccgcgggctt ctaccacacg 780
ggcacctccg tcaactgcat cgtcgaggag gtggaggcgc gctccgtgta cccctacgac 840
tccttcgccc tgtccacggg ggacatcgtg tacatgtccc ccttctacgg cctgcgcgag 900
ggggcccacg gggagcacat cggctacgcg cccgggcgct tccagcaggt ggagcactac 960
taccccatcg acctggactc gcgcctccgc gcctccgaga gcgtgacgcg caactttctg 1020
cgcacgccgc acttcacggt ggcctgggac tgggccccca agacgcggcg cgtgtgcagc 1080
ctggccaagt ggcgcgaggc cgaggagatg atccgcgacg agacgcgcga cgggtccttc 1140
cgcttcacgt cgcgggccct gggcgcctcc ttcgtcagcg acgtcacgca gctcgacctg 1200
cagcgcgtgc acctgggcga ctgcgtcctc cgcgaggcct cggaggccat cgacgccatc 1260
taccggcggc gctacaacaa cacgcacgtg ctggccggcg acaagcccga ggtgtacctc 1320
gcccgcgggg gcttcgtggt ggccttccgc ccgctgatct cgaacgagct ggcgcagctg 1380
tacgcgcgcg agctcgagcg cctcggcctc gccggcgtcg tgggccccgc gtcccccgcg 1440
gccgcccgtc gggcccggcg ctcccccggc ccggcgggga cgcccgagcc gccggccgtc 1500
aacggcacgg ggcacctgcg catcaccacg ggctcggccg agtttgcgcg cctgcagttc 1560
acctacgacc acatccaggc gcacgtgaac gacatgctga gccgcatcgc ggccgcctgg 1620
tgcgagctgc agaacaagga ccgcaccctg tggggcgaga tgtcgcgcct gaaccccagc 1680
gccgtggcca cggccgcgct gggccagcgc gtctcggcgc gcatgctcgg cgacgtgatg 1740
gccatctcgc ggtgcgtgga ggtgcgcggc ggcgtgtacg tgcagaactc catgcgcgtg 1800
cccggcgagc gcggcacgtg ctacagccgc ccgctggtga ccttcgagca caacggcacg 1860
ggcgtgatcg agggccagct cggcgacgac aacgagctcc tcatctcgcg cgacctcatc 1920
gagccctgca ccggcaacca ccggcgctac tttaagctgg gcggcgggta cgtgtactac 1980
gaggactaca gctacgtgcg catggtggag gtgcccgaga cgatcagcac gcgggtgacc 2040
ctgaacctga cgctgctcga ggaccgcgag ttcctgcccc tcgaggtgta cacgcgcgag 2100
gagctcgccg acacgggcct cctggactac agcgagatcc agcgccgcaa ccagctgcac 2160
gcgctcaagt tctacgacat tgaccgcgtg gtcaaggtgg accacaacgg atcgggctct 2220
catcaccatc accatcacta gaagctt 2247
<210> 17
<211> 2229
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
atgctactag taaatcagtc acaccaaggc ttcaataagg aacacacaag caagatggta 60
agcgctattg ttttatatgt gcttttggcg gcggcggcgc attctgcctt tgcggcggcc 120
gtgacgcggg ccgcctcggc ctcgcccgcg cccgggacgg gcgccacccc agacggcttc 180
tccgcggagg agtccctcga ggagatcgac ggggccgtct cccccggccc ctcggacgcc 240
cccgacggcg agtacggcga cctggacgcg cgcacggccg tgcgcgcggc cgcgaccgag 300
cgggaccgct tctacgtctg cccgccgccg tccggctcca cggtggtgcg cctggagccc 360
gagcaggcct gccccgagta ctcgcagggg cgcaacttca cggaggggat cgccgtgctc 420
ttcaaggaga acatcgcccc gcacaagttc aaggcccaca tctactacaa gaacgtcatc 480
gtcacgaccg tgtggtccgg gagcacgtac gcggccatca cgaaccgctt cacggaccgc 540
gtgcccgtcc ccgtgcagga gatcacggac gtgatcgacc gccgcggcaa gtgcgtctcc 600
aaggccgagt acgtgcgcaa caaccacaag gtgaccgcct tcgaccgcga cgagaacccc 660
gtcgaggtgg acctgcgccc ctcgcgcctg aacgcgctcg gcacccgcgg ctggcacacc 720
accaacgaca cctacaccaa gatcggcgcc gcgggcttct accacacggg cacctccgtc 780
aactgcatcg tcgaggaggt ggaggcgcgc tccgtgtacc cctacgactc cttcgccctg 840
tccacggggg acatcgtgta catgtccccc ttctacggcc tgcgcgaggg ggcccacggg 900
gagcacatcg gctacgcgcc cgggcgcttc cagcaggtgg agcactacta ccccatcgac 960
ctggactcgc gcctccgcgc ctccgagagc gtgacgcgca actttctgcg cacgccgcac 1020
ttcacggtgg cctgggactg ggcccccaag acgcggcgcg tgtgcagcct ggccaagtgg 1080
cgcgaggccg aggagatgat ccgcgacgag acgcgcgacg ggtccttccg cttcacgtcg 1140
cgggccctgg gcgcctcctt cgtcagcgac gtcacgcagc tcgacctgca gcgcgtgcac 1200
ctgggcgact gcgtcctccg cgaggcctcg gaggccatcg acgccatcta ccggcggcgc 1260
tacaacaaca cgcacgtgct ggccggcgac aagcccgagg tgtacctcgc ccgcgggggc 1320
ttcgtggtgg ccttccgccc gctgatctcg aacgagctgg cgcagctgta cgcgcgcgag 1380
ctcgagcgcc tcggcctcgc cggcgtcgtg ggccccgcgt cccccgcggc cgcccgtcgg 1440
gcccggcgct cccccggccc ggcggggacg cccgagccgc cggccgtcaa cggcacgggg 1500
cacctgcgca tcaccacggg ctcggccgag tttgcgcgcc tgcagttcac ctacgaccac 1560
atccaggcgc acgtgaacga catgctgagc cgcatcgcgg ccgcctggtg cgagctgcag 1620
aacaaggacc gcaccctgtg gggcgagatg tcgcgcctga accccagcgc cgtggccacg 1680
gccgcgctgg gccagcgcgt ctcggcgcgc atgctcggcg acgtgatggc catctcgcgg 1740
tgcgtggagg tgcgcggcgg cgtgtacgtg cagaactcca tgcgcgtgcc cggcgagcgc 1800
ggcacgtgct acagccgccc gctggtgacc ttcgagcaca acggcacggg cgtgatcgag 1860
ggccagctcg gcgacgacaa cgagctcctc atctcgcgcg acctcatcga gccctgcacc 1920
ggcaaccacc ggcgctactt taagctgggc ggcgggtacg tgtactacga ggactacagc 1980
tacgtgcgca tggtggaggt gcccgagacg atcagcacgc gggtgaccct gaacctgacg 2040
ctgctcgagg accgcgagtt cctgcccctc gaggtgtaca cgcgcgagga gctcgccgac 2100
acgggcctcc tggactacag cgagatccag cgccgcaacc agctgcacgc gctcaagttc 2160
tacgacattg accgcgtggt caaggtggac cacaacggat cgggctctca tcaccatcac 2220
catcactag 2229
<210> 18
<211> 742
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 18
Met Leu Leu Val Asn Gln Ser His Gln Gly Phe Asn Lys Glu His Thr
1 5 10 15
Ser Lys Met Val Ser Ala Ile Val Leu Tyr Val Leu Leu Ala Ala Ala
20 25 30
Ala His Ser Ala Phe Ala Ala Ala Val Thr Arg Ala Ala Ser Ala Ser
35 40 45
Pro Ala Pro Gly Thr Gly Ala Thr Pro Asp Gly Phe Ser Ala Glu Glu
50 55 60
Ser Leu Glu Glu Ile Asp Gly Ala Val Ser Pro Gly Pro Ser Asp Ala
65 70 75 80
Pro Asp Gly Glu Tyr Gly Asp Leu Asp Ala Arg Thr Ala Val Arg Ala
85 90 95
Ala Ala Thr Glu Arg Asp Arg Phe Tyr Val Cys Pro Pro Pro Ser Gly
100 105 110
Ser Thr Val Val Arg Leu Glu Pro Glu Gln Ala Cys Pro Glu Tyr Ser
115 120 125
Gln Gly Arg Asn Phe Thr Glu Gly Ile Ala Val Leu Phe Lys Glu Asn
130 135 140
Ile Ala Pro His Lys Phe Lys Ala His Ile Tyr Tyr Lys Asn Val Ile
145 150 155 160
Val Thr Thr Val Trp Ser Gly Ser Thr Tyr Ala Ala Ile Thr Asn Arg
165 170 175
Phe Thr Asp Arg Val Pro Val Pro Val Gln Glu Ile Thr Asp Val Ile
180 185 190
Asp Arg Arg Gly Lys Cys Val Ser Lys Ala Glu Tyr Val Arg Asn Asn
195 200 205
His Lys Val Thr Ala Phe Asp Arg Asp Glu Asn Pro Val Glu Val Asp
210 215 220
Leu Arg Pro Ser Arg Leu Asn Ala Leu Gly Thr Arg Gly Trp His Thr
225 230 235 240
Thr Asn Asp Thr Tyr Thr Lys Ile Gly Ala Ala Gly Phe Tyr His Thr
245 250 255
Gly Thr Ser Val Asn Cys Ile Val Glu Glu Val Glu Ala Arg Ser Val
260 265 270
Tyr Pro Tyr Asp Ser Phe Ala Leu Ser Thr Gly Asp Ile Val Tyr Met
275 280 285
Ser Pro Phe Tyr Gly Leu Arg Glu Gly Ala His Gly Glu His Ile Gly
290 295 300
Tyr Ala Pro Gly Arg Phe Gln Gln Val Glu His Tyr Tyr Pro Ile Asp
305 310 315 320
Leu Asp Ser Arg Leu Arg Ala Ser Glu Ser Val Thr Arg Asn Phe Leu
325 330 335
Arg Thr Pro His Phe Thr Val Ala Trp Asp Trp Ala Pro Lys Thr Arg
340 345 350
Arg Val Cys Ser Leu Ala Lys Trp Arg Glu Ala Glu Glu Met Ile Arg
355 360 365
Asp Glu Thr Arg Asp Gly Ser Phe Arg Phe Thr Ser Arg Ala Leu Gly
370 375 380
Ala Ser Phe Val Ser Asp Val Thr Gln Leu Asp Leu Gln Arg Val His
385 390 395 400
Leu Gly Asp Cys Val Leu Arg Glu Ala Ser Glu Ala Ile Asp Ala Ile
405 410 415
Tyr Arg Arg Arg Tyr Asn Asn Thr His Val Leu Ala Gly Asp Lys Pro
420 425 430
Glu Val Tyr Leu Ala Arg Gly Gly Phe Val Val Ala Phe Arg Pro Leu
435 440 445
Ile Ser Asn Glu Leu Ala Gln Leu Tyr Ala Arg Glu Leu Glu Arg Leu
450 455 460
Gly Leu Ala Gly Val Val Gly Pro Ala Ser Pro Ala Ala Ala Arg Arg
465 470 475 480
Ala Arg Arg Ser Pro Gly Pro Ala Gly Thr Pro Glu Pro Pro Ala Val
485 490 495
Asn Gly Thr Gly His Leu Arg Ile Thr Thr Gly Ser Ala Glu Phe Ala
500 505 510
Arg Leu Gln Phe Thr Tyr Asp His Ile Gln Ala His Val Asn Asp Met
515 520 525
Leu Ser Arg Ile Ala Ala Ala Trp Cys Glu Leu Gln Asn Lys Asp Arg
530 535 540
Thr Leu Trp Gly Glu Met Ser Arg Leu Asn Pro Ser Ala Val Ala Thr
545 550 555 560
Ala Ala Leu Gly Gln Arg Val Ser Ala Arg Met Leu Gly Asp Val Met
565 570 575
Ala Ile Ser Arg Cys Val Glu Val Arg Gly Gly Val Tyr Val Gln Asn
580 585 590
Ser Met Arg Val Pro Gly Glu Arg Gly Thr Cys Tyr Ser Arg Pro Leu
595 600 605
Val Thr Phe Glu His Asn Gly Thr Gly Val Ile Glu Gly Gln Leu Gly
610 615 620
Asp Asp Asn Glu Leu Leu Ile Ser Arg Asp Leu Ile Glu Pro Cys Thr
625 630 635 640
Gly Asn His Arg Arg Tyr Phe Lys Leu Gly Gly Gly Tyr Val Tyr Tyr
645 650 655
Glu Asp Tyr Ser Tyr Val Arg Met Val Glu Val Pro Glu Thr Ile Ser
660 665 670
Thr Arg Val Thr Leu Asn Leu Thr Leu Leu Glu Asp Arg Glu Phe Leu
675 680 685
Pro Leu Glu Val Tyr Thr Arg Glu Glu Leu Ala Asp Thr Gly Leu Leu
690 695 700
Asp Tyr Ser Glu Ile Gln Arg Arg Asn Gln Leu His Ala Leu Lys Phe
705 710 715 720
Tyr Asp Ile Asp Arg Val Val Lys Val Asp His Asn Gly Ser Gly Ser
725 730 735
His His His His His His
740
<210> 19
<211> 2970
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
atgctactag taaatcagtc acaccaaggc ttcaataagg aacacacaag caagatggta 60
agcgctattg ttttatatgt gcttttggcg gcggcggcgc attctgcctt tgcggcggcc 120
gtgacgcggg ccgcctcggc ctcgcccgcg cccgggacgg gcgccacccc agacggcttc 180
tccgcggagg agtccctcga ggagatcgac ggggccgtct cccccggccc ctcggacgcc 240
cccgacggcg agtacggcga cctggacgcg cgcacggccg tgcgcgcggc cgcgaccgag 300
cgggaccgct tctacgtctg cccgccgccg tccggctcca cggtggtgcg cctggagccc 360
gagcaggcct gccccgagta ctcgcagggg cgcaacttca cggaggggat cgccgtgctc 420
ttcaaggaga acatcgcccc gcacaagttc aaggcccaca tctactacaa gaacgtcatc 480
gtcacgaccg tgtggtccgg gagcacgtac gcggccatca cgaaccgctt cacggaccgc 540
gtgcccgtcc ccgtgcagga gatcacggac gtgatcgacc gccgcggcaa gtgcgtctcc 600
aaggccgagt acgtgcgcaa caaccacaag gtgaccgcct tcgaccgcga cgagaacccc 660
gtcgaggtgg acctgcgccc ctcgcgcctg aacgcgctcg gcacccgcgg ctggcacacc 720
accaacgaca cctacaccaa gatcggcgcc gcgggcttct accacacggg cacctccgtc 780
aactgcatcg tcgaggaggt ggaggcgcgc tccgtgtacc cctacgactc cttcgccctg 840
tccacggggg acatcgtgta catgtccccc ttctacggcc tgcgcgaggg ggcccacggg 900
gagcacatcg gctacgcgcc cgggcgcttc cagcaggtgg agcactacta ccccatcgac 960
ctggactcgc gcctccgcgc ctccgagagc gtgacgcgca actttctgcg cacgccgcac 1020
ttcacggtgg cctgggactg ggcccccaag acgcggcgcg tgtgcagcct ggccaagtgg 1080
cgcgaggccg aggagatgat ccgcgacgag acgcgcgacg ggtccttccg cttcacgtcg 1140
cgggccctgg gcgcctcctt cgtcagcgac gtcacgcagc tcgacctgca gcgcgtgcac 1200
ctgggcgact gcgtcctccg cgaggcctcg gaggccatcg acgccatcta ccggcggcgc 1260
tacaacaaca cgcacgtgct ggccggcgac aagcccgagg tgtacctcgc ccgcgggggc 1320
ttcgtggtgg ccttccgccc gctgatctcg aacgagctgg cgcagctgta cgcgcgcgag 1380
ctcgagcgcc tcggcctcgc cggcgtcgtg ggccccgcgt cccccgcggc cgcccgtcgg 1440
gcccggcgct cccccggccc ggcggggacg cccgagccgc cggccgtcaa cggcacgggg 1500
cacctgcgca tcaccacggg ctcggccgag tttgcgcgcc tgcagttcac ctacgaccac 1560
atccaggcgc acgtgaacga catgctgagc cgcatcgcgg ccgcctggtg cgagctgcag 1620
aacaaggacc gcaccctgtg gggcgagatg tcgcgcctga accccagcgc cgtggccacg 1680
gccgcgctgg gccagcgcgt ctcggcgcgc atgctcggcg acgtgatggc catctcgcgg 1740
tgcgtggagg tgcgcggcgg cgtgtacgtg cagaactcca tgcgcgtgcc cggcgagcgc 1800
ggcacgtgct acagccgccc gctggtgacc ttcgagcaca acggcacggg cgtgatcgag 1860
ggccagctcg gcgacgacaa cgagctcctc atctcgcgcg acctcatcga gccctgcacc 1920
ggcaaccacc ggcgctactt taagctgggc ggcgggtacg tgtactacga ggactacagc 1980
tacgtgcgca tggtggaggt gcccgagacg atcagcacgc gggtgaccct gaacctgacg 2040
ctgctcgagg accgcgagtt cctgcccctc gaggtgtaca cgcgcgagga gctcgccgac 2100
acgggcctcc tggactacag cgagatccag cgccgcaacc agctgcacgc gctcaagttc 2160
tacgacattg accgcgtggt caaggtggac cacaacggat caggcggggg tgggtccgga 2220
ggaggtggct cgggatctga gcccagaggg cccacaatca agccctgtcc tccatgcaaa 2280
tgcccagcac ctaacctctt gggtggacca tccgtcttca tcttccctcc aaagatcaag 2340
gatgtactca tgatctccct gagccccata gtcacatgtg tggtggtgga tgtgagcgag 2400
gatgacccag atgtccagat cagctggttt gtgaacaacg tggaagtaca cacagctcag 2460
acacaaaccc atagagagga ttacaacagt actctccggg tggtcagtgc cctccccatc 2520
cagcaccagg actggatgag tggcaaggag ttcaaatgca aggtcaacaa caaagacctg 2580
ccagcgccca tcgagagaac catctcaaaa cccaaagggt cagtaagagc tccacaggta 2640
tatgtcttgc ctccaccaga agaagagatg actaagaaac aggtcactct gacctgcatg 2700
gtcacagact tcatgcctga agacatttac gtggagtgga ccaacaacgg gaaaacagag 2760
ctaaactaca agaacactga accagtcctg gactctgatg gttcttactt catgtacagc 2820
aagctgagag tggaaaagaa gaactgggtg gaaagaaata gctactcctg ttcagtggtc 2880
cacgagggtc tgcacaatca ccacacgact aagagcttct cccggactcc gggtaaagga 2940
tcgggctctc atcaccatca ccatcactag 2970
<210> 20
<211> 989
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 20
Met Leu Leu Val Asn Gln Ser His Gln Gly Phe Asn Lys Glu His Thr
1 5 10 15
Ser Lys Met Val Ser Ala Ile Val Leu Tyr Val Leu Leu Ala Ala Ala
20 25 30
Ala His Ser Ala Phe Ala Ala Ala Val Thr Arg Ala Ala Ser Ala Ser
35 40 45
Pro Ala Pro Gly Thr Gly Ala Thr Pro Asp Gly Phe Ser Ala Glu Glu
50 55 60
Ser Leu Glu Glu Ile Asp Gly Ala Val Ser Pro Gly Pro Ser Asp Ala
65 70 75 80
Pro Asp Gly Glu Tyr Gly Asp Leu Asp Ala Arg Thr Ala Val Arg Ala
85 90 95
Ala Ala Thr Glu Arg Asp Arg Phe Tyr Val Cys Pro Pro Pro Ser Gly
100 105 110
Ser Thr Val Val Arg Leu Glu Pro Glu Gln Ala Cys Pro Glu Tyr Ser
115 120 125
Gln Gly Arg Asn Phe Thr Glu Gly Ile Ala Val Leu Phe Lys Glu Asn
130 135 140
Ile Ala Pro His Lys Phe Lys Ala His Ile Tyr Tyr Lys Asn Val Ile
145 150 155 160
Val Thr Thr Val Trp Ser Gly Ser Thr Tyr Ala Ala Ile Thr Asn Arg
165 170 175
Phe Thr Asp Arg Val Pro Val Pro Val Gln Glu Ile Thr Asp Val Ile
180 185 190
Asp Arg Arg Gly Lys Cys Val Ser Lys Ala Glu Tyr Val Arg Asn Asn
195 200 205
His Lys Val Thr Ala Phe Asp Arg Asp Glu Asn Pro Val Glu Val Asp
210 215 220
Leu Arg Pro Ser Arg Leu Asn Ala Leu Gly Thr Arg Gly Trp His Thr
225 230 235 240
Thr Asn Asp Thr Tyr Thr Lys Ile Gly Ala Ala Gly Phe Tyr His Thr
245 250 255
Gly Thr Ser Val Asn Cys Ile Val Glu Glu Val Glu Ala Arg Ser Val
260 265 270
Tyr Pro Tyr Asp Ser Phe Ala Leu Ser Thr Gly Asp Ile Val Tyr Met
275 280 285
Ser Pro Phe Tyr Gly Leu Arg Glu Gly Ala His Gly Glu His Ile Gly
290 295 300
Tyr Ala Pro Gly Arg Phe Gln Gln Val Glu His Tyr Tyr Pro Ile Asp
305 310 315 320
Leu Asp Ser Arg Leu Arg Ala Ser Glu Ser Val Thr Arg Asn Phe Leu
325 330 335
Arg Thr Pro His Phe Thr Val Ala Trp Asp Trp Ala Pro Lys Thr Arg
340 345 350
Arg Val Cys Ser Leu Ala Lys Trp Arg Glu Ala Glu Glu Met Ile Arg
355 360 365
Asp Glu Thr Arg Asp Gly Ser Phe Arg Phe Thr Ser Arg Ala Leu Gly
370 375 380
Ala Ser Phe Val Ser Asp Val Thr Gln Leu Asp Leu Gln Arg Val His
385 390 395 400
Leu Gly Asp Cys Val Leu Arg Glu Ala Ser Glu Ala Ile Asp Ala Ile
405 410 415
Tyr Arg Arg Arg Tyr Asn Asn Thr His Val Leu Ala Gly Asp Lys Pro
420 425 430
Glu Val Tyr Leu Ala Arg Gly Gly Phe Val Val Ala Phe Arg Pro Leu
435 440 445
Ile Ser Asn Glu Leu Ala Gln Leu Tyr Ala Arg Glu Leu Glu Arg Leu
450 455 460
Gly Leu Ala Gly Val Val Gly Pro Ala Ser Pro Ala Ala Ala Arg Arg
465 470 475 480
Ala Arg Arg Ser Pro Gly Pro Ala Gly Thr Pro Glu Pro Pro Ala Val
485 490 495
Asn Gly Thr Gly His Leu Arg Ile Thr Thr Gly Ser Ala Glu Phe Ala
500 505 510
Arg Leu Gln Phe Thr Tyr Asp His Ile Gln Ala His Val Asn Asp Met
515 520 525
Leu Ser Arg Ile Ala Ala Ala Trp Cys Glu Leu Gln Asn Lys Asp Arg
530 535 540
Thr Leu Trp Gly Glu Met Ser Arg Leu Asn Pro Ser Ala Val Ala Thr
545 550 555 560
Ala Ala Leu Gly Gln Arg Val Ser Ala Arg Met Leu Gly Asp Val Met
565 570 575
Ala Ile Ser Arg Cys Val Glu Val Arg Gly Gly Val Tyr Val Gln Asn
580 585 590
Ser Met Arg Val Pro Gly Glu Arg Gly Thr Cys Tyr Ser Arg Pro Leu
595 600 605
Val Thr Phe Glu His Asn Gly Thr Gly Val Ile Glu Gly Gln Leu Gly
610 615 620
Asp Asp Asn Glu Leu Leu Ile Ser Arg Asp Leu Ile Glu Pro Cys Thr
625 630 635 640
Gly Asn His Arg Arg Tyr Phe Lys Leu Gly Gly Gly Tyr Val Tyr Tyr
645 650 655
Glu Asp Tyr Ser Tyr Val Arg Met Val Glu Val Pro Glu Thr Ile Ser
660 665 670
Thr Arg Val Thr Leu Asn Leu Thr Leu Leu Glu Asp Arg Glu Phe Leu
675 680 685
Pro Leu Glu Val Tyr Thr Arg Glu Glu Leu Ala Asp Thr Gly Leu Leu
690 695 700
Asp Tyr Ser Glu Ile Gln Arg Arg Asn Gln Leu His Ala Leu Lys Phe
705 710 715 720
Tyr Asp Ile Asp Arg Val Val Lys Val Asp His Asn Gly Ser Gly Gly
725 730 735
Gly Gly Ser Gly Gly Gly Gly Ser Gly Ser Glu Pro Arg Gly Pro Thr
740 745 750
Ile Lys Pro Cys Pro Pro Cys Lys Cys Pro Ala Pro Asn Leu Leu Gly
755 760 765
Gly Pro Ser Val Phe Ile Phe Pro Pro Lys Ile Lys Asp Val Leu Met
770 775 780
Ile Ser Leu Ser Pro Ile Val Thr Cys Val Val Val Asp Val Ser Glu
785 790 795 800
Asp Asp Pro Asp Val Gln Ile Ser Trp Phe Val Asn Asn Val Glu Val
805 810 815
His Thr Ala Gln Thr Gln Thr His Arg Glu Asp Tyr Asn Ser Thr Leu
820 825 830
Arg Val Val Ser Ala Leu Pro Ile Gln His Gln Asp Trp Met Ser Gly
835 840 845
Lys Glu Phe Lys Cys Lys Val Asn Asn Lys Asp Leu Pro Ala Pro Ile
850 855 860
Glu Arg Thr Ile Ser Lys Pro Lys Gly Ser Val Arg Ala Pro Gln Val
865 870 875 880
Tyr Val Leu Pro Pro Pro Glu Glu Glu Met Thr Lys Lys Gln Val Thr
885 890 895
Leu Thr Cys Met Val Thr Asp Phe Met Pro Glu Asp Ile Tyr Val Glu
900 905 910
Trp Thr Asn Asn Gly Lys Thr Glu Leu Asn Tyr Lys Asn Thr Glu Pro
915 920 925
Val Leu Asp Ser Asp Gly Ser Tyr Phe Met Tyr Ser Lys Leu Arg Val
930 935 940
Glu Lys Lys Asn Trp Val Glu Arg Asn Ser Tyr Ser Cys Ser Val Val
945 950 955 960
His Glu Gly Leu His Asn His His Thr Thr Lys Ser Phe Ser Arg Thr
965 970 975
Pro Gly Lys Gly Ser Gly Ser His His His His His His
980 985
<210> 21
<211> 32
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
gcggccgtga cgcgggccgc ctcggcctcg cc 32
<210> 22
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
gttgtggtcc accttgacca cgcggtcaat g 31

Claims (5)

1. The recombinant baculovirus transfer vector containing the porcine pseudorabies virus gB-IgGFc fusion protein gene is characterized in that GP67 signal peptide-gB-IgGFc fusion protein-His label is taken as an exogenous gene and is respectively inserted into a restriction enzyme cutting site between BamHI and EcoRI and a restriction enzyme cutting site between XbaI and HindIII of the baculovirus transfer vector; the nucleotide sequence of the gB-IgGFc fusion protein is obtained by connecting a gene of gB protein with a coding sequence of IgGFc protein, wherein the gene of gB protein is deleted from a C-end transmembrane region segment; the nucleotide sequence of the gene of the gB protein with the coding C-terminal transmembrane region fragment deleted is shown as SEQ ID No. 1; the nucleotide sequence of the IgGFc protein coding sequence is shown as SEQ ID No. 2.
2. A recombinant baculovirus expressing porcine pseudorabies virus gB-IgGFc fusion protein, which is obtained by transfecting the recombinant baculovirus transfer vector of claim 1 into an insect cell, culturing until the cell is diseased, and collecting supernatant.
3. Use of the recombinant baculovirus transfer vector of claim 1 or the recombinant baculovirus of claim 2 for the production of a vaccine for porcine pseudorabies.
4. A subunit vaccine for preventing and treating porcine pseudorabies, which comprises an adjuvant and the gB-IgGFc fusion protein expressed by the recombinant baculovirus of claim 2.
5. The subunit vaccine of claim 4, wherein the gB-IgGFc fusion protein is present at a concentration of 200 μ g/ml.
CN201910354221.1A 2019-04-29 2019-04-29 Recombinant baculovirus transfer vector containing porcine pseudorabies virus gB protein gene, recombinant baculovirus, preparation method and application Active CN110066827B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910354221.1A CN110066827B (en) 2019-04-29 2019-04-29 Recombinant baculovirus transfer vector containing porcine pseudorabies virus gB protein gene, recombinant baculovirus, preparation method and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910354221.1A CN110066827B (en) 2019-04-29 2019-04-29 Recombinant baculovirus transfer vector containing porcine pseudorabies virus gB protein gene, recombinant baculovirus, preparation method and application

Publications (2)

Publication Number Publication Date
CN110066827A CN110066827A (en) 2019-07-30
CN110066827B true CN110066827B (en) 2020-12-15

Family

ID=67369458

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910354221.1A Active CN110066827B (en) 2019-04-29 2019-04-29 Recombinant baculovirus transfer vector containing porcine pseudorabies virus gB protein gene, recombinant baculovirus, preparation method and application

Country Status (1)

Country Link
CN (1) CN110066827B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114908056B (en) * 2022-05-18 2024-04-16 华中农业大学 Recombinant CHO cell line expressing pig PRV gDFc or gBFc fusion protein and construction method and application thereof

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104248757B (en) * 2014-09-30 2017-10-27 普莱柯生物工程股份有限公司 Porcine pseudorabies virus vaccine combination and its preparation method and application
CA2985227C (en) * 2015-05-15 2021-05-04 Reber Genetics Co., Ltd. Novel baculovirus vectors and methods of use
CN106267182B (en) * 2015-06-29 2020-02-07 普莱柯生物工程股份有限公司 Preparation method of porcine pseudorabies virus subunit vaccine, vaccine composition and application

Also Published As

Publication number Publication date
CN110066827A (en) 2019-07-30

Similar Documents

Publication Publication Date Title
CN109943592B (en) Recombinant baculovirus transfer vector containing porcine pseudorabies virus gD protein gene, recombinant baculovirus, preparation method and application
CN110317278B (en) Fusion protein of SVV and FMDV, encoding gene, expression vector, cell line, engineering bacterium, vaccine and application thereof
CN113058032B (en) Classical swine fever, porcine pseudorabies and porcine circovirus type 2 triple subunit vaccine and preparation method and application thereof
KR20190110605A (en) Swine Coronavirus Vaccine
KR20220031028A (en) African Swine Fever Vaccine
US20230285535A1 (en) Recombinant Pseudorabies Virus and Vaccine Composition thereof
CN110327461B (en) Preparation method and application of porcine pseudorabies virus subunit vaccine
CN110279855A (en) Pig Senecan virus novel gene engineered vaccine, preparation method and application
CN110124023B (en) Novel genetic engineering subunit vaccine of goose astrovirus virus-like particles
CN111349179B (en) Avian reovirus genetic engineering vaccine
CN111558037A (en) Bivalent subunit vaccine and preparation method and application thereof
CN110256539A (en) O-shaped foot and mouth disease virus novel gene engineering subunit vaccine
CN110981968B (en) Fusion protein containing rabies virus G protein, preparation method, application and vaccine thereof
CN104628865B (en) A kind of pseudo- mad dog epitope polypeptide recombinant vaccine
CN109021115B (en) Porcine circovirus trivalent subunit vaccine
CN114507272A (en) Bovine akabane virus vaccine
CN110066827B (en) Recombinant baculovirus transfer vector containing porcine pseudorabies virus gB protein gene, recombinant baculovirus, preparation method and application
CN111978411B (en) Porcine reproductive and respiratory syndrome subunit vaccine and preparation method and application thereof
CN109999191B (en) Novel genetic engineering subunit vaccine of mycoplasma gallisepticum
CN115427071A (en) Compositions comprising LTB and pathogenic antigens and uses thereof
CN110237244B (en) Duck tembusu virus genetic engineering subunit vaccine and preparation method and application thereof
CN111093698B (en) Paramyxoviridae expression systems
CN114134165B (en) Novel HPV therapeutic nucleic acid vaccine
CN113943376B (en) Fusion gene, encoding protein thereof and application thereof in resisting African swine fever
CN109295014B (en) Atypical classical swine fever virus E2 protein recombinant baculovirus and preparation method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant