CN104248757B - Porcine pseudorabies virus vaccine combination and its preparation method and application - Google Patents
Porcine pseudorabies virus vaccine combination and its preparation method and application Download PDFInfo
- Publication number
- CN104248757B CN104248757B CN201410519314.2A CN201410519314A CN104248757B CN 104248757 B CN104248757 B CN 104248757B CN 201410519314 A CN201410519314 A CN 201410519314A CN 104248757 B CN104248757 B CN 104248757B
- Authority
- CN
- China
- Prior art keywords
- vaccine
- vaccine combination
- prv
- porcine pseudorabies
- pseudorabies virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a kind of porcine pseudorabies virus vaccine combination, the porcine pseudorabies virus vaccine combination subunit antigen containing porcine pseudorabies virus, or contain recombinant Newcastle disease virus porcine pseudorabies virus carrier.Present invention also offers the preparation method and application of the vaccine combination.The vaccine combination can effectively prevent the relevant disease of porcine pseudorabies virus relevant disease and the infection caused by porcine pseudorabies virus.The combination of immunogenic antigens can induce the immune effect for producing collaboration in PRV vaccine combination of the present invention, and not only immune effect is good, further reduces immune usage amount, reduces immune cost.
Description
Technical field
The invention belongs to veterinary biologics field, vaccine combination and its preparation more particularly to PRV
Method, and the immunizing antigen is used to prepare prevention and/or treated with PRV relevant disease and mad by pig puppet
The application of the composition of infection caused by dog disease poison.
Background technology
Pseudoabies, also known as AujeszkyShi disease, are by the pig blister in herpetoviridae (Herpesviridae) α subfamilies
A variety of domestic animals, poultry and the wild animals such as pig, ox, sheep caused by the type of exanthema virus I (Suid herpesvirus 1strain)
It is a kind of to generate heat, very itch (in addition to pig) and encephalomyelitis as primary symptom acute infectious disease.The pseudoabies of pig is extensive in China
In the presence of harm is serious, is to restrict one of main epidemic disease of large-scale pig farm production.It can cause in-pig miscarriage, stillborn foetus or
There is nervous symptoms, paralysis in mummy tire and piglet, and the death rate is high.PRV has stronger pantropic, neurotropism and latent sense
Contaminate characteristic, peripheral neverous system can latent infection for a long time, become infectious virus when latent virus is activated, dived
The host of volt infection will fall ill.
Pig PRV only one of which serotypes, it is generally recognized that the cross-protection of strain is very strong, but still suffers from piggy injection at present
Typical porcine pseudorabies occur after commercialized vaccine, such as long-time body temperature is raised, spiritual depressed, anorexia is breathed
Road and/or nervous symptoms.Outstanding behaviours can all be infected for the pig at any age, can be in swinery horizontal transmission, and incubation period is short by (1~2
My god), the incidence of disease is between 10%~100%, and (the piglet death rate may be up to the morbid pig death rate between 10%~100%
100%) pig hyperpyrexia (40~42 DEG C, continue more than 3 days), can be caused after infection, had difficulty in breathing, diarrhoea is breathed heavily, and is coughed, is played spray
Sneeze, hindlimb paralysis, dog sits, and falls down to the ground suddenly, twitch, can not lie on one's side, opisthotonos, swimming shape is struck, and is finally died of exhaustion, and can draw
Play herd boar semen quality to decline, farrowing sow miscarriage (up to 35%), premature labor, stillborn foetus is weak young (all dead before weak young 14 age in days
Die) etc. breeding difficulty symptom.It can not be attacked after the vaccine immunity pig of prior art fully against wild poison, height still occurs
Heat, spirit is depressed, loss of appetite or the useless symptom such as absolutely, infection rate more than 80%, the incidence of disease more than 30%, the death rate 10%~
Between 20%.The also no vaccine of prior art can solve the problem that for pseudoabies caused by pseudorabies variant.
First passage of the present invention uses PRV gB albumen with gD protein combinations, for pseudorabies variant
Caused pseudoabies has preferable protective effect, by immune efficacy comparative test, have been surprisingly found that, two kinds of protein combinations
Use, collaboration stimulates organism immune response, effectively reduces immunizing dose, greatly reduces immune cost.
The content of the invention
It is an object of the invention to overcome prior art defect, there is provided one kind prevention and/or treatment PRV sense
The vaccine combination of dye, the vaccine combination includes two kinds of PRV immune protective antigens and adjuvant.The present invention is carried
Two kinds of PRV immunizing antigens that the vaccine combination of the prevention of confession and/or treatment PRV infection is included are
GB albumen and gD albumen.
The first aspect of the present invention is a kind of porcine pseudorabies virus vaccine combination, and described vaccine combination includes exempting from
GB albumen, gD albumen and the adjuvant of epidemic disease amount.
It is used as a kind of preferred embodiment of the present invention, in the vaccine combination of the present invention, described gB proteins
Sequence is SEQ ID NO.3；Described gD proteins sequence is SEQ ID NO.4.
Preferably, the prevention that the present invention is provided and/or the pig that the vaccine combination for the treatment of PRV infection is included
Pseudorabies virus immunizing antigen gB protein amino acid sequences such as SEQ ID NO：Shown in 3.
Preferably, the prevention that the present invention is provided and/or the pig that the vaccine combination for the treatment of PRV infection is included
Pseudorabies virus immunizing antigen gB protein nucleotide sequences such as SEQ ID NO：Shown in 1.
Preferably, the prevention that the present invention is provided and/or the pig that the vaccine combination for the treatment of PRV infection is included
Pseudorabies virus immunizing antigen gD protein amino acid sequences such as SEQ ID NO：Shown in 4.
Preferably, the prevention that the present invention is provided and/or the pig that the vaccine combination for the treatment of PRV infection is included
Pseudorabies virus immunizing antigen gD protein nucleotide sequences such as SEQ ID NO：Shown in 2.
Term " gB albumen " is also known as " gB glycoprotein ",
Term " gD albumen " is also known as " gD glycoprotein ", is that porcine pseudorabies virus carries out infecting required structural proteins, is
One of ripe primary glycoproteins on virion cyst membrane surface, also referred to as " gp50 albumen ".
The prevention that the present invention is provided and/or the porcine pseudorabies that the vaccine combination for the treatment of PRV infection is included
Malicious immunizing antigen gB albumen, gD albumen can also be the polypeptide of the amino acid sequence essentially identical with its functional derivative.
Term " adjuvant ", which refers to, to be added in the composition of the present invention with the material for the immunogenicity for increasing composition.It is known
Adjuvant includes, but are not limited to：Oily adjuvant, water-soluble adjuvant, Alum adjuvant, Cytokine adjuvant.
Term used herein " oily adjuvant " is also known as " oil adjuvant " or " oil emulsion adjuvant ", is by including vegetable oil, animal
One or more of compositions in oil, mineral oil, for delaying RT of the immunogene in body, are allowed to continue slowly to release
Put, strengthen phagocytosis and the sterilizing ability of macrophage.
Term used herein " water-soluble adjuvant " is also known as " water-based adjuvant " or " water adjuvant ", is a kind of polymeric water-soluble
Dispersion, effect and security for improving water-soluble vaccines can be by high molecular weight polypropylene acids synthetic polymer groups
Into.
Term used herein " Alum adjuvant ", also known as " aluminium glue adjuvant " or " aluminium adjuvant ", including aluminum hydroxide adjuvant and
Aluminium phosphate adjuvant, its major function is sustained release, but has the activation to immunocyte simultaneously.By antigen and aluminium hydroxide or
Aluminum phosphate hybrid injection, can make antigen be stored in injection site, with antigen sustained release and nonspecific immunity stimulation.
Term used herein " Cytokine adjuvant ", including IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7,
IL-10, IL-12, IL-15, IL-18, INF- γ, GM-CSF, TNF-α, TNF-β, TCA-3 etc., also known as " cell factor " or " thin
Born of the same parents' element ", is that the secretion of live body host cell by diffusion, cell contact or blood circulation reaches other cells of host, in body
A class non-immunoglobulin, local native protein or the glycoprotein played a role in liquid with extremely low concentration is also a class by body
The immunocyte of activation and some nonimmune cells are produced, secretion, can adjust cell growth, differentiation, with hematopoiesis, inflammatory reaction,
The general designation of the closely related high activity multi-functional small molecules albumen such as immune response and wound healing, can stimulate or suppress
Immunologic function, promotes cell development differentiation, regulation cell physiological function and cell-tocell transmission, immune in immune response
Very important regulating and controlling effect is played in system.
A kind of 206 adjuvant in oily adjuvant has been used in the embodiment of the present invention.
Amount suitable for the adjuvant of the composition of the present invention is preferably effective dose." effective dose " refers to adjuvant same
Played in host during antigen combined administration of the invention for their immunological role must or it is enough excessive without causing
Side effect institute necessary amounts.The accurate amount of adjuvant to be administered is by the class according to factor such as composition used and the disease for the treatment of
Type, the type of animal to be treated and age, the mode of administration, and other compositions in composition and change.
In one embodiment, the present invention provides a kind of vaccine group treated and/or prevent PRV infection
Compound, is made up of PRV immunizing antigen gB albumen, gD albumen and 206 adjuvants.
It is used as a kind of preferred embodiment of the present invention, in the vaccine combination of the present invention, described gB protein contents
For 25-100 μ g/ml；GD protein contents are 25-100 μ g/ml.
As a kind of most preferred embodiment of the present invention, in the vaccine combination of the present invention, described gB albumen contains
Measure as 50 μ g/ml；GD protein contents are 50 μ g/ml.
The composition of composition or the amount of component of the present invention is preferably therapeutically effective amount.The therapeutically effective amount refers to
Their immunological role is played without causing excessive side effect institute necessary amounts in the host that composition is applied.Composition used and
The accurate amount of composition to be administered is by according to factor such as the type of disease treated, the type of animal to be treated and year
Age, the mode of administration, and other compositions in composition and change.
For animal pig, vaccine combination gB proteantigens effective dose of the present invention is 25-100 μ g/ml；
GD proteantigens effective dose is 25-100 μ g/ml.
It is highly preferred that the vaccine combination gB proteantigens effective dose is 50 μ g/ml；GD proteantigens effective dose is 50
μg/ml。
Another aspect of the present invention is a kind of porcine pseudorabies virus vaccine combination, and described vaccine combination includes weight
Group NDV-porcine pseudorabies virus carrier and adjuvant.
It is used as a kind of preferred embodiment of the present invention, in the vaccine combination of the present invention, described recombinant Newcastle disease
Virus-porcine pseudorabies virus carrier includes one or more heterologous polynucleotides, and it encodes one or more porcine pseudorabies
Viral antigen, polypeptide or its variant, wherein, described porcine pseudorabies virus antigen includes gB albumen, gD albumen.
Term " functional derivative " refers to the functional biological work substantially similar with the bioactivity of intact proteins/peptide sequence
Albumen/peptide sequence of property.In other words, it refers preferably to, when the functional derivative is applied into animal, substantially remain
Immune response is excited, the polypeptide or its fragment of the ability for the aversion response such as attacked for porcine pseudorabies strain.
Term " fragment " refers to such polynucleotide sequence, its be artificial constructed (such as by chemical synthesis) or by will
Natural products is cracked into the separation of the nucleic acid of the present invention of multiple small fragments (using restriction enzyme, or mechanical shearing) structure
Part, or the nucleic acid synthesized by PCR, archaeal dna polymerase or any other polymerization technique well known in the art part, or pass through
Well known to a person skilled in the art the nucleic acid moiety that recombinant nucleic acid technology is expressed in host cell.
As being commonly understood by and using herein, " functional fragment " refers to the basic phase of bioactivity of coding and complete nucleic-acid sequences
As functional biological activity nucleotide sequence.In other words, in the context of the present invention, it refers preferably to substantially remain volume
The nucleic acid or its fragment of the such polypeptides/proteins ability of code, the polypeptides/proteins are excited and are directed to when being applied to animal
The immune response of PRV attack, and more preferably aversion response.
When referring to amino acid sequence, the polypeptide that " substantially the same " can be understood as the present invention preferably has such ammonia
Base acid sequence, itself and SEQ ID NO：The part or all of of sequence shown in 3-4 has at least 70% homology, or even excellent
The homology of selection of land 80%, or even more preferably still 90% homology, or most preferably 95% homology.
Term " homology " herein is also including same or like with reference sequence, while providing the letter of any amino acid
Single replacement/modification.BLAST-P (basic part parallelism gopher) can be used, well known to a person skilled in the art program progress
The homology search of this aspect.For corresponding nucleotide sequence, homology be related to the BLASTX that is known in the art and
BLASTN programs.
It is used as a kind of preferred embodiment of the present invention, in the vaccine combination of the present invention, described porcine pseudorabies
Viral antigen gB albumen is the porcine pseudorabies virus gB albumen that sequence SEQ ID NO.3 are encoded, the porcine pseudorabies virus stated
Antigen gD albumen is the gD albumen that sequence SEQ ID NO.4 are encoded.
" carrier " means recombinant DNA or RNA plasmids, bacteriophage or virus, and it includes and delivered in vivo or in vitro
To the heterologous polynucleotide of target cell.The purpose that heterologous polynucleotide can prevent or treat comprising aim sequence, it is optional
Ground, it is the form of expression cassette.Carrier be able to need not be replicated in final target cell or subject.Term " carrier " includes
For cloning vector, also including viral vector.
As a kind of preferred embodiment of the present invention, the vaccine combination described in the vaccine combination of the present invention,
Characterized in that, described NDV is low virulent strain, it is preferable that institute's NDV is Sota plants of NDV La.
Sota plants of NDV La is purchased from China Veterinery Drug Inspection Office.
Another aspect of the present invention is a kind of method for preparing the vaccine combination, and described method includes：1) prepare
The step of gB albumen and gD proteantigens；And 2) hybrid antigen in proportion, add the step of adjuvant, emulsification.
Treated and/or prevention PRV relevant disease or infection it is a further object to provide a kind of
The preparation method of vaccine combination, including：
(1) gB albumen and gD proteantigens are prepared；
(2) hybrid antigen in proportion, adds adjuvant, emulsification.
The preparation of antigen can be carried out by a variety of methods well known by persons skilled in the art, including genetic engineering means,
For example pass through the clone comprising polynucleotides of the present invention or expression vector.Term " carrier ", which is related to, is designed to transduction/transfection
The polynucleotide constructs of one or more cell types.Carrier can be, such as " cloning vector ", and it is designed to point
From, propagation and replicate insertion nucleotides；" expression vector ", it is designed in host cell express nucleotide sequence；
Or " viral vector ", it is designed to production recombinant virus or virus-like particle；Or " shuttle vector ", it includes more than one
The property of the carrier of type.Being adapted to prepare the publicly available carrier of PRV antigen of the present invention includes plasmid, gland
Virus, baculoviral, yeast baculoviral, plant virus, adeno-associated virus, retroviruse, herpes simplex virus, α virus,
Slow virus etc., can also obtain the method for building such carrier.The preparation of PRV antigen of the present invention also includes logical
Artificial synthesized mode is crossed to realize.
Another aspect of the present invention is a kind of method for preparing the vaccine combination, it is characterised in that described method
Including：1) the step of recombinating the newcastle disease virus gene group full-length cDNA carrier；2) recombinantly express the Newcastle disease virus NP,
The step of P, L expression vector；3) the porcine pseudorabies virus antigen gene is recombinantly expressed to the NDV base
The step of because of group full-length cDNA recombinant vector；And 4) by the NDV of the expression porcine pseudorabies virus antigen
Genomic full_length cDNA recombinant vector and the expression Newcastle disease virus NP, the common transfectional cell of P, L gene recombined vector, are carried out
Virus is shaken the step of rescuing.
It is used as a kind of preferred embodiment of the present invention, in the vaccine combination preparation method of the present invention, transfectional cell
For bhk cell.Also other cell line cells well known in the art for cultivating NDV be can select.
Another aspect of the present invention is that described vaccine combination is preparing prevention and/or treatment porcine pseudorabies virus phase
Related disorders or by the application in the medicine infected caused by porcine pseudorabies virus.
It is another object of the present invention to provide include PRV immunizing antigen gB albumen, gD albumen or its work(
The polypeptide of the essentially identical amino acid sequence of energy derivative is for preventing and/or treating PRV relevant disease or sense
Application in the composition and/or method of dye.
Term " prevention ", which refers to, to be suppressed pseudorabies infection by the vaccine combination given according to the present invention or postpones disease
All behaviors of breaking-out.Term " treatment " refers to infects porcine pseudorabies virus by giving according to the vaccine combination of the present invention
Caused symptom mitigation or all behaviors taken a turn for the better.
Term " aversion response " is meant prevents PRV relevant disease or by PRV in animal
The breaking-out of caused infection or the seriousness for mitigating the such disease existed.
PRV polypeptide of the present invention, it advantageously excites the aversion response in animal.Specifically, originally
Invent the polypeptide being related to and include the amino acid sequence essentially identical with its functional derivative.
Treatment and/or prevention PRV are being prepared it is a further object to provide a kind of vaccine combination
The application of relevant disease or the medicine of infection.
Term " porcine pseudorabies virus relevant disease " used herein is used to refer to caused by PRV infection
Disease.Its example include morbidity piglet show obvious nervous symptoms, lethargic sleep, toot cry, vomit, having loose bowels, body temperature rise, one
Denier is fallen ill, and farrowing sow can miscarry, produce mummy fetus or stillborn foetus or breeding difficulty, but not limited to this.
Term " porcine pseudorabies virus relevant disease " used herein can be further used for finger and show as any age
Pig can all infect, can be in swinery horizontal transmission, incubation period is short (1~2 day), and the incidence of disease is between 10%~100%, morbid pig
The death rate (the piglet death rate may be up to 100%) between 10%~100%, can cause after infection pig hyperpyrexia (40~42 DEG C,
Continue more than 3 days), have difficulty in breathing, diarrhoea is breathed heavily, and is coughed, is sneezed, and hindlimb paralysis, dog sits, and falls down to the ground suddenly, is twitched, is lain on one's side not
Rise, opisthotonos, swimming shape is struck, and is finally died of exhaustion, and herd boar semen quality can be caused to decline, farrowing sow miscarriage is (high
Up to 35%), premature labor, stillborn foetus, the breeding difficulty symptom such as weak young (all dead before weak young 14 age in days), but not limited to this.Above-mentioned disease
The symptom difference that shape is produced with having infected in the prior art after common porcine pseudorabies virus is：Infection can be caused after having infected
Adult Pig (body weight is in more than 50kg pigs) can cause pig hyperpyrexia (40~42 DEG C, continue more than 3 days) afterwards, have difficulty in breathing, diarrhoea,
Breathe heavily, cough, sneeze, hindlimb paralysis, dog sits, and falls down to the ground suddenly, twitch, can not lie on one's side, opisthotonos, swimming shape is struck, and is finally declined
Exhaust and dead；Piglet sudden onset within newborn and 4 week old, occurs large quantities of death, and the death rate is up to more than 90%；Fall ill piglet master
Show as body temperature to rise up to more than 41 DEG C, appetite is useless exhausted, with obvious nervous symptoms and diarrhoea；Pre-and Post-Weaning Piglets are main
For Respiratory symptoms, performance expiratory dyspnea, cough, rhinorrhea etc..
The present invention has the advantages that following prominent：
(1) vaccine combination of the present invention can pass through the component of genetic engineering means or artificial synthesized means to vaccine combination
A large amount of synthesis expression are carried out, it is not only time-consuming short, it can also be easy to large-scale production；
(2) combination of many immunogenic antigens can induce and produce collaboration in PRV vaccine combination of the present invention
Immune effect, not only immune effect is good, further reduces immune usage amount, reduces immune cost；
(3) infection that vaccine combination of the present invention can effectively protect pig to resist PRV is finished there is provided one
The approach of kind prevention and/or treatment PRV infection, it is to avoid traditional live vaccine virulence returns the hair of strong and scattered malicious risk
It is raw, there is positive realistic meaning for purification PRV.
Brief description of the drawings
Fig. 1 is gB gene PCR amplified production electrophoresis results, and each swimming lane is respectively from left to right：Marker DL5000、gB
Gene PCR amplified production, extracting negative control pcr amplification product, PCR negative controls；
Fig. 2 is gD gene PCR amplified production electrophoresis results, and each swimming lane is respectively from left to right：Marker DL5000, take out
Carry negative control pcr amplification product；3：PCR negative controls；4：GD gene PCR amplified productions；
Fig. 3 is pFastBac/HBM-TOPO-gB digestion qualification results, and each swimming lane is respectively from left to right：Marker
DL5000；2-5 swimming lanes：PFastBac/HBM-TOPO-gB Mlu I and the digestion qualification results of Hind III；
Fig. 4 is pFastBac/HBM-TOPO-gD digestion qualification results, and each swimming lane is respectively from left to right：Marker
DL5000；2-4 swimming lanes：PFastBac/HBM-TOPO-gD Mlu I and the digestion qualification results of Hind III；
Fig. 5 is Bacmid-gB and Bacmid-gD PCR qualification results, and each swimming lane is respectively from left to right：Marker
DL5000, Bacmid-gB PCR identifications, Bacmid-gD PCR identifications, Bacmid PCR negative controls；
Fig. 6 is that vNDV-PRV-gB-gD builds schematic diagram.
In sequence table：
Sequence 1 is the nucleotide sequence of HN1201 plants of gB albumen of PRV；
Sequence 2 is the nucleotide sequence of HN1201 plants of gD albumen of PRV；
Sequence 3 is the amino acid sequence of HN1201 plants of gB albumen of PRV；
Sequence 4 is the amino acid sequence of HN1201 plants of gD albumen of PRV.
Embodiment
The invention will now be further described with reference to specific embodiments, and advantages of the present invention and feature will be with description more
To be clear.But these embodiments are only exemplary, do not constitute any limitation to the scope of the present invention.Those skilled in the art
It should be understood that can be carried out without departing from the spirit and scope of the invention to the details and form of technical solution of the present invention
Modifications or substitutions, but these are changed and replacement is each fallen within protection scope of the present invention.
The preparation of PRV gB, gD albumen of embodiment 1
1. the amplification of PRV gB, gD gene
PRV HN1201 viruses or the culture of its different generation, the different generations are inoculated with well-grown PK15 cells
Secondary culture is the culture within 5-35 generations, and TAKARA companies MiniBEST Viral RNA/DNA are used after harvest is viral
Extraction Kit Ver.3.0 kits extract PRV genomic DNAs.Take 1 μ l genomic DNAs template, be utilized respectively
GB, gD specific primer：
gBSF:5 ' CTAGGGGGCGTCGGGGTCCTCGT 3 ' and
gBSR:5′ATGCCCGCTGGTGGCGGTCTTTGG3′
gDSF:5 ' ATGCTGCTCGCAGCGCTATTGGC 3 ' and
gDSR:5′CTACGGACCGGGCTGCGCTTTTAG3′
Enter performing PCR amplification, utilize TAKARA high-fidelity enzyme HS DNA Polymerase with
GC Buffer, gB amplification conditions are：94℃3min；98 DEG C of 10s, 68 DEG C of 3min, 30cycles；68 DEG C of 5min, PCR primer life
Entitled gB.GD amplification conditions are：94℃3min；98 DEG C of 10s, 68 DEG C of 1min, 30cycles；68℃5min.PCR primer is named as
gD。
2. recombinate Bacmid acquisition and identification
The PCR primer gB and gD that high-fidelity enzymatic amplification is obtained are cloned into pFastBac/HBM-TOPO carriers and (are purchased from respectively
Invitrogen companies, article No. A11339), clone's system is as follows：PCR primer gB 4 μ l, Salt solution (salting liquid) 1 μ
L, TOPO vector1 μ l, totally 6 μ l.It is well mixed, it is incubated at room temperature 5min, conversion One ShotR Mach1TMT1R competence is thin
Born of the same parents, are coated with amicillin resistance flat board, and picking monoclonal identifies the direction of insertion of gB, gD gene respectively, and direction of insertion is correct
Plasmid send Invitrogen companies be sequenced, identify gB, gD sequence correctness.Correct plasmid is sequenced to be respectively designated as
PFastBac/HBM-TOPO-gB, pFastBac/HBM-TOPO-gD.
PFastBac/HBM-TOPO-gB, pFastBac/HBM-TOPO-gD plasmid are converted into DH10Bac competence respectively
Cell, pFastBac/HBM-TOPO-gB, pFastBac/HBM-TOPO-gD respectively with the shuttle plasmid in competent cell
Bacmid carries out swivel base, is extracted and obtained with Invitrogen PureLink HiPure Plasmid DNA Miniprep Kit
Recombinant plasmid, and identify with pUCM13Forward/pUCM13Reverse primers gB, gD insertion, positive Bacmid respectively
It is respectively designated as Bacmid-gB, Bacmid-gD.
3. transfection obtains recombinant baculovirus
According to saying for Invitrogen companies Bac-to-Bac HBM TOPO Secreted Expression System
The method that bright book is provided is carried out.6 orifice plates paving 8 × 10 per hole5Individual sf9 cells, after after cell attachment according to II turn of Cellfectin
The specification of transfection reagent is transfected：8 μ l Cellfectin II and 1 μ g Bacmid-gB DNA to 100 μ l are diluted respectively
In the culture mediums of SF-900 II, Vortex is mixed, the DNA after mixed diluting and the Cellfectin II after dilution (cumulative volume~
210 μ l), it is well mixed and is incubated at room temperature 15~30min, it is one after another drop of to be added in cell.After transfection after 72h cytopathies to appear,
Cells and supernatant is collected, P0 is designated as recombinant virus vBac-gB.P0 infects sf9 cells for recombinant virus vBac-gB, through 3 generations
Expand after culture, the P3 of acquisition is used for expression of recombinant proteins for vBac-gB.
Above-mentioned transfection method is equally pressed, Bacmid-gD DNA are transfected, the recombinant virus of harvest is designated as P0 generations
vBac-gD.P0 infects sf9 cells for recombinant virus vBac-gD, and after expanding culture through 3 generations, the P3 of acquisition is used for for vBac-gD
Expression of recombinant proteins.
4. recombinate shape virus infection High-five cells obtain recombinant protein
P3 (is purchased from for recombinant baculovirus vBac-gB, vBac-gD inoculation High-five cells respectively
Invitrogen, article No. B85502).Suspended culture High-five cells in 500ml triangular flasks, and 7.0 are reached to cell density
×105After cell/ml, according to 1MOI amount virus inoculation, 72h collects cells and supernatant after infection.Utilize Millipore's
Volume concentration is the 1/10 of original volume by tangential flow filtration system.(it is purchased from the Triton X-100 of 1% (volume ratio)
Sigma, article No. T8787) inactivation baculoviral, it is 200 μ g/ml that SDS-PAGE optical densitometric methods, which determine protein content,.
Implement the preparation of 2 PRV vaccine combinations
Example 1 prepare gB and gD albumen, be added slowly in adjuvant, plus during be constantly with rotating speed
800rpm mulsers stir 12min, mix, 4 DEG C of preservations, the as vaccine combination of PRV.Specific proportioning is shown in Table
1。
The PRV vaccine combination composition proportion of table 1
The Study On Immunogenicity of the PRV vaccine combination of embodiment 3
21 age in days PRV negative antibodies piglets 36 are randomly divided into 9 groups, 4/group, i.e. 1-7 groups are respectively that the present invention is implemented
The vaccine 1 of the preparation of example 1, vaccine 2, vaccine 3, vaccine 4, vaccine 5, vaccine 6, the immune group of vaccine 7, the 8th group and the 9th group of injection equivalent
PBS, single immunization.Poison is attacked after 28 days after immune, toxic agent amount is attacked for porcine pseudorabies virus HN1201 strains 2 × 108.0TCID50/
Head, the daily set time observes clinical condition and measures body temperature in 7 days after attack.
As a result in the case where this attacks toxic agent amount, 4 piglets of 1-7 immune groups are protected, and of short duration clinical sign occur at 5 days
Progressively recover normal, final survival afterwards；8th group of 2 days dead 2 after poison is attacked, 3 days all dead, there is obvious clinical sign；The
9 groups of survivals, phenomenon without exception occurs.Attack poison protection and the results are shown in Table 2.
The porcine pseudorabies virus vaccine combination of table 2 is immunized after piglet and attacks poison protection result
Judge for animal, the clinical sign for assessing disease is carried out in the case of all individual immunities are not known
, body temperature rising condition is shown in Table 3.Clinical pig body temperature rise number of days statistics, vaccine is compared using ANOVA analyses to piglet body
The effect of temperature change.As a result body temperature rise difference not significantly (P ＞ are shown between vaccine 1, vaccine 2, vaccine 3 and the immune group of vaccine 4
0.05), difference is not notable (P ＞ 0.05) between vaccine 5, vaccine 6 and the immune group of vaccine 7, and vaccine 1, vaccine 2, vaccine 3, epidemic disease
Seedling 4 is extremely notable (P ＜ 0.01) with difference between vaccine 5, vaccine 6, vaccine 7.Number of days is raised by relative immunity piglet body temperature to put down
Average, as a result shows that the body temperature rise number of days average value and vaccine 1, vaccine 2, vaccine of piglet is immunized in vaccine 5, vaccine 6 and vaccine 7
The 3 body temperature rise number of days average values that piglet is immunized with vaccine 4 are compared to be dropped to 1-1.25 days by 2.75-3 days, averagely have dropped
54.5%-66.7%.Pass through the clinical evaluation result correlation of the immune efficacy of relatively more each vaccine, it can be seen that vaccine 5, vaccine 6
To be significantly higher than vaccine 1, vaccine 2, vaccine 3 and vaccine 4 with the immune effect of vaccine 7.Demonstrate the present invention and include two kinds of antigens
Vaccine combination immune effect is better than single antigen vaccine, and also found, the present invention includes two kinds of antigenc vaccine compositions
With lower antigenic content, more preferable immune effect can be but reached, by comparing influence of the vaccine to clinical disease, this hair
Bright vaccine combination clinical disease is considerably less than single antigen vaccine.
The body temperature rising condition after piglet is immunized in the porcine pseudorabies virus vaccine combination of table 3
| Group | A (my god) | B (my god) | C (my god) | D (my god) | Average value (my god) |
| 1 | 3 | 3 | 3 | 3 | 3 |
| 2 | 3 | 3 | 3 | 2 | 2.75 |
| 3 | 3 | 2 | 3 | 3 | 2.75 |
| 4 | 2 | 3 | 3 | 3 | 2.75 |
| 5 | 1 | 1 | 1 | 2 | 1.25 |
| 6 | 1 | 1 | 1 | 1 | 1 |
| 7 | 1 | 1 | 1 | 1 | 1 |
| 9 | 0 | 0 | 0 | 0 | 0 |
Further each test group piglet feeding situation is counted, 4 are the results are shown in Table.7 days feed intake statistics of clinical pig,
Compare the effect that vaccine changes to piglet feed intake using ANOVA analyses.As a result vaccine 1, vaccine 2, vaccine 3 and vaccine are shown
Feed intake difference is not notable (P ＞ 0.05) between 4 immune groups, the not notable (P of difference between vaccine 5, vaccine 6 and the immune group of vaccine 7
＞ 0.05), and vaccine 1, vaccine 2, vaccine 3, vaccine 4 are extremely notable (P ＜ 0.01) with difference between vaccine 5, vaccine 6, vaccine 7.
By relative immunity piglet feed intake average value, as a result show that the feed intake average value of piglet is immunized in vaccine 5, vaccine 6 and vaccine 7
Risen to compared with the feed intake average value that piglet is immunized in vaccine 1, vaccine 2, vaccine 3 and vaccine 4 by 210.89g-215.21g
285.56g-290.57g, averagely rise 37.78%-32.69%.Knot is judged by the immune efficacy clinic of relatively more each vaccine
Fruit correlation, it can be seen that the immune effect of vaccine 5, vaccine 6 and vaccine 7 will be significantly higher than vaccine 1, vaccine 2, vaccine 3 and epidemic disease
Seedling 4.Further demonstrate the present invention and be better than single antigen vaccine comprising two kinds of antigenc vaccine compositions immune effects.
Situation of searching for food is immunized after piglet in the porcine pseudorabies virus vaccine combination of table 4
| Group | A(g) | B(g) | C(g) | D(g) | Average value (g) |
| 1 | 215.90 | 210.14 | 208.00 | 209.54 | 210.89 |
| 2 | 214.50 | 210.24 | 210.08 | 211.42 | 211.56 |
| 3 | 210.08 | 211.80 | 219.60 | 209.12 | 212.64 |
| 4 | 220.74 | 214.63 | 216.14 | 209.35 | 215.21 |
| 5 | 280.42 | 275.26 | 298.34 | 288.24 | 285.56 |
| 6 | 295.21 | 289.28 | 287.35 | 290.45 | 290.57 |
| 7 | 291.14 | 288.84 | 292.08 | 287.42 | 289.87 |
| 9 | 288.45 | 290.54 | 287.96 | 296.35 | 290.83 |
The preparation of porcine pseudorabies virus vaccine of the embodiment 4 using NDV as carrier
1. the structure of Sota plants of total length carriers of NDV La
(1) NDV propagation and RNA are extracted, RT-PCR
By Newcastle Disease Virus Vaccine with based on Sota plants of low virulent strain La, learned with reference to Hua Zhong Agriculture University master in 2012
Structure and the identification of degree thesis whole-length NDV La Sota pnca genes group full-length cDNA carriers and NP, P helper plasmid, take NDV La Sota
Strain virus uses the Trizol Reagent (article No.s of Invitrogen companies in the culture of SPF chicken embryos after harvest is viral：
NDV RNA 12183-555) are extracted, with the Reverse Transcriptase M-MLV (article No.s of TAKARA companies：2641A) try
Agent box prepares cDNA.
(2) structure of NDV La Sota plants of each fragment
The NDV LaSota pnca gene groups sequence (gene order number is AF077761) announced with reference to Gene Bank, uses NEB
Cutter softwares are to the restriction endonuclease analysis of NDV La Sota pnca gene groups, with reference to the multiple cloning sites of pBR322 carriers,
It is divided into 8 fragment amplification full length viral genomes, FseI and PacI enzymes is introduced respectively in the downstream of M genes and the upstream of F genes
Enzyme site, and ' end adds T7 polymerase promoters, in its 3 ' Hepatitis D virus core that introducing self can be modified behind end 5
Enzyme core sequence (HdvRz), 8 pairs of primers of design are expanded (primer see the table below).With the high-fidelity enzyme of TAKARA companiesHS DNA Polymerase, PCR expand NDV each fragment gene, and PRC conditions are：94℃2min；
98 DEG C of 10s, 55 DEG C of 15s, 72 DEG C of 1min/kb (extension of time is adjusted according to each fragment length), 30cycles；72℃10min.
NDV1-UP:5′
CGGCgaattcTAATACGACTCACTATAGGACCAAACAGAGAATCCGTGAG3′
NDV1-DOWN:5′CATgggcccTTTTTAGCATTGGAC3′
NDV2-UP:5′TGCTAAAAAgggcccATGGTCGAG3′
NDV2-DOWN:5′ATTCcacgtgCTTGACTGCATTCACTG3′
NDV3-UP:5′ATTCcacgtgCGTGAAAGCGCCAGAGAAGA 3′
NDV3-DOWN:5′
CAAAttaattaaGAACTAggccggccCTAACTTGATAGACAGGTAA3′
NDV4-UP:5′ATTCttaattaaAAAAAACACGGGTAGAAGAT3′
NDV4-DOWN:5′AGCTGcggccgcTGTTATTTGTGC 3′
NDV5-UP:5′AACAgcggccgcAGCTCTGATACAAGC3′
NDV5-DOWN:5′GATCcgtacgAATGCTGCTGAACTCCTC 3′
NDV6-UP:5′CATTcgtacgGATCCGGCATTCTGGTT 3′
NDV6-DOWN:5′GTTTcttaagAACAATATTTGGGCTTG 3′
NDV7-UP:5′TGTTcttaagAAACATACGCAAAGAGT 3′
NDV7-DOWN:5′
CGAGatttaaatACATGTAGTACAGATTAGCTGGGAATG 3′
NDV8-UP:5′ATGTatttaaatCTCGGAAGAGCCTCAATTTGATCA 3′
NDV8-DOWN:5′CCGGacgcgtACCAAACAAAGATTTGGTGAATG3′
(3) structure of NDV La Sota plants of total length carrier
According to the multiple cloning sites of NDV La Sota pnca gene group restriction endonuclease analysis and pBR322 carriers, synthesis
One section of 265bp sequence (including EcoR I, Apa I, Pml I, Fse I, Pac I, Not I, Bsiw I, Afl II, Swa I,
Mlu I and the restriction enzyme sites of Hind III multiple cloning sites sequence, and HdvRz and T7 terminator sequences：
GAATTCGGGCCCCACGTGGGCCGGCCTTAATTAAGCGGCCGCCGTACGCTTAAGATTTAAATACGCGTACGCGTGGG
TCGGCATGGCATCTCCACCTCCTCGACCTGGGCATCCGAAGGAGGACGCACGTCCACTCGGATGGCTAAGGGAGGCT
GCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTC
TAAACGGGTCTTGAGGGGTTTTTTGCTGAAGCTT, plasmid is named as pMD18T-HT.
By pMD18T-HT plasmids EcoR I and the digestions of Hind III, will containing multiple cloning sites sequence, HdvRz sequences and
The fragment of T7 terminator sequences is cloned into EcoR I and Hind III site of pBR322 carriers, and the positive plasmid of acquisition is named as
pBRT7H.NDV La Sota full-length genomes PCR is then expanded to the NDV1~8DNA fragments obtained according to the clone time shown in figure
Sequence, is attached using the overlapping restriction endonuclease sites of genome adjacent segment and is assembled into pBRT7H carriers, final to build
Plasmid be named as pBRT7H-La.The carrier of structure is sequenced simultaneously, it is ensured that base sequence it is correct.
2. structure and the identification of helper plasmid
, respectively will coding NDV NPs, phosphoprotein P and polymerase protein L genes ORF based on pCI-neo carriers
Multiple cloning sites of the cDNA clone under the T7 promoters of pCI-neo carriers, the plasmid of structure be respectively designated as pCI-NP,
PCI-P and pCI-L.
After the plasmid of structure largely extracting, harvesting sample after bhk cell, transfection 72h is transfected respectively, anti-new city is used
Epidemic disease standard serum is primary antibody, and the sheep anti-chicken IgG of horseradish peroxidase-labeled carries out WesternBlot identifications for secondary antibody；With anti-
Ewcastle disease standard positive serum is primary antibody, and the sheep anti-chicken IgG of FITC marks carries out indirect immunofluorescene assay for secondary antibody and shows structure
The helper plasmid built has expression.
3.NDV rescue and identification
The total length plasmid pT7H-La of structure and helper plasmid pCI-NP, pCI-P and pCI-L are used respectively
Lipofectamine 2000 is according to 4:2:2:1 ratio cotransfection bhk cell, after transfection cultivate 3~4d harvest nutrient solution and
Cell.The culture of harvest is inoculated with the passage of 9 age in days SPF chicken embryos, NDV HA detections, chick embryo allantois positive harvest HA is carried out
Liquid, the virus as saved.
By the virus infection bhk cell of rescue, the visible obvious green of Fluirescence observation is shown with indirect immunofluorescene assay
Fluorescence, it was demonstrated that the NDV pT7H-La plasmids of structure can be packaged into functional active virus under T7 promoters, also illustrate structure
Helper plasmid pCI-NP, pCI-P and the pCI-L built has functional activity.
4. build the NDV transcription plasmids containing PRV gB genes and gD genes
The amplification of PRV gB, gD genes
PRV HN1201 viruses or the culture (pseudorabies of its different generation are inoculated with well-grown PK15 cells
Sick Strain is HN1201 plants (Pseudorabies virus, strain HN1201), and preserving number is CCTCC NO.V
201311；It is preserved in China typical culture collection center；Preservation address is Wuhan, China Wuhan University, and preservation date is
On May 20th, 2013), the culture of the different generations is the culture within 5-35 generations, and TAKARA companies are used after harvest is viral
MiniBEST Viral RNA/DNA Extraction Kit Ver.3.0 kits extract PRV genomic DNAs.Take 1 μ l genes
DNA is as template for group, is utilized respectively gB, gD specific primer：
gBSF:5 ' GGGCTAGCCTAGGGGGCGTCGGGGTCCTCGT 3 ' and
gBSR:5′TTGAATTCATGCCCGCTGGTGGCGGTCTTTGG3′
gDSF:5 ' GGGCGGCCGCATGCTGCTCGCAGCGCTATTGGC 3 ' and
gDSR:5′TTTCTAGACTACGGACCGGGCTGCGCTTTTAG3′
Enter performing PCR amplification, utilize TAKARA high-fidelity enzyme HS DNA Polymerase with
GC Buffer, gB amplification conditions are：94℃3min；98 DEG C of 10s, 68 DEG C of 3min, 30cycles；68 DEG C of 5min, PCR primer life
Entitled gB.GD amplification conditions are：94℃3min；98 DEG C of 10s, 68 DEG C of 1min, 30cycles；68℃5min.PCR primer is named as
gD。
5 build the NDV transcription plasmids containing PRV gB genes and gD genes
By PRV gB genes (the SEQ ID NO of amplification:1) with pVAX1 carriers after Nhe I and the digestions of EcoR I, connection
PVAX1-gB plasmids are built, by pVAX1-gB plasmids and gD genes (SEQ ID NO:2) after Not I and the digestions of Xba I, connection
PVaX1-gB-gD plasmids are built, the pVAX1-gB-gD plasmids using structure is templates, and the method expanded by PCR obtains two ends and is
Pac I and the restriction enzyme sites of Fse I, and the insertion box containing T7 promoters, terminator.Primer is as follows：
gBDF:5 ' CATGGCCGGCCTAATACGACTCACTATAGGGAGAC3 ' and gBDR：5′
GCTCTTAATTAAAGCCATAGAGCCCACCGCATCCC3′
With Pac I and Fse I digestion PCR primers, clip size is about 4343bp.With Pac I and the digested plasmids of Fse I
PBRT7H-La, the fragment that generation size is 19812bp.By the two fragments connection generation plasmid pBRT7H-LP.
The generation and identification of the NDV carriers of 6 expression PRV gB and gD genes
For generation expression PRV gB genes and the engineered NDV carriers of gD genes, following reactant and bar have been used
Part.The plasmid pBRT7H-LP of step 3 is used as transcription plasmid.By plasmid pCI-NP, pCI-P and pCI-L be used separately as NP, P and
L protein expression plasmids.By these four plasmids, together cotransfection enters bhk cell.After 72 hours, bhk cell supernatant is connect
9 age in days SPF chicken embryos are planted with amplicon virus.After 3 days, harvest allantoic fluid and check hemagglutination activity using chicken red blood cells
(HA).It has successfully been obtained NDV-PRV-gB-gD infectious particles.Use QuiaAMP viral RNAs extracts kit (Qiagen)
Extract RNA.RT-PCR is carried out using one-step RT-PCR kit (Qiagen).Sequencing result show gB genes and gD genes with gram
It is grand enter to transcribe the gB genes and gD gene original series of plasmid be 100% identical.The recombinant viral vector is designated as vNDV-
PRV-gB-gD。
Clinical assessment of 7 pairs of NDV-PRV vaccines in pig
The vNDV-PRV-gB-gD vaccine immunity piglet situations of table 5
| Group | Immunization wayses | Immunizing dose | Piglet number | Attack toxic agent amount |
| vNDV-PRV-gB-gD | Subcutaneous inoculation | 2mL | 4 | 2×108.0TCID50 |
| PBS | Subcutaneous inoculation | 2mLPBS | 4 | 2×108.0TCID50 |
| Blank control | — | — | 4 | — |
21 age in days PRV negative antibodies piglets 20 are randomly divided into 3 groups, 4/group, vNDV-PRV-gB-gD are diluted to
107.0EID50/ mL, vNDV-PRV-gB-gD vaccine 2ml/ heads, control group inoculation PBS liquid 2ml/ heads are immunized according to table 5.After immune
Poison is attacked after 28 days, it is HN1201 plants of porcine pseudorabies virus 2 × 10 to attack toxic agent amount8.0TCID50/ head, observation clinical symptoms and death
Situation (the results are shown in Table 6).
Malicious situation is attacked after the vNDV-PRV-gB-gD vaccine immunity piglets of table 6
Table 6 is shown, after vNDV-PRV-gB-gD vaccine immunity piglets, although is unable to blocking virus infection and (clinical condition occurs
Shape), but 100% (4/4) protection can be provided for piglet, and compare piglet and attack all dead after 4 days after poison, therefore, vNDV-PRV-
GB-gD vaccines have good protection.
Described above is only the preferred embodiments of the present invention, not does any formal limitation to the present invention, though
So the present invention is disclosed above with preferred embodiment, but is not limited to the present invention, any to be familiar with this professional technology people
Member, in the range of technical solution of the present invention is not departed from, when the technology contents using the disclosure above make a little change or repair
The equivalent embodiment for equivalent variations is adornd, as long as being the content without departing from technical solution of the present invention, the technology according to the present invention is real
Any simple modification, equivalent variations and modification that confrontation above example is made, still fall within the scope of technical solution of the present invention
It is interior.
Claims (4)
1. a kind of porcine pseudorabies virus vaccine combination, it is characterised in that described vaccine combination includes the gB of immune amount
Albumen, gD albumen and adjuvant；Wherein, described gB protein contents are that 25-50 μ g/ml, gD protein content are 25-50 μ g/ml；Institute
The gB proteins sequence stated is SEQ ID NO.3, and described gD proteins sequence is SEQ ID NO.4.
2. vaccine combination according to claim 1, it is characterised in that described gB protein contents are 25 μ g/ml, gD eggs
Bai Hanliang is 25 μ g/ml；Or described gB protein contents are that 50 μ g/ml, gD protein contents are 50 μ g/ml.
3. a kind of method for preparing any one of claim 1 vaccine combination, it is characterised in that described method includes：
1) the step of preparing gB albumen and gD proteantigens；And
2) hybrid antigen in proportion, adds the step of adjuvant, emulsification；Wherein, described gB protein contents are 25-50 μ g/ml；gD
Protein content is 25-50 μ g/ml.
4. the vaccine combination according to claim any one of 1-2 is preparing prevention and/or treatment porcine pseudorabies virus
Relevant disease or by the application in the medicine infected caused by porcine pseudorabies virus.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410519314.2A CN104248757B (en) | 2014-09-30 | 2014-09-30 | Porcine pseudorabies virus vaccine combination and its preparation method and application |
| CN201510789015.5A CN105251000B (en) | 2014-09-30 | 2014-09-30 | Porcine pseudorabies virus vaccine composition and its preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410519314.2A CN104248757B (en) | 2014-09-30 | 2014-09-30 | Porcine pseudorabies virus vaccine combination and its preparation method and application |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510789015.5A Division CN105251000B (en) | 2014-09-30 | 2014-09-30 | Porcine pseudorabies virus vaccine composition and its preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104248757A CN104248757A (en) | 2014-12-31 |
| CN104248757B true CN104248757B (en) | 2017-10-27 |
Family
ID=52184231
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410519314.2A Active CN104248757B (en) | 2014-09-30 | 2014-09-30 | Porcine pseudorabies virus vaccine combination and its preparation method and application |
| CN201510789015.5A Active CN105251000B (en) | 2014-09-30 | 2014-09-30 | Porcine pseudorabies virus vaccine composition and its preparation method and application |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510789015.5A Active CN105251000B (en) | 2014-09-30 | 2014-09-30 | Porcine pseudorabies virus vaccine composition and its preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN104248757B (en) |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106267182B (en) * | 2015-06-29 | 2020-02-07 | 普莱柯生物工程股份有限公司 | Preparation method of porcine pseudorabies virus subunit vaccine, vaccine composition and application |
| CN105693827B (en) * | 2015-06-29 | 2020-05-15 | 普莱柯生物工程股份有限公司 | Porcine pseudorabies virus subunit vaccine and preparation method and application thereof |
| CN106405082A (en) * | 2016-08-31 | 2017-02-15 | 洛阳普莱柯万泰生物技术有限公司 | Porcine pseudorabies virus detection test paper |
| CN107860921A (en) * | 2017-11-01 | 2018-03-30 | 杭州微瑞科技有限公司 | Pseudorabies virus antibody Quantitative detection card and application method |
| CN109134669B (en) * | 2018-09-19 | 2021-03-23 | 天康生物股份有限公司 | Fusion protein of porcine pseudorabies virus, preparation method, application and vaccine thereof |
| CN110066827B (en) * | 2019-04-29 | 2020-12-15 | 华中农业大学 | Recombinant baculovirus transfer vector containing porcine pseudorabies virus gB protein gene, recombinant baculovirus, preparation method and application |
| CN112011521A (en) * | 2020-06-15 | 2020-12-01 | 浙江迪福润丝生物科技有限公司 | Novel recombinant newcastle disease virus vector coronavirus vaccine candidate strain as well as construction method and application thereof |
| CN114146172B (en) * | 2021-12-07 | 2022-09-16 | 重庆市动物疫病预防控制中心 | Nano antibody vaccine capable of preventing porcine pseudorabies virus infection, preparation method and application |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1376200A (en) * | 1999-06-10 | 2002-10-23 | 梅瑞尔公司 | DNA vaccine-PCV |
| CN1705436A (en) * | 2002-10-15 | 2005-12-07 | 法国海布雷德斯公司 | Method for producing a mammal provided with resistance to an alpha-herpes virus mediated infection and mammal obtained by implementing said method and said mammal's progeny |
| CN101121023A (en) * | 1996-07-19 | 2008-02-13 | 梅瑞尔公司 | Polynucleotide vaccine formula for treating porcine respiratory and reproductive diseases |
| CN102985112A (en) * | 2010-03-26 | 2013-03-20 | 国立大学法人东京大学 | Pharmaceutical composition for treatment and prevention of herpesvirus infections |
| CN104004774A (en) * | 2013-05-31 | 2014-08-27 | 普莱柯生物工程股份有限公司 | Swine pseudorabies virus and vaccine composition as well as preparation method and application thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6146642A (en) * | 1998-09-14 | 2000-11-14 | Mount Sinai School Of Medicine, Of The City University Of New York | Recombinant new castle disease virus RNA expression systems and vaccines |
| EP2052082A4 (en) * | 2007-02-21 | 2011-01-12 | Novavax Inc | Chimeric newcastle disease virus vlps |
| CN101376880B (en) * | 2008-09-24 | 2010-12-08 | 中国农业科学院哈尔滨兽医研究所 | Recombinant new castle disease LaSota attenuated vaccine strain expressing rabies virus glucoprotein (GP protein) |
-
2014
- 2014-09-30 CN CN201410519314.2A patent/CN104248757B/en active Active
- 2014-09-30 CN CN201510789015.5A patent/CN105251000B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101121023A (en) * | 1996-07-19 | 2008-02-13 | 梅瑞尔公司 | Polynucleotide vaccine formula for treating porcine respiratory and reproductive diseases |
| CN1376200A (en) * | 1999-06-10 | 2002-10-23 | 梅瑞尔公司 | DNA vaccine-PCV |
| CN1705436A (en) * | 2002-10-15 | 2005-12-07 | 法国海布雷德斯公司 | Method for producing a mammal provided with resistance to an alpha-herpes virus mediated infection and mammal obtained by implementing said method and said mammal's progeny |
| CN102985112A (en) * | 2010-03-26 | 2013-03-20 | 国立大学法人东京大学 | Pharmaceutical composition for treatment and prevention of herpesvirus infections |
| CN104004774A (en) * | 2013-05-31 | 2014-08-27 | 普莱柯生物工程股份有限公司 | Swine pseudorabies virus and vaccine composition as well as preparation method and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| A DNA vaccine coding for gB and gD of pseudorabies virus(suid herpes type 1) primes the immune system in the presence of maternal immunity more efficiently than conventional vaccines;E.M.A. van Rooij等;《Vaccine》;20051003;第24卷;摘要 * |
| 伪狂犬病亚单位疫苗研究进展;杨承槐等;《江西畜牧兽医杂志》;20041231(第3期);第5页左栏第5段至右栏第1段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105251000B (en) | 2018-12-14 |
| CN105251000A (en) | 2016-01-20 |
| CN104248757A (en) | 2014-12-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104248757B (en) | Porcine pseudorabies virus vaccine combination and its preparation method and application | |
| US9650424B2 (en) | Porcine pseudorabies virus, vaccine composition and preparation method and use thereof | |
| CN105567648B (en) | Recombination avian herpetoviruses carrier and vaccine for immunity inoculation aquatic bird species | |
| CN104250640A (en) | Porcine pseudorabies virus gene deletion strain, vaccine composition, preparation method and application thereof | |
| CN105693827A (en) | Porcine pseudorabies virus subunit vaccine and preparation method and application thereof | |
| CN105018433B (en) | Porcine pseudorabies virus gene-deleted strain, vaccine composition and its preparation method and application | |
| CN110387354B (en) | Pseudorabies virus passage attenuated strain and application thereof | |
| CN105985966A (en) | Gene VII-type newcastle disease virus strain, vaccine composition thereof and preparing method and application of vaccine composition | |
| CN106267182A (en) | The preparation method of a kind of porcine pseudorabies virus subunit vaccine and vaccine combination and application | |
| CN104582724A (en) | An immunogenic composition of killed leptospira bacteria | |
| CN106794242B (en) | Broad-spectrum vaccine against avian reovirus | |
| CN106924726A (en) | A kind of vaccine combination for preventing porcine reproductive and respiratory syndrome and its preparation method and application | |
| CN107287168A (en) | A kind of NDV saves method and its application | |
| CN106929480A (en) | Porcine reproductive and respiratory syndrome virus strain and its application | |
| CN105018436B (en) | Porcine pseudorabies virus gene-deleted strain, vaccine composition and its preparation method and application | |
| CN104328090B (en) | A kind of porcine pseudorabies virus strain, vaccine composition and its preparation method and application | |
| CN107326012A (en) | A kind of cell line and its application | |
| KR20210035675A (en) | Avian metapneumovirus vaccine with high tilter using Newcastle virus vector | |
| KR20210035676A (en) | Avian metapneumovirus vaccine with high tilter using Newcastle virus vector | |
| CN104248761A (en) | Vaccine composition, and preparation method and application thereof | |
| JP2015512396A (en) | Modified Marek's disease virus and vaccine produced from said virus | |
| CN115261335B (en) | Oral immune avian influenza inactivated vaccine | |
| CN116478937B (en) | Gene III avian reovirus variant and application thereof in preparing vaccine | |
| CN107299088B (en) | Infectious bovine rhinotracheitis virus IBRV-B strain and application thereof | |
| Ismael et al. | Epidemiological Study on the Impact of Vaccination Programs on Antigenic Relatedness, Genetic Characterization of Highly pathogenic Avian Influenza H5N1. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |