CN110066827A - Recombinant baculovirus transfer vector, recombinant baculovirus and the preparation method and application of the protein gene of gB containing porcine pseudorabies virus - Google Patents

Recombinant baculovirus transfer vector, recombinant baculovirus and the preparation method and application of the protein gene of gB containing porcine pseudorabies virus Download PDF

Info

Publication number
CN110066827A
CN110066827A CN201910354221.1A CN201910354221A CN110066827A CN 110066827 A CN110066827 A CN 110066827A CN 201910354221 A CN201910354221 A CN 201910354221A CN 110066827 A CN110066827 A CN 110066827A
Authority
CN
China
Prior art keywords
iggfc
ala
val
arg
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201910354221.1A
Other languages
Chinese (zh)
Other versions
CN110066827B (en
Inventor
钱平
李祥敏
李江龙
陈焕春
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Huazhong Agricultural University
Original Assignee
Huazhong Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Huazhong Agricultural University filed Critical Huazhong Agricultural University
Priority to CN201910354221.1A priority Critical patent/CN110066827B/en
Publication of CN110066827A publication Critical patent/CN110066827A/en
Application granted granted Critical
Publication of CN110066827B publication Critical patent/CN110066827B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • A61P31/22—Antivirals for DNA viruses for herpes viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/14011—Baculoviridae
    • C12N2710/14021—Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/14011—Baculoviridae
    • C12N2710/14041—Use of virus, viral particle or viral elements as a vector
    • C12N2710/14043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vectore
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16711—Varicellovirus, e.g. human herpesvirus 3, Varicella Zoster, pseudorabies
    • C12N2710/16722—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16711—Varicellovirus, e.g. human herpesvirus 3, Varicella Zoster, pseudorabies
    • C12N2710/16734—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Virology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Immunology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Physics & Mathematics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Communicable Diseases (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present invention provides the recombinant baculovirus transfer vectors containing porcine pseudorabies virus gB protein gene, recombinant baculovirus and its preparation method and application, belong to live vaccine technical field.Recombinant baculovirus transfer vector containing porcine pseudorabies virus gB protein gene is inserted at the restriction enzyme site between the BamHI of baculovirus transfer vector and EcoRI between XbaI and HindIII respectively at restriction enzyme site using GP67 signal peptide-gB-His label or GP67 signal peptide-gB-IgGFc-His label as foreign gene；The gB is the gene for encoding the gB albumen of C-terminal transmembrane fragment missing.The carrier promotes the secreting, expressing of porcine pseudorabies virus gB albumen and gB-IgGFc fusion protein.Single subunit vaccine is prepared using gB albumen and gB-IgGFc fusion protein, has the characteristics that good safety, high specificity, to attack malicious protective rate high.

Description

The recombinant baculovirus transfer vector of the protein gene of gB containing porcine pseudorabies virus, again Group baculoviral and preparation method and application
Technical field
The invention belongs to live vaccine technical fields, and in particular to the recombination bar of the protein gene of gB containing porcine pseudorabies virus Shape Baculovirus transfer vector, recombinant baculovirus and preparation method and application.
Background technique
Porcine pseudorabies (Pseudorabies, PR also known as Aujeszky's disease, AD) are by porcine pseudorabies virus A kind of infectious disease caused by (Pseudorabies Virus, PRV).In addition to the pig at various ages, ox are all susceptible, in natural conditions Under make the zoogenetic infections such as sheep, dog, cat, rabbit, mouse, mink, fox fall ill, be easy to cause biggish economic loss to animal husbandry. Porcine pseudorabies virus (Pseudorabies virus, PRV) is also known as I type of herpesvirus suis, infectious bulbar paralysis virus, surprise Itch syndrome virus, aujesky's disease virus, easily causes a variety of domestic animals such as ox, sheep, pig, dog and cat and wild animal fever, odd Itch (except pig) and the symptoms such as encephalomyelitis.Since the clinical symptoms of this disease are similar to rabies, thus used " pseudoabies " this Name of disease.
The infection character of porcine pseudorabies virus includes two kinds, and one is latent infections, another is subclinical infection.It is latent Volt infection is that infected pig does not show clinical symptoms, but infectious virus can exist for a long time with latence in pig body, It separates less than virus, but the presence of virus genom DNA can be found with polymerase probe method, in extraneous poor environment stimulation etc. Caused by immunity weaken when, the virus of latence can be converted into infective virus.Subclinical infection is made in swinery After a small amount of virus of vaccine inoculation or natural infection part, which obtains partial immunity, and subclinical infection pig and performance can occur For the pig of inferior clinical symptom, this band poison pig toxin expelling sustainable 1 year or more.For the infection character of porcine pseudorabies virus, It attempts to be immunized with improvement attenuated live vaccine and inactivated vaccine to control the outbreak of disease of pig.Attenuated live vaccine usually has exempts from for a long time Epidemic disease effect, but there is the insufficient risk with Genomic instability of decaying.Inactivated vaccine is effective not as good as attenuated vaccine, while needing to repeat Inoculation, greatly increases the usage amount of inactivated vaccine.There is presently no occur carrying the subunit vaccine of PRV individual gene.
Summary of the invention
In view of this, the purpose of the present invention is to provide a kind of recombination bars containing porcine pseudorabies virus gB protein gene Shape Baculovirus transfer vector, the carrier promote the secreting, expressing of porcine pseudorabies virus gB albumen.
The object of the invention is also to provide a kind of expression porcine pseudorabies virus gB albumen or gB-IgGFc to merge egg White recombinant baculovirus, the virus have the characteristics that secreting, expressing gB albumen or gB-IgGFc fusion protein.
The object of the invention is also to provide a kind of subunit vaccines for porcine pseudorabies, and the subunit vaccine is not It is only highly-safe, and with the features such as high specificity, immunity is efficient.
The present invention provides the recombinant baculovirus transfer vectors containing porcine pseudorabies virus gB protein gene, with GP67 Signal peptide-gB-His label is that foreign gene is inserted into the digestion position between the BamHI of baculovirus transfer vector and EcoRI respectively At point between XbaI and HindIII at restriction enzyme site；
The gB is the gene for encoding the gB albumen of C-terminal transmembrane fragment missing；The coding C-terminal transmembrane fragment missing GB albumen gene nucleotide sequence as shown in SEQ ID No.1.
The present invention provides the recombinant baculovirus transfers containing porcine pseudorabies virus gB-IgGFc antigen-4 fusion protein gene Carrier is inserted between BamHI and EcoRI respectively using GP67 signal peptide-gB-IgGFc fusion protein-His label as foreign gene Restriction enzyme site between XbaI and HindIII at restriction enzyme site；
The nucleotides sequence of the gB-IgGFc fusion protein is classified as the gene of the gB albumen of coding C-terminal transmembrane fragment missing It is linked in sequence to obtain by catenation sequence with the coded sequence of IgGFc albumen；The gB egg of the coding C-terminal transmembrane fragment missing The nucleotide sequence of white gene is as shown in SEQ ID No.1；The nucleotide sequence of the coded sequence of the IgGFc albumen is such as Shown in SEQ ID No.2.
The present invention provides the construction methods of the recombinant baculovirus transfer vector, comprising the following steps:
(1) using PRV genome as template, the gB segment of PCR amplification C-terminal transmembrane fragment missing；
(2) the gB segment that C-terminal transmembrane fragment lacks is connect with carrier is carrier and obtains the recombinant vector containing gB；
(3) using the recombinant vector containing gB as template, with the first primer to PCR amplification is carried out, the first pcr amplification product is obtained For GP67 signal peptide-gB-His label target fragment；
Using first pcr amplification product as template, restriction enzyme site is added respectively, obtains to both ends and is connected separately with BamHI XbaI and HindIII enzyme is connected separately with the GP67 signal peptide-gB-His label target fragment of EcoRI restriction enzyme site and both ends GP67 signal peptide-gB-His label the target fragment of enzyme site；
(4) both ends are connected separately with to the GP67 signal peptide-gB-His label mesh of BamHI and EcoRI restriction enzyme site Segment and both ends be connected separately with XbaI and HindIII restriction enzyme site GP67 signal peptide-gB-His label target fragment connect It is connected in baculovirus transfer vector, obtains the recombinant baculovirus transfer containing porcine pseudorabies virus gB protein gene and carry Body.
Preferably, the first primer to include for gB 5 ' end addition GP67 signal peptides forward primer and for gB 3 ' end add Add the reverse primer of His label, the nucleotide sequence of the forward primer is as shown in SEQ ID No.3 and SEQ ID No.4；Institute The nucleotide sequence of reverse primer is stated as shown in SEQ ID No.5.
Preferably, addition restriction enzyme site must arrive the GP67 signal that both ends are connected separately with BamHI and EcoRI restriction enzyme site The method of peptide-gB-His label target fragment includes carrying out PCR amplification using SEQ ID No.6 and SEQ ID No.7 to obtain；
The addition restriction enzyme site must arrive the GP67 signal peptide-that both ends are connected separately with XbaI and HindIII restriction enzyme site The method of gB-His label target fragment includes carrying out PCR amplification using SEQ ID No.8 and SEQ ID No.9 to obtain.
The present invention provides one kind to turn containing porcine pseudorabies virus gB-IgGFc antigen-4 fusion protein gene recombinant baculovirus The construction method of transfer body, comprising the following steps:
(1) using PRV genome as template, the gB segment of PCR amplification C-terminal transmembrane fragment missing and artificial synthesized IgGFc- His segment；
(2) the gB segment of C-terminal transmembrane fragment missing or IgGFc-His segment are connect with carrier is carrier respectively, Obtain the recombinant vector containing gB or the recombinant vector containing IgGFc-His；
(3) using the recombinant vector containing gB as template, with the first primer to PCR amplification is carried out, the first pcr amplification product is obtained For GP67 signal peptide-gB-His label target fragment；
(4) using the GP67 signal peptide-gB-His label target fragment and the recombinant vector containing IgGFc-His as template, Fusion DNA vaccine amplification is carried out with the second primer pair, the second pcr amplification product of acquisition is GP67 signal peptide-gB-IgGFc-His label Target fragment；
Using second pcr amplification product as template, restriction enzyme site is added respectively, obtains to both ends and is connected separately with BamHI With the GP67 signal peptide-gB-IgGFc-His label target fragment of EcoRI restriction enzyme site and both ends be connected separately with XbaI and GP67 signal peptide-gB-His label the target fragment of HindIII restriction enzyme site；
(5) both ends are connected separately with to the GP67 signal peptide-gB-IgGFc-His of BamHI and EcoRI restriction enzyme site Label target fragment and both ends are connected separately with the GP67 signal peptide-gB-IgGFc-His mark of XbaI and HindIII restriction enzyme site Label target fragment is connected in baculovirus transfer vector, is obtained containing porcine pseudorabies virus gB-IgGFc antigen-4 fusion protein gene Recombinant baculovirus transfer vector.
Preferably, second primer pair includes that 5 ' the end addition GP67 signal peptide sequences of gB are shown such as SEQ ID No.10 The forward primer of column, if SEQ ID No.11 show the reverse primer of 3 ' the end addition homology arm sequences of gB, such as SEQ ID No.12 show the forward primer of 5 ' the end addition homology arm sequences of IgGFc and as SEQ ID No.13 show the 3 ' of IgGFc The reverse primer of end addition His sequence label.
In the present invention, using second pcr amplification product as template, restriction enzyme site is added respectively, obtains both ends difference The method for being connected with the GP67 signal peptide-gB-IgGFc-His label target fragment of BamHI and EcoRI restriction enzyme site preferably includes PCR amplification is carried out using SEQ ID No.6 and SEQ ID No.7 to obtain.Primer shown in SEQ ID No.6 makes GP67 signal Add upper BamHI restriction enzyme site in 5 ' ends of peptide-gB-IgGFc-His label target fragment；Primer shown in SEQ ID No.7 makes Add upper EcoRI restriction enzyme site in 3 ' ends of GP67 signal peptide-gB-IgGFc-His label target fragment.
In the present invention, the addition restriction enzyme site must arrive both ends and be connected separately with XbaI and HindIII restriction enzyme site The method of GP67 signal peptide-gB-IgGFc-His label target fragment is preferably included using SEQ ID No.8 and SEQ ID No.9 PCR amplification is carried out to obtain.Primer shown in SEQ ID No.8 makes GP67 signal peptide-gB-IgGFc-His label target fragment Add upper XbaI enzyme cutting site in 5 ' ends.Primer shown in SEQ ID No.9 makes GP67 signal peptide-gB-IgGFc-His label purpose Add upper HindIII restriction enzyme site in 3 ' ends of segment.
The present invention provides a kind of recombinant baculovirus for expressing porcine pseudorabies virus gB albumen, by the recombination bar Shape Baculovirus transfer vector is transfected to insect cell, and lesion occurs in culture to cell, is collected supernatant and is obtained.
The present invention provides a kind of recombinant baculovirus for expressing porcine pseudorabies virus gB-IgGFc fusion protein, by institute The recombinant baculovirus transfer vector stated is transfected to insect cell, and lesion occurs in culture to cell, is collected supernatant and is obtained.
Recombinant baculovirus transfer vector of the present invention or the method construct to obtain recombinant baculovirus transfer vector Or application of the recombinant baculovirus in the vaccine of production porcine pseudorabies.
The present invention provides a kind of subunit vaccines for preventing and treating porcine pseudorabies, including one in adjuvant and following albumen Kind: the porcine pseudorabies virus gB albumen of the recombinant baculovirus expression and the gB- of the recombinant baculovirus expression IgGFc fusion protein.
Preferably, the concentration of the porcine pseudorabies virus gB albumen is 200~300 μ g/ml；The gB-IgGFc fusion The concentration of albumen is 150~200 μ g/ml.
The present invention provides the recombinant baculovirus transfer vector containing porcine pseudorabies virus gB protein gene, GP67 letters Number peptide-gB-His label be foreign gene be inserted at BamHI the and EcoRI restriction enzyme site of baculovirus transfer vector respectively and At XbaI and HindIII restriction enzyme site；The gB is the gene for encoding the gB albumen of transmembrane fragment missing.The sequence of the gB It is according to the DNA sequence dna for the coding gB albumen for encoding transmembrane fragment missing in China's prevalence advantage strain, the gB albumen is The glycoprotein of PRV, including 2082bp, transmembrane deletion is more conducive to the secreting, expressing of the gB albumen, while the recombination is rod-shaped GP67 signal peptide-gB-His label is placed in opening in baculovirus transfer vector in the form of 2 copies in Baculovirus transfer vector Under mover, the expression quantity of target gene can be improved, is provided convenience for later separation purifying and the vivoexpression albumen.
The present invention provides the recombinant baculovirus transfers containing porcine pseudorabies virus gB-IgGFc antigen-4 fusion protein gene Carrier, GP67 signal peptide-gB-IgGFc fusion protein-His label are that foreign gene is inserted into baculovirus transfer vector respectively At BamHI and EcoRI restriction enzyme site and at XbaI and HindIII restriction enzyme site；The gB-IgGFc fusion protein be coding across The gene of the gB albumen of film area fragment deletion and the coded sequence of IgGFc albumen are linked in sequence to obtain by catenation sequence.It is described GB and mouse IgG the Fc fusion protein that the albumen of gB-IgGFc coding is PRV, overall length are 3231 bases, encode 1077 ammonia Base acid, gB transmembrane deletion is more conducive to the secreting, expressing of the gB-IgGFc albumen, while PRV glycoprotein gB and IgGFc being melted The protective immunity that can be enhanced to PRV is closed, IgG2a Fc segment plays potential molecule adjuvant effect.Simultaneously by the GP67 Signal peptide-gB-IgGFc fusion protein-His label is placed under the promoter of baculovirus transfer vector in the form of 2 copies, is improved The expression quantity of target gene is provided convenience for later separation purifying and the vivoexpression albumen.
Recombinant baculovirus transfer vector of the present invention or the method construct to obtain recombinant baculovirus transfer vector Or application of the recombinant baculovirus in the vaccine of production porcine pseudorabies.Due to porcine pseudorabies virus gB Protein reconstitution bar The gB albumen of shape expressing viral and the gB-IgGFc fusion protein of gB-IgGFc fusion protein recombinant baculovirus expression, it is all non- Totivirus, therefore the danger to prepare the virus-free diffusion of subunit vaccine, production process are safer.The gB albumen of preparation simultaneously After gB-IgGFc fusion protein immunization body, there is diagnostic antigen high specificity, high sensitivity diagnoses rapid feature；Energy Enough realize efficient producer gene engineered vaccine.In addition, obtaining the antigen of a large amount of gB-IgGFc fusion protein compared with gB albumen Immunogenicity is more preferable, higher to the protective rate of mouse.Therefore, IgG2a Fc segment is played as molecule adjuvant and Antigen Fusion Improve the effect of the immunogenicity of antigen.
Detailed description of the invention
Fig. 1 is recombination baculovirus transfer vector PFBD-2-PRVgB and PFBD-2-PRVgB-IgGFc digestion qualification figure Spectrum；
Fig. 2 is that Western blot and SDA-PAGE analyze recombinant baculovirus AC-2-PRV-gB protein expression electrophoretogram；
Fig. 3 is that Western blot and SDA-PAGE analyze recombinant baculovirus AC-2-PRV-gB-IgG2aFc albumen table Up to electrophoretogram；
Fig. 4 is the antibody level detection of the anti-PRV of different time points after two kinds of subunit vaccines of mouse immune；
Fig. 5 is that the detection of mouse inducing cytokine level is immunized in two kinds of subunit vaccines；
Fig. 6 is that two kinds of subunit vaccines are immunized mouse immune and attack after poison survival rate after mouse.
Specific embodiment
The present invention provides the recombinant baculovirus transfer vectors comprising porcine pseudorabies virus gB protein gene, with GP67 Signal peptide-gB-His label is that foreign gene is inserted into the digestion position between the BamHI of baculovirus transfer vector and EcoRI respectively At point between XbaI and HindIII at restriction enzyme site；
The gB is the gene for encoding the gB albumen of C-terminal transmembrane fragment missing；The coding C-terminal transmembrane fragment missing GB albumen gene nucleotide sequence as shown in SEQ ID No.1.GB full length gene is 2745bp (SEQ ID No.14), The amino acid sequence of the protein of gB gene expression is as shown in SEQ ID No.15.
In the present invention, the gene of the gB albumen of the coding C-terminal transmembrane fragment missing is not limited to SEQ ID Nucleotide sequence shown in No.1 further includes the nucleotide sequence complementary with SEQ ID No.1 phase and in SEQ ID No.1 On the basis of, it can be achieved the object of the present invention by simply adding, deleting, replacing the sequence that one or more nucleotide obtain, It belongs to the scope of protection of the present invention.In embodiments of the present invention, the nucleotide sequence of the GP67 signal peptide-gB-His label is such as Shown in SEQ ID No.16.The coded sequence of the GP67 signal peptide-gB-His label is as shown in SEQ ID No.17.It is described The amino acid sequence of GP67 signal peptide-gB-His label is as shown in SEQ ID No.18.
The present invention is not particularly limited the source of the baculovirus transfer vector, using known in the art rod-shaped Baculovirus transfer vector.In order to illustrate recombinant baculovirus transfer vector composition, used in the embodiment of this field PFBDHmHNM1P10eEFP plasmid is as recombinant baculovirus transfer vector preparation and reorganization baculoviral.It is described PFBDHmHNM1P10eEFP plasmid is constructed by this laboratory and provides (patent No.: ZL200910063217.6).By institute of the present invention The core for stating recombinant baculovirus transfer vector is that GP67 signal peptide-gB-His label is foreign gene, and baculoviral turns The type of transfer body is not done specifically, it is all containing there are two and more than two multiple cloning sites.The multiple cloning sites Type is with no restrictions, it is not limited to restriction enzyme site between the restriction enzyme site and XbaI and HindIII between BamHI and EcoRI.
The present invention nucleotide sequence of the GP67 signal peptide is not done it is specifically limited, using GP67 known in the art The nucleotide sequence of signal peptide.In embodiments of the present invention, the sequence of the GP67 signal peptide is referring to SEQ in construction method Sequence shown in ID No.3 and SEQ ID No.4.The present invention does not do specifically limited, use to the nucleotide sequence of the His label The nucleotide sequence of His label known in the art.In embodiments of the present invention, the sequence of the His label referring to Sequence shown in SEQ ID No.5 in construction method.
The present invention provides the recombinant baculovirus transfers comprising porcine pseudorabies virus gB-IgGFc antigen-4 fusion protein gene Carrier, GP67 signal peptide-gB-IgGFc fusion protein-His label are that foreign gene is inserted into baculovirus transfer vector respectively At restriction enzyme site between BamHI and EcoRI between XbaI and HindIII at restriction enzyme site；The gB-IgGFc merges egg White nucleotides sequence is classified as the gene of gB albumen of coding C-terminal transmembrane fragment missing and the coded sequence of IgGFc albumen passes through Catenation sequence is linked in sequence to obtain；The nucleotide sequence such as SEQ of the gene of the gB albumen of the coding C-terminal transmembrane fragment missing Shown in ID No.1；The nucleotide sequence of the coded sequence of the IgGFc albumen is as shown in SEQ ID No.2.
In the present invention, the sequence while foregoing description of the gB albumen of the coding C-terminal transmembrane fragment missing, herein not It repeats.The IgGFc albumen selects mouse IgG Fc albumen, preferably mouse IgG 2aFc albumen, rather than other IgG are sub- Type, because IgG2a Fc and source of mouse Fc γ RI receptor affinity are higher, and Fc γ RI receptor is the high-affinity of immunoglobulin Receptor, the fusion protein advantageously formed have stronger specificity.The coded sequence of the IgGFc albumen is not limited to Nucleotide sequence shown in SEQ ID No.2 further includes the nucleotide sequence complementary with SEQ ID No.2 phase and in SEQ ID On the basis of No.2, by simply add, delete, replace the sequence that one or more nucleotide obtain can realize it is of the invention Purpose belongs to the scope of protection of the present invention.The effect of the catenation sequence be by the 5 ' of the nucleotide sequence of IgGFc albumen ends and 3 ' ends of gB albumen connect.The catenation sequence flexibility with higher, using known in the art connection function Catenation sequence.In embodiments of the present invention, the specific nucleotide sequence of the catenation sequence is referring to following construction methods In show the reverse primer of 3 ' the end addition homology arm sequences of gB such as SEQ ID No.8 or show such as SEQ ID No.9 Nucleotide sequence in the forward primer of 5 ' the end addition homology arm sequences of IgGFc.The baculovirus transfer vector Kind is similar containing porcine pseudorabies virus gB protein gene recombinant baculovirus transfer vector, and this will not be repeated here.
In the present invention, the nucleotide of the coded sequence of the GP67 signal peptide-gB-IgGFc fusion protein-His label For sequence as shown in SEQ ID No.19, the nucleotide sequence of the gB-IgG2aFc gene shares 2970bp, encodes 989 amino Acid；The protein sequence of the gB-IgG2aFc gene coding is as shown in SEQ ID No.20.
The present invention provides the construction methods of the recombinant baculovirus transfer vector, comprising the following steps:
(1) using PRV genome as template, the gB segment of PCR amplification C-terminal transmembrane fragment missing；
(2) the gB segment that C-terminal transmembrane fragment lacks is connect with carrier is carrier and obtains the recombinant vector containing gB；
(3) using the recombinant vector of gB as template, with the first primer to PCR amplification is carried out, obtaining the first pcr amplification product is GP67 signal peptide-gB-His label target fragment；
Using first pcr amplification product as template, restriction enzyme site is added respectively, obtains to both ends and is connected separately with BamHI XbaI and HindIII enzyme is connected separately with the GP67 signal peptide-gB-His label target fragment of EcoRI restriction enzyme site and both ends GP67 signal peptide-gB-His label the target fragment of enzyme site；
(4) both ends are connected separately with to the GP67 signal peptide-gB-His label mesh of BamHI and EcoRI restriction enzyme site Segment and both ends be connected separately with XbaI and HindIII restriction enzyme site GP67 signal peptide-gB-His label target fragment connect It is connected in baculovirus transfer vector, obtains the recombinant baculovirus transfer containing porcine pseudorabies virus gB protein gene and carry Body.
The present invention is using PRV genome as template, the gB segment of PCR amplification C-terminal transmembrane fragment missing.The C-terminal cross-film The gB segment of area's fragment deletion includes carrying out PCR amplification using the genome of porcine pseudorabies virus as template and obtaining.The PCR Amplification forward primer includes gcggccgtgacgcgggccgcctcggcctcgcc (SEQ ID No.21)；The PCR amplification It include gttgtggtccaccttgaccacgcggtcaatg, (SEQ ID No.22) with reverse primer.The journey of the PCR amplification Sequence is as follows: 4 DEG C, 5min；(94 DEG C, 30s；60 DEG C, 30s；72 DEG C, 1kb/min) 30 circulations；72 DEG C, 5min；The PCR expands The total system of increasing is that 50 μ l:10X buffer (contain Mg2+), 5 μ l；DNTP, 6ul；10 μM of primer1,2 μ l；10μM Primer2,2 μ l；Template, 200ng；Taq enzyme, 0.5 μ l；ddH2O polishing system.
After obtaining the gB segment of C-terminal transmembrane fragment missing, gB segment and base that the present invention lacks C-terminal transmembrane fragment The connection of plinth carrier obtains the recombinant vector containing gB.
In the present invention, the type of the carrier is carrier is not particularly limited, using carrier is carrier known in the art ?.In the embodiment of the present invention, the carrier is carrier is with pEASYBLUNT carrier to illustrate connection procedure.It is described PEASYBLUNT carrier and the gB segment mixed room temperature of transmembrane fragment missing react 5min, pass through blunt end cloning.
Using the recombinant vector of gB as template, the present invention, to PCR amplification is carried out, is obtained the first PCR amplification and produced with the first primer Object is GP67 signal peptide-gB-His label target fragment；Using first pcr amplification product as template, digestion position is added respectively Point obtains to both ends and is connected separately with the GP67 signal peptide-gB-His label target fragment and two of BamHI and EcoRI restriction enzyme site End is connected separately with the GP67 signal peptide-gB-His label target fragment of XbaI and HindIII restriction enzyme site.
In the present invention, the first primer to the forward primer for preferably including 5 ' the end addition GP67 signal peptides for gB and is gB 3 ' end addition His labels reverse primer, the nucleotide sequence of the forward primer such as SEQ ID No.3 and SEQ ID Shown in No.4；The nucleotide sequence of the reverse primer is as shown in SEQ ID No.5.The first primer is to progress PCR amplification Reaction system be 50 μ l:10 × buffer (contain Mg2+), 5 μ l；dNTP,6μl；10 μM of forward primers, 2 μ l；10 μM are reversely drawn Object, 2 μ l；Template, 200ng；Taq, 0.5 μ l；ddH2O supplies system；The first primer is to the response procedures for carrying out PCR amplification It is 94 DEG C, 5min；(94 DEG C, 30s；65 DEG C, 30s；72 DEG C, 1kb/min) 30 circulations；72 DEG C, 5min.
In the present invention, the addition restriction enzyme site must arrive both ends and be connected separately with BamHI and EcoRI restriction enzyme site The method of GP67 signal peptide-gB-His label target fragment preferably includes to carry out using SEQ ID No.6 and SEQ ID No.7 PCR amplification obtains.Primer shown in SEQ ID No.6 makes the 5 ' of GP67 signal peptide-gB-His label target fragment to hold in addition BamHI restriction enzyme site；Primer shown in SEQ ID No.7 makes the 3 ' of GP67 signal peptide-gB-His label target fragment to hold addition Upper EcoRI restriction enzyme site.Response procedures when SEQ ID No.6 and SEQ ID No.7 progress PCR amplification are preferably as follows: 94 DEG C, 5min；(94 DEG C, 30s；65 DEG C, 30s；72 DEG C, 1kb/min) 30 circulations；72 DEG C, 5min.The reaction system is same as above.
In the present invention, the addition restriction enzyme site must arrive both ends and be connected separately with XbaI and HindIII restriction enzyme site The method of GP67 signal peptide-gB-His label target fragment preferably includes to carry out using SEQ ID No.8 and SEQ ID No.9 PCR amplification obtains.Primer shown in SEQ ID No.8 makes the 5 ' of GP67 signal peptide-gB-His label target fragment to hold in addition XbaI enzyme cutting site.Primer shown in SEQ ID No.9 makes the 3 ' of GP67 signal peptide-gB-His label target fragment to hold in addition HindIII restriction enzyme site.Response procedures when SEQ ID No.8 and SEQ ID No.9 progress PCR amplification are preferably as follows: 94 DEG C, 5min；(94 DEG C, 30s；65 DEG C, 30s；72 DEG C, 1kb/min) 30 circulations；72 DEG C, 5min.The reaction system is same as above.
After obtaining two segments, the present invention believes the GP67 that the both ends are connected separately with BamHI and EcoRI restriction enzyme site Number peptide-gB-His label target fragment and both ends are connected separately with the GP67 signal peptide-gB- of XbaI and HindIII restriction enzyme site His label target fragment is connected in baculovirus transfer vector, obtains the weight containing porcine pseudorabies virus gB protein gene Group baculovirus transfer vector.
In the present invention, before the connection, preferably baculovirus transfer vector or above-mentioned two target fragment are successively used BamHI and EcoRI and XbaI and HindIII enzyme carry out digestion.The method of the connection preferably uses T4DNA ligase at 16 DEG C Connection is overnight.
The present invention provides a kind of recombinant baculovirus containing porcine pseudorabies virus gB-IgGFc antigen-4 fusion protein gene The construction method of transfer vector, comprising the following steps:
(1) using PRV genome as template, the gB segment of PCR amplification C-terminal transmembrane fragment missing and artificial synthesized IgGFc- His segment；
(2) the gB segment of C-terminal transmembrane fragment missing or IgGFc-His segment are connect with carrier is carrier respectively, Obtain the recombinant vector containing gB or the recombinant vector containing IgGFc-His；
(3) using the recombinant vector containing gB as template, with the first primer to PCR amplification is carried out, the first pcr amplification product is obtained For GP67 signal peptide-gB-His label target fragment；
(4) using the GP67 signal peptide-gB-His label target fragment and the recombinant vector containing IgGFc-His as template, Fusion DNA vaccine amplification is carried out with the second primer pair, the second pcr amplification product of acquisition is GP67 signal peptide-gB-IgGFc-His label Target fragment；
Using second pcr amplification product as template, restriction enzyme site is added respectively, obtains to both ends and is connected separately with BamHI With the GP67 signal peptide-gB-IgGFc-His label target fragment of EcoRI restriction enzyme site and both ends be connected separately with XbaI and GP67 signal peptide-gB-His label the target fragment of HindIII restriction enzyme site；
(5) both ends are connected separately with to the GP67 signal peptide-gB-IgGFc-His of BamHI and EcoRI restriction enzyme site Label target fragment and both ends are connected separately with the GP67 signal peptide-gB-IgGFc-His mark of XbaI and HindIII restriction enzyme site Label target fragment is connected in baculovirus transfer vector, is obtained containing porcine pseudorabies virus gB-IgGFc antigen-4 fusion protein gene Recombinant baculovirus transfer vector.
In the present invention, described using PRV genome as template, the gB segment of PCR amplification C-terminal transmembrane fragment missing and people The operating method of work synthesis IgGFc-His segment is same as above, and is not repeated them here again.
In the present invention, the gB segment of C-terminal transmembrane fragment missing or IgGFc-His segment are carried with basis respectively The operating method of body connection is same as above, and is not repeated them here again.
In the present invention, same to the operating method for carrying out PCR amplification with the first primer using the recombinant vector containing gB as template On, it does not repeat them here again.
In the present invention, second primer pair preferably includes 5 ' the end addition GP67 that gB is shown such as SEQ ID No.10 The forward primer of signal peptide sequence, if SEQ ID No.11 show the reverse primer of 3 ' the end addition homology arm sequences of gB, such as SEQ ID No.12 show the forward primer of 5 ' the end addition homology arm sequences of IgGFc and as SEQ ID No.13 is shown The reverse primer of 3 ' the end addition His sequence labels of IgGFc.Second primer pair carries out response procedures when fusion DNA vaccine amplification: 94 DEG C, 5min；(94 DEG C, 30s；65 DEG C, 30s；72 DEG C, 1kb/min) 30 circulations；72 DEG C, 5min；It is anti-when the PCR amplification Answer system are as follows: 50 μ l:10X buffer (contain Mg2+), 5 μ l；DNTP, 6 μ l；10 μM of forward primers, 2 μ l；10 μM of reverse primers, 2 μ l；Template (HBM-gD-His or IgGFc-His), 200ng；Taq, 0.5 μ l；ddH2O supplies system；Amplification system 2:50 μ l: 10X buffer (contains Mg2+), 5 μ l；DNTP, 6 μ l；10 μM of forward primers, 2 μ l；10 μM of reverse primers, 2 μ l；(the HBM letter of template 1 Number peptide-gD-His), 200ng；Template 2 (IgGFc-His), 200ng；Taq, 0.5 μ l；ddH2O supplies system.
In the present invention, using second pcr amplification product as template, restriction enzyme site is added respectively, obtains both ends difference The method for being connected with the GP67 signal peptide-gB-IgGFc-His label target fragment of BamHI and EcoRI restriction enzyme site preferably includes PCR amplification is carried out using SEQ ID No.6 and SEQ ID No.7 to obtain.Primer shown in SEQ ID No.6 makes GP67 signal Add upper BamHI restriction enzyme site in 5 ' ends of peptide-gB-IgGFc-His label target fragment；Primer shown in SEQ ID No.7 makes Add upper EcoRI restriction enzyme site in 3 ' ends of GP67 signal peptide-gB-IgGFc-His label target fragment.SEQ ID No.6 and SEQ Response procedures when ID No.7 progress PCR amplification are preferably as follows: 94 DEG C, 5min；(94 DEG C, 30s；65 DEG C, 30s；72 DEG C, 1kb/ Min), 30 circulations)；72 DEG C, 5min.The reaction system is same as above.
In the present invention, the addition restriction enzyme site must arrive both ends and be connected separately with XbaI and HindIII restriction enzyme site The method of GP67 signal peptide-gB-IgGFc-His label target fragment is preferably included using SEQ ID No.8 and SEQ ID No.9 PCR amplification is carried out to obtain.Primer shown in SEQ ID No.8 makes GP67 signal peptide-gB-IgGFc-His label target fragment Add upper XbaI enzyme cutting site in 5 ' ends.Primer shown in SEQ ID No.9 makes GP67 signal peptide-gB-IgGFc-His label purpose Add upper HindIII restriction enzyme site in 3 ' ends of segment.SEQ ID No.8 and SEQ ID No.9 carries out reaction interval when PCR amplification Sequence is preferably as follows: 94 DEG C, 5min；(94 DEG C, 30s；65 DEG C, 30s；72 DEG C, 1kb/min), 30 circulations；72 DEG C, 5min.It is described Reaction system is same as above.
The present invention provides the recombination of a kind of expression porcine pseudorabies virus gB albumen or gB-IgGFc fusion protein is rod-shaped Virus transfects recombinant baculovirus transfer vector prepared by above-mentioned construction method to insect cell, and disease occurs in culture to cell Become, collects supernatant and obtain.
In the present invention, the recombinant baculovirus transfer vector transfects to the method for insect cell and preferably uses lipid The transfection of body mediated transfection method.The present invention is not particularly limited the type of the insect cell, using elder brother known in the art Worm cell.In embodiments of the present invention, the insect cell is preferably Sf9 insect cell.The present invention is to thin after transfection The method of born of the same parents' culture is not particularly limited, using the transfection cell culture processes of this field routine.The present invention waits for described thin After lesion occur in born of the same parents, supernatant is collected using conventional centrifugal method.
Recombinant baculovirus transfer vector of the present invention or the method construct to obtain recombinant baculovirus transfer vector Or application of the recombinant baculovirus in the vaccine of production porcine pseudorabies.
In the present invention, the method for the vaccine of the production porcine pseudorabies preferably includes following steps: expression pig is pseudo- The recombinant baculovirus of hydrophobin gB albumen or gB--IgGFc fusion protein is with 0.1MOI dose inoculation transfection insect cell In, continue to cultivate, when lesion occurs in cell, collect supernatant, finds gB and gB- by Westernblot analysis detection IgGFc fusion protein is secreted in supernatant.
The present invention provides a kind of subunit vaccines for preventing and treating porcine pseudorabies, including one in adjuvant and following albumen Kind: the porcine pseudorabies virus gB albumen of the recombinant baculovirus expression and the gB- of the recombinant baculovirus expression IgGFc fusion protein.
In the present invention, the concentration of the porcine pseudorabies virus gB albumen is preferably 200~300 μ g/ml, more preferably 250μg/ml；The concentration of the gB-IgGFc fusion protein is 150~200 μ g/ml, more preferably 180 μ g/ml.
In the present invention, the adjuvant is preferably SEPPIC IMS-1313 adjuvant.GB the or gB-IgGFc albumen and assistant The volume ratio of agent is preferably 7:3.The collunarium dosage of subunit vaccine of the present invention is preferably 20 μ g/ only 6 week old mouse, institute The kind for stating mouse is Babic.After first immunisation 14 days it is primary with same dosage booster immunization.
Below with reference to embodiment to porcine pseudorabies virus gB Protein reconstitution baculovirus transfer vector provided by the invention, Recombinant baculovirus virus and its preparation method and application is described in detail, but they cannot be interpreted as to the present invention The restriction of protection scope.
Embodiment 1
The building side of recombinant baculovirus transfer vector PFBD-2-PRVgB containing porcine pseudorabies virus gB protein gene Method
The gene gB of artificial synthesized coding C-terminal transmembrane fragment missing, the gB is connect with pEASYBLUNT carrier and is obtained PEASYBLUNT-gB recombinant vector is obtained, then sequence verification, it is correct spare after as a result comparing.
Using plasmid pEASYBLUNT-gB as template, PCR amplification acquisition is carried out by 2 groups of primer pairs respectively and is connected with GP67 The gB gene of signal peptide sequence, so by BamHI and EcoRI, XbaI and HindIII target gene is cloned into respectively it is rod-shaped Baculovirus transfer vector PFBDHmHNM1P10eEFP abbreviation PFBD (throws away referring to a kind of expression of Chinese patent 200910063217.6 and repairs Adorn the recombinant baculovirus of the sandwich H1N1 influenza virus HA-NA-M1 gene of synthesis).Specially using pEASYBLUNT-gB as mould Plate obtains GP67-gB-His label target fragment to PCR amplification is carried out respectively with the first primer；Amplification is obtained with the first primer The segment GP67 signal peptide-gB-His labeled targets sequence obtained is template, carries out PCR amplification respectively with the second primer pair and is connected GP67 signal peptide-gB-His labeled targets the sequence and acquisition for being connected to BamHI and EcoRI restriction enzyme site be connected with XbaI and GP67 signal peptide-gB-His labeled targets the sequence of HindIII restriction enzyme site.The wherein sequence of first group of primer pair such as SEQ ID Shown in No.3 and SEQ ID No.4, SEQ ID No.5；It is connected with the primer such as SEQ ID of XbaI and HindIII restriction enzyme site No.6, SEQ ID No.7 are connected with primer such as SEQ ID No.8, the SEQ ID No.9 institute of BamHI and EcoRI restriction enzyme site Show；The primer sequence is shown in Table 1.
1 primer sequence information list of table
The transfer vector of acquisition is by BamHI and EcoRI, SpeI and HindIII digestion identification, as a result A institute as shown in figure 1 Show, wherein M is 15000bp Marker.Digestion identification clip size is consistent with expected results as the result is shown for digestion, expression transfer Vector construction success.Transfer vector PFBD-2-PRV-gB contains the PRV gB gene order of 2 copies.
Embodiment 2
The construction method of recombinant baculovirus AC-2-PRVgB
1 μ g Baculovirus transfer plasmids PFBD-2-PRV-gB is taken to be added in DHI0Bac large intestine sense bacterium competence cell, After ice bath 30 minutes.The heat shock 45 seconds in 42 DEG C of water, then ice bath 2 minutes, add 900 microlitres of SOC fluid nutrient mediums, 37 DEG C of shakings 4h is cultivated, takes 100 microlitres to be coated on three anti-LB plates (Kan, Gen and Tel), 37 DEG C of 24~48h of culture.Picking is blue by 3 wheels The single white bacterium colony of white screening contains in the anti-LB culture medium of suitable concentration kanamycins, gentamicin, tetracycline three in 10mL, 16h is cultivated in 37 DEG C of shaking tables (180rpm/min).Bacterium is collected by centrifugation, 0.3mLSolution I is added and is resuspended, is added 0.3mLSolution II is mixed gently, and 0.3mLSoution III is added immediately and mixes, ice bath 10min, 4 DEG C of 12000rpm centrifugations 10min shifts supernatant in the 1.5mLEP pipe of another sterile blank, is added after 0.5mL isopropanol mixes and stands 10min, and 4 DEG C 12000rpm is centrifuged 10min, discards after supernatant with 75% ethanol washing, 30~50 μ LTE dissolution is added after dry, 4 DEG C save.
, will the positive rod granule transfection Sf 9 insect cell of identification using liposome mediated transfection method: by Sf9 cell inoculation in It in six orifice plates, is transfected when cell grows to 80~90%, takes the sterile Ep pipe of two 1.5mL.100 μ L are added in A pipe without blood 100 μ L serum-free Grace ' s culture mediums and 1- are sequentially added in clear Grace ' s culture medium and 8 μ Lcellinfection, pipe B The Bacmid of 2ug recombination, is stored at room temperature 5-10min, the solution in pipe B is gradually added dropwise in pipe A, 20min is stored at room temperature, Then serum-free Grace ' s culture medium is added to 1mL.Mixture in 1.5mLEp pipe is added on cell monolayer, is trained in 27 DEG C It supports in case and cultivates 5-6h, replace complete Grace ' s culture solution, continue 2~3d of culture, after cytopathy to appear, collect training It supports object supernatant and obtains recombinant baculovirus AC-2-PRVgB.
Embodiment 3
The nucleotide sequence gB and coding mouse IgG 2aFc albumen of the coding gB albumen of artificial synthesized transmembrane fragment missing Nucleotide sequence IgG2aFc；The ratio that the gB or IgG2aFc and pEASYBLUNT carrier are 0.5~4:1 according to volume ratio Example mixed room temperature reacts 5min, and connection obtains pEASYBLUNT-gB and pEASYBLUNT-IgG2aFc recombinant vector, and sequencing is tested Card, it is correct spare after as a result comparing.
Using pEASYBLUNT-gB as template, connected with the first primer in embodiment 1 to carrying out PCR amplification respectively There is GP67 signal peptide-gB-His label target fragment；With the first primer to amplification obtain product GP67-gB-His label and PEASYBLUNT-IgG2aFc is template, carries out PCR amplification acquisition respectively with the second primer pair and is connected with BamHI and EcoRI enzyme GP67 signal peptide-gB-IgG2aFc-His the target fragment of enzyme site；The segment GP67-gB- that amplification is obtained with the first primer IgG2aFc-His and pEASYBLUNT-IgGFc is connected with BamHI and EcoRI digestion position with third primer pair amplifies for template GP67 signal peptide-gB-IgG2aFc-His sequence the target fragment of point.
The wherein sequence of second group of primer pair such as SEQ ID No.10, SEQ ID No.11, SEQ ID No.12 and SEQ Shown in ID No.13；The primer sequence is shown in Table 2.
2 primer sequence information list of table
Sequence Number
gccaccatgctactagtaaatcagtcacaccaag-F SEQ ID No.10
ccacctcctccggacccacccccgcctgatccgttgtggtccaccttgaccacgcggtc-R SEQ ID No.11
ggggtgggtccggaggaggtggctcgggatctgagcccagagggcccacaatcaagccc-F SEQ ID No.12
ctagtgatggtgatggtgatgagagcccgatcc-R SEQ ID No.13
GP67 signal peptide sequence will be connected with and is connected with the gB-IgGFc target fragment of BamHI and EcoRI restriction enzyme site, It is connected with GP67 signal peptide sequence and the gB-IgG2aFc target fragment for being connected with XbaI and HindIII restriction enzyme site is connected to bar Baculovirus transfer vector PFBD-2-PRVgB-IgG2aFc is obtained in shape Baculovirus transfer vector PFBDHmHNM1P10eEFP.
Double digestion identifies baculovirus transfer vector PFBD-2-PRVgB-IgG2aFc.As a result as shown in figure 1 shown in B, wherein M For 15000bp Marker.Digestion identification clip size is consistent with expected results as the result is shown for digestion, expression transfer vector building Success.Digestion qualification result shows that transfer vector PFBD-2-PRV-gB contains the PRV gB gene order of 2 copies.
According to the recombinant baculovirus AC-2- of the construction method preparation expression gB-IgGFc fusion protein of embodiment 2 PRVgB-IgG2aFc。
Embodiment 4
It is rod-shaped with recombination obtained in recombinant baculovirus AC-2-PRVgB obtained in embodiment 2 and embodiment 3 respectively Viral AC-2-PRVgB-IgG2aFc is that object uses Westernblot analysis detection gB gene and gB-IgG2aFc fusion Expression
By sf9 cell inoculation 6 orifice plates, when cell it is long to 90% when, with the weight in 0.1MOI dose inoculation embodiment 2 or 3 Group baculoviral.Inoculation collected cells and supernatant and cell after 72 hours respectively.After SDA-PAGE runs glue, it is transferred to pvdf membrane, His antibody is commercialized as primary antibody (MBL, the U.S.), the sheep anti-mouse igg (Wuhan doctor's moral biology) of HRP label is secondary antibody, is passed through ECL shows that liquid detects APPVE2 protein expression.Experimental result is as shown in left figure in Fig. 2 and Fig. 3.Wherein left figure in Fig. 2 occurs one , there is the band of a 90KDa in the band of 71KDa, left figure in Fig. 3.It can be seen that recombinant virus bacillus AC-2-PRVgB and In the gB albumen and gB-IgG2aFc fusion protein secretion supernatant of the expression of AC-2-PRVgB-IgG2aFc infected insect cell.
The gB albumen and gB-IgG2aFc fusion protein of SDA-PAGE detection purifying
The recombinant baculovirus AC-2-PRVgB or AC-2-PRVgB- that will be obtained in embodiment 2 with 0.0001MOI dosage IgG2aFc is inoculated with HF cell (1*106/ ml), inoculation is collected after 4 days or 5 days, 4 degree of preservations.It can also be direct after collecting 10000rpm is centrifuged 10min, harvests culture supernatant.0.45mm or 0.22 μm of filter filters supernatant.Take 20ml equilibration buffer The His filler balanced, is added in the supernatant of filtering, and 4 degree are stirred overnight.By gB albumen overnight in conjunction with His filler or GB-IgGFc fusion protein is put into pillar, is freely dripped, and will be flowed through liquid again in conjunction with His, is freely dripped.0mm imidazoles 10mmTris-200mmNaCl buffer elutes 2 column volumes, and then 20mm imidazoles 10mmTris-200mmNaCl buffer is washed De- 2 column volumes carry out washing foreign protein.Last 200mm imidazoles 10mmTris-200mmNaCl buffer elutes 2 column volumes, into The elution of row destination protein.Albumen takes 30~50 μ l samples to carry out SDS-PAGE detection by de- imidazoles processing after elution.
SDA-PAGE analysis recombinant baculovirus AC-2-PRV-gB protein expression electrophoretogram is as shown in right in Figure 2, wherein There is 71KDa or so and is purified into specific band.SDA-PAGE analyzes recombinant baculovirus AC-2-PRV-gB-IgG2aFc Protein expression electrophoretogram is as shown in right in Figure 3, wherein 90KDa or so occur is purified into specific band.Recombinant virus The gB albumen and gB-IgGFc fusion protein of bacillus AC-2-PRVgB and AC-2-PRVgB-IgG2aFc infected insect cell expression It secretes in supernatant.
Embodiment 5
The vaccine for preventing and treating porcine pseudorabies
(1), rod-shaped disease AC-2-PRVgB and AC-2-PRVgB-IgG2aFc subunit vaccine preparation is recombinated
The AC-2-PRVgB-IgG2aFc of recombinant baculovirus AC-2-PRVgB and the preparation of embodiment 3 are obtained with embodiment 2, According to 0.0001MOI dose inoculation HF cell (1*106/ ml), after culture 5 days, supernatant is harvested by centrifugation, through ni-sepharose purification, SDS-PAGE detection.GB and gB-IgG2aFc protein content is calculated, the concentration of gB albumen is 200 μ g/ml in vaccine；In vaccine The concentration of gB-IgGFc albumen is 300 μ g/ml.Emulsification system is carried out with the IMS-1313 adjuvant of 200 μ g/ml dosage and SEPPIC Standby subunit vaccine, every immune 20 μ g albumen.It prepares subunit vaccine and is stored in 4 degree of preservations after steriling test.
(2), the safety of the subunit vaccine of recombinant baculovirus AC-2-PRVgB and AC-2-PRVgB-IgG2aFc preparation Property test.
The subunit vaccine is prepared, 6 week old Babic mouse are immunized respectively, every batch of is inoculated with 12 mouse respectively.Inoculation side Formula is Nasal immunization.Test result shows that body temperature after vaccine inoculation, spirit and appetite are normal.Confirm that the vaccine on mouse is equal It is safe.
(3), the subunit vaccine of recombinant baculovirus AC-2-PRVgB and AC-2-PRVgB-IgG2aFc preparation is in mouse On Study On Immunogenicity
For the validity of the subunit vaccine of system evaluation These parameters.It is small to buy 6-7 week old PCR detection PRV feminine gender Mouse 60, it is randomly divided into 4 groups.Only, immunization route is Nasal immunization to 20 μ g/ of immunizing dose.After first immunisation 14 days with same agent It is primary to measure booster immunization.It takes a blood sample before immune and before 14,28,42 days immune under eyelid, 42 days separation splenic lymphocytes is immunized, pass through GD and gB albumen stimulation separation lymphocyte, harvests supernatant, measures cytokine content.
1. body generates the detection of specific antibody for being directed to PRV
Indirect elisa method detects PRV antibody, and operating procedure is as follows: being purified with recombinant baculovirus expression of the invention PRgB albumen is coated with elisa plate, carries out square matrix titration, determines every 0.5 μ g of hole coating, 4 DEG C overnight.Then 37 DEG C of 1%BSA are used Close 1h.The diluted serum to be checked of 50 μ L100 times is added in every hole after washing, is incubated for 1h.50 μ L10000 are added in washing 3 times, every hole The sheep anti mouse or rabbit igg of diluted HRP label again, 37 degree of incubation 1h.Tmb substrate solution, color development at room temperature are added after washing 10min.50 μ L2mol/LH are added in every hole2SO4Stop bath terminates reaction, measures OD450Value.The result shows that immune the present embodiment The subunit vaccine of preparation, in addition to PBS group, all groups of generation PRV specific IgG antibodies at 14,28,42dpi, and Reach peak value at 42dpi.In addition, the mouse IgG antibody titre of inoculation gD-IgG2aFc and gB-IgG2aFc is above inoculation gD With the mouse (as shown in Figure 4) of gB.The subunit of the above results confirmation, AC-2-PRVgB and AC-2-PRVgB-IgG2aFc preparation Vaccine can effectively induce the atopic antibody for generating and being directed to APPV.Obviously, the PRV specificity that gB-IgG2aFc immune group generates IgG antibody is apparently higher than gD or gB immune group.Exempt from these results indicate that Antigen Fusion to IgG2aFc can be effectively facilitated body fluid Epidemic disease reaction.
2. body generates specific cell immunoreaction detection
(1) sterile taking-up mouse spleen is set after cleaning in the plate for filling incomplete RPMI-1640, is transferred to sterile homogenate In device, add a little incomplete 1640, be lightly ground, add incomplete RPMI-1640 and mix, filters removal tissue through cellular filter Fragment.Gentle aspiration filtered fluid enters in 15ml centrifuge tube, and 1000rpm is centrifuged 10min.Supernatant is abandoned, the sterile 8.3g/L of 5ml is added NH4Cl, static 5min (removal red blood cell), 1000rpm is centrifuged 10min.Supernatant is abandoned, full RPMI-1640 washing is cannotd be used up, 1000rpm is centrifuged 10min.Supernatant is abandoned, precipitating is suspended with complete 2.5mlRPMI-1640 (containing 10%FBS).Cell count, platform are expected Indigo plant dyeing, it is desirable that cell activity should be 95% or more.Adjusting cell concentration is 1 × 106/mL.12 orifice plates, every hole are added after mixing 500μL.The gB albumen of each sample purifying, canavalin (positive control) and culture solution (negative control) stimulation, and every kind of thorn Sharp object does 3 repetitions；12 porocyte culture plates are placed 37 DEG C, 5%CO2It is cultivated in incubator for 24 hours, is then centrifuged for harvest supernatant. IFN-γ and IL-4 protein expression water in supernatant are detected respectively with commercialization mouse IFN-γ and IL-4ELISA detection kit Flat, kit uses double crush syndrome.
The result shows that the IL-4 concentration of four subunit vaccine immune groups is apparently higher than IFN-γ.Furthermore gB-IgGFc exempts from The IL-4 concentration of epidemic disease group is apparently higher than that (Fig. 5, wherein left figure is the variation of IL-4 concentration, right figure in three processing groups in gD or gB group For the concentration variation of IFN-γ in three processing groups).These statistics indicate that, PRVgD the or gB albumen for connecting Fc can significantly promote Into cell immune response.
(4), the subunit vaccine of recombinant baculovirus AC-2-PRVgB and AC-2-PRVgB-IgG2aFc preparation is in mouse On attack malicious Protection
In order to assess suitability of the mouse IgG 2aFc segment as potential molecule adjuvant, all equal intranasal infections of mouse 100LD50PRVGX street strain.During monitoring, the protective rate of difference group is as shown in Figure 6.After attacking poison, gB-IgG2aFc group Protective rate is apparently higher than gB group.The mouse of immune gB-IgG2aFc all survives, without any clinical symptoms；Immune gD-IgG2aFc Mouse survival rate be 83%；The mouse survival rate of immune gD is 50%；The mouse survival rate of immune gB-IgG2aFc is 67% (as shown in Figure 6).These statistics indicate that PRVgD the or gB albumen of recombinant baculovirus expression can be effectively protected mouse from PRV infection.In addition, gB can achieve optimal protecting effect with merging for IgG2aFc segment subunit vaccine.
The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered It is considered as protection scope of the present invention.
Sequence table
<110>Hua Zhong Agriculture University
<120>recombinant baculovirus transfer vector, recombinant baculovirus and the preparation of the protein gene of gB containing porcine pseudorabies virus Methods and applications
<160> 22
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2082
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
gcggccgtga cgcgggccgc ctcggcctcg cccgcgcccg ggacgggcgc caccccagac 60
ggcttctccg cggaggagtc cctcgaggag atcgacgggg ccgtctcccc cggcccctcg 120
gacgcccccg acggcgagta cggcgacctg gacgcgcgca cggccgtgcg cgcggccgcg 180
accgagcggg accgcttcta cgtctgcccg ccgccgtccg gctccacggt ggtgcgcctg 240
gagcccgagc aggcctgccc cgagtactcg caggggcgca acttcacgga ggggatcgcc 300
gtgctcttca aggagaacat cgccccgcac aagttcaagg cccacatcta ctacaagaac 360
gtcatcgtca cgaccgtgtg gtccgggagc acgtacgcgg ccatcacgaa ccgcttcacg 420
gaccgcgtgc ccgtccccgt gcaggagatc acggacgtga tcgaccgccg cggcaagtgc 480
gtctccaagg ccgagtacgt gcgcaacaac cacaaggtga ccgccttcga ccgcgacgag 540
aaccccgtcg aggtggacct gcgcccctcg cgcctgaacg cgctcggcac ccgcggctgg 600
cacaccacca acgacaccta caccaagatc ggcgccgcgg gcttctacca cacgggcacc 660
tccgtcaact gcatcgtcga ggaggtggag gcgcgctccg tgtaccccta cgactccttc 720
gccctgtcca cgggggacat cgtgtacatg tcccccttct acggcctgcg cgagggggcc 780
cacggggagc acatcggcta cgcgcccggg cgcttccagc aggtggagca ctactacccc 840
atcgacctgg actcgcgcct ccgcgcctcc gagagcgtga cgcgcaactt tctgcgcacg 900
ccgcacttca cggtggcctg ggactgggcc cccaagacgc ggcgcgtgtg cagcctggcc 960
aagtggcgcg aggccgagga gatgatccgc gacgagacgc gcgacgggtc cttccgcttc 1020
acgtcgcggg ccctgggcgc ctccttcgtc agcgacgtca cgcagctcga cctgcagcgc 1080
gtgcacctgg gcgactgcgt cctccgcgag gcctcggagg ccatcgacgc catctaccgg 1140
cggcgctaca acaacacgca cgtgctggcc ggcgacaagc ccgaggtgta cctcgcccgc 1200
gggggcttcg tggtggcctt ccgcccgctg atctcgaacg agctggcgca gctgtacgcg 1260
cgcgagctcg agcgcctcgg cctcgccggc gtcgtgggcc ccgcgtcccc cgcggccgcc 1320
cgtcgggccc ggcgctcccc cggcccggcg gggacgcccg agccgccggc cgtcaacggc 1380
acggggcacc tgcgcatcac cacgggctcg gccgagtttg cgcgcctgca gttcacctac 1440
gaccacatcc aggcgcacgt gaacgacatg ctgagccgca tcgcggccgc ctggtgcgag 1500
ctgcagaaca aggaccgcac cctgtggggc gagatgtcgc gcctgaaccc cagcgccgtg 1560
gccacggccg cgctgggcca gcgcgtctcg gcgcgcatgc tcggcgacgt gatggccatc 1620
tcgcggtgcg tggaggtgcg cggcggcgtg tacgtgcaga actccatgcg cgtgcccggc 1680
gagcgcggca cgtgctacag ccgcccgctg gtgaccttcg agcacaacgg cacgggcgtg 1740
atcgagggcc agctcggcga cgacaacgag ctcctcatct cgcgcgacct catcgagccc 1800
tgcaccggca accaccggcg ctactttaag ctgggcggcg ggtacgtgta ctacgaggac 1860
tacagctacg tgcgcatggt ggaggtgccc gagacgatca gcacgcgggt gaccctgaac 1920
ctgacgctgc tcgaggaccg cgagttcctg cccctcgagg tgtacacgcg cgaggagctc 1980
gccgacacgg gcctcctgga ctacagcgag atccagcgcc gcaaccagct gcacgcgctc 2040
aagttctacg acattgaccg cgtggtcaag gtggaccaca ac 2082
<210> 2
<211> 699
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
gagcccagag ggcccacaat caagccctgt cctccatgca aatgcccagc acctaacctc 60
ttgggtggac catccgtctt catcttccct ccaaagatca aggatgtact catgatctcc 120
ctgagcccca tagtcacatg tgtggtggtg gatgtgagcg aggatgaccc agatgtccag 180
atcagctggt ttgtgaacaa cgtggaagta cacacagctc agacacaaac ccatagagag 240
gattacaaca gtactctccg ggtggtcagt gccctcccca tccagcacca ggactggatg 300
agtggcaagg agttcaaatg caaggtcaac aacaaagacc tgccagcgcc catcgagaga 360
accatctcaa aacccaaagg gtcagtaaga gctccacagg tatatgtctt gcctccacca 420
gaagaagaga tgactaagaa acaggtcact ctgacctgca tggtcacaga cttcatgcct 480
gaagacattt acgtggagtg gaccaacaac gggaaaacag agctaaacta caagaacact 540
gaaccagtcc tggactctga tggttcttac ttcatgtaca gcaagctgag agtggaaaag 600
aagaactggg tggaaagaaa tagctactcc tgttcagtgg tccacgaggg tctgcacaat 660
caccacacga ctaagagctt ctcccggact ccgggtaaa 699
<210> 3
<211> 76
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
taagcgctat tgttttatat gtgcttttgg cggcggcggc gcattctgcc tttgcggcgg 60
ccgtgacgcg ggccgc 76
<210> 4
<211> 85
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
gccaccatgc tactagtaaa tcagtcacac caaggcttca ataaggaaca cacaagcaag 60
atggtaagcg ctattgtttt atatg 85
<210> 5
<211> 59
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
ctagtgatgg tgatggtgat gagagcccga tccgcggtgg cgcgagacgc ccggcgcgg 59
<210> 6
<211> 34
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
ggatccgcca ccatgctact agtaaatcag tcac 34
<210> 7
<211> 35
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
gaattcctag tgatggtgat ggtgatgaga gcccg 35
<210> 8
<211> 34
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
tctagagcca ccatgctact agtaaatcag tcac 34
<210> 9
<211> 35
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
aagcttctag tgatggtgat ggtgatgaga gcccg 35
<210> 10
<211> 34
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
gccaccatgc tactagtaaa tcagtcacac caag 34
<210> 11
<211> 59
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
ccacctcctc cggacccacc cccgcctgat ccgttgtggt ccaccttgac cacgcggtc 59
<210> 12
<211> 59
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 12
ggggtgggtc cggaggaggt ggctcgggat ctgagcccag agggcccaca atcaagccc 59
<210> 13
<211> 33
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 13
ctagtgatgg tgatggtgat gagagcccga tcc 33
<210> 14
<211> 2745
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 14
atgcccgctg gtggcggtct ttggcgcggg ccccgcgggc atcggcccgg gcaccacggc 60
ggtgctggcc tcggacgtct ttggcctgct ccacaccacg ctgcagctgc gcggggcgcc 120
gtcgcgctag cgctgctgct gctggcgctc gccgcgaccc cgacgtgcgg cgcggcggcc 180
gtgacgcggg ccgcctcggc ctcgcccgcg cccgggacgg gcgccacccc agacggcttc 240
tccgcggagg agtccctcga ggagatcgac ggggccgtct cccccggccc ctcggacgcc 300
cccgacggcg agtacggcga cctggacgcg cgcacggccg tgcgcgcggc cgcgaccgag 360
cgggaccgct tctacgtctg cccgccgccg tccggctcca cggtggtgcg cctggagccc 420
gagcaggcct gccccgagta ctcgcagggg cgcaacttca cggaggggat cgccgtgctc 480
ttcaaggaga acatcgcccc gcacaagttc aaggcccaca tctactacaa gaacgtcatc 540
gtcacgaccg tgtggtccgg gagcacgtac gcggccatca cgaaccgctt cacggaccgc 600
gtgcccgtcc ccgtgcagga gatcacggac gtgatcgacc gccgcggcaa gtgcgtctcc 660
aaggccgagt acgtgcgcaa caaccacaag gtgaccgcct tcgaccgcga cgagaacccc 720
gtcgaggtgg acctgcgccc ctcgcgcctg aacgcgctcg gcacccgcgg ctggcacacc 780
accaacgaca cctacaccaa gatcggcgcc gcgggcttct accacacggg cacctccgtc 840
aactgcatcg tcgaggaggt ggaggcgcgc tccgtgtacc cctacgactc cttcgccctg 900
tccacggggg acatcgtgta catgtccccc ttctacggcc tgcgcgaggg ggcccacggg 960
gagcacatcg gctacgcgcc cgggcgcttc cagcaggtgg agcactacta ccccatcgac 1020
ctggactcgc gcctccgcgc ctccgagagc gtgacgcgca actttctgcg cacgccgcac 1080
ttcacggtgg cctgggactg ggcccccaag acgcggcgcg tgtgcagcct ggccaagtgg 1140
cgcgaggccg aggagatgat ccgcgacgag acgcgcgacg ggtccttccg cttcacgtcg 1200
cgggccctgg gcgcctcctt cgtcagcgac gtcacgcagc tcgacctgca gcgcgtgcac 1260
ctgggcgact gcgtcctccg cgaggcctcg gaggccatcg acgccatcta ccggcggcgc 1320
tacaacaaca cgcacgtgct ggccggcgac aagcccgagg tgtacctcgc ccgcgggggc 1380
ttcgtggtgg ccttccgccc gctgatctcg aacgagctgg cgcagctgta cgcgcgcgag 1440
ctcgagcgcc tcggcctcgc cggcgtcgtg ggccccgcgt cccccgcggc cgcccgtcgg 1500
gcccggcgct cccccggccc ggcggggacg cccgagccgc cggccgtcaa cggcacgggg 1560
cacctgcgca tcaccacggg ctcggccgag tttgcgcgcc tgcagttcac ctacgaccac 1620
atccaggcgc acgtgaacga catgctgagc cgcatcgcgg ccgcctggtg cgagctgcag 1680
aacaaggacc gcaccctgtg gggcgagatg tcgcgcctga accccagcgc cgtggccacg 1740
gccgcgctgg gccagcgcgt ctcggcgcgc atgctcggcg acgtgatggc catctcgcgg 1800
tgcgtggagg tgcgcggcgg cgtgtacgtg cagaactcca tgcgcgtgcc cggcgagcgc 1860
ggcacgtgct acagccgccc gctggtgacc ttcgagcaca acggcacggg cgtgatcgag 1920
ggccagctcg gcgacgacaa cgagctcctc atctcgcgcg acctcatcga gccctgcacc 1980
ggcaaccacc ggcgctactt taagctgggc ggcgggtacg tgtactacga ggactacagc 2040
tacgtgcgca tggtggaggt gcccgagacg atcagcacgc gggtgaccct gaacctgacg 2100
ctgctcgagg accgcgagtt cctgcccctc gaggtgtaca cgcgcgagga gctcgccgac 2160
acgggcctcc tggactacag cgagatccag cgccgcaacc agctgcacgc gctcaagttc 2220
tacgacattg accgcgtggt caaggtggac cacaacgtgg tgctgctgcg cggcatcgcc 2280
aacttcttcc agggcctcgg cgacgtgggc gccgccgtcg gcaaggtggt cctgggcgcc 2340
acgggggccg tgatctcggc cgtcggcggc atggtgtcct tcctgtccaa ccccttcggg 2400
gcgctcgcca tcgggctgct ggtgctggcc ggcctggtcg cggccttcct ggcctaccgg 2460
cacatctcgc gcctgcgccg caaccccatg aaggccctgt accccgtcac gacgaaggcg 2520
ctcaaggagg acggcgtcga agaggacgac gtggacgagg ccaagctgga ccaggcccgg 2580
gacatgatcc ggtacatgtc catcgtgtcg gccctcgagc agcaggagca caaggcgcgc 2640
aagaagaaca gcgggcccgc gctgctggcc agccgcgtcg gggcgatggc cacgcgccgc 2700
cggcactacc agcgcctcga gaacgaggac cccgacgccc cctag 2745
<210> 15
<211> 914
<212> PRT
<213>artificial sequence (Artificial Sequence)
<400> 15
Met Pro Ala Gly Gly Gly Leu Trp Arg Gly Pro Arg Gly His Arg Pro
1 5 10 15
Gly His His Gly Gly Ala Gly Leu Gly Arg Leu Trp Pro Ala Pro His
20 25 30
His Ala Ala Ala Ala Arg Gly Ala Val Ala Leu Ala Leu Leu Leu Leu
35 40 45
Ala Leu Ala Ala Thr Pro Thr Cys Gly Ala Ala Ala Val Thr Arg Ala
50 55 60
Ala Ser Ala Ser Pro Ala Pro Gly Thr Gly Ala Thr Pro Asp Gly Phe
65 70 75 80
Ser Ala Glu Glu Ser Leu Glu Glu Ile Asp Gly Ala Val Ser Pro Gly
85 90 95
Pro Ser Asp Ala Pro Asp Gly Glu Tyr Gly Asp Leu Asp Ala Arg Thr
100 105 110
Ala Val Arg Ala Ala Ala Thr Glu Arg Asp Arg Phe Tyr Val Cys Pro
115 120 125
Pro Pro Ser Gly Ser Thr Val Val Arg Leu Glu Pro Glu Gln Ala Cys
130 135 140
Pro Glu Tyr Ser Gln Gly Arg Asn Phe Thr Glu Gly Ile Ala Val Leu
145 150 155 160
Phe Lys Glu Asn Ile Ala Pro His Lys Phe Lys Ala His Ile Tyr Tyr
165 170 175
Lys Asn Val Ile Val Thr Thr Val Trp Ser Gly Ser Thr Tyr Ala Ala
180 185 190
Ile Thr Asn Arg Phe Thr Asp Arg Val Pro Val Pro Val Gln Glu Ile
195 200 205
Thr Asp Val Ile Asp Arg Arg Gly Lys Cys Val Ser Lys Ala Glu Tyr
210 215 220
Val Arg Asn Asn His Lys Val Thr Ala Phe Asp Arg Asp Glu Asn Pro
225 230 235 240
Val Glu Val Asp Leu Arg Pro Ser Arg Leu Asn Ala Leu Gly Thr Arg
245 250 255
Gly Trp His Thr Thr Asn Asp Thr Tyr Thr Lys Ile Gly Ala Ala Gly
260 265 270
Phe Tyr His Thr Gly Thr Ser Val Asn Cys Ile Val Glu Glu Val Glu
275 280 285
Ala Arg Ser Val Tyr Pro Tyr Asp Ser Phe Ala Leu Ser Thr Gly Asp
290 295 300
Ile Val Tyr Met Ser Pro Phe Tyr Gly Leu Arg Glu Gly Ala His Gly
305 310 315 320
Glu His Ile Gly Tyr Ala Pro Gly Arg Phe Gln Gln Val Glu His Tyr
325 330 335
Tyr Pro Ile Asp Leu Asp Ser Arg Leu Arg Ala Ser Glu Ser Val Thr
340 345 350
Arg Asn Phe Leu Arg Thr Pro His Phe Thr Val Ala Trp Asp Trp Ala
355 360 365
Pro Lys Thr Arg Arg Val Cys Ser Leu Ala Lys Trp Arg Glu Ala Glu
370 375 380
Glu Met Ile Arg Asp Glu Thr Arg Asp Gly Ser Phe Arg Phe Thr Ser
385 390 395 400
Arg Ala Leu Gly Ala Ser Phe Val Ser Asp Val Thr Gln Leu Asp Leu
405 410 415
Gln Arg Val His Leu Gly Asp Cys Val Leu Arg Glu Ala Ser Glu Ala
420 425 430
Ile Asp Ala Ile Tyr Arg Arg Arg Tyr Asn Asn Thr His Val Leu Ala
435 440 445
Gly Asp Lys Pro Glu Val Tyr Leu Ala Arg Gly Gly Phe Val Val Ala
450 455 460
Phe Arg Pro Leu Ile Ser Asn Glu Leu Ala Gln Leu Tyr Ala Arg Glu
465 470 475 480
Leu Glu Arg Leu Gly Leu Ala Gly Val Val Gly Pro Ala Ser Pro Ala
485 490 495
Ala Ala Arg Arg Ala Arg Arg Ser Pro Gly Pro Ala Gly Thr Pro Glu
500 505 510
Pro Pro Ala Val Asn Gly Thr Gly His Leu Arg Ile Thr Thr Gly Ser
515 520 525
Ala Glu Phe Ala Arg Leu Gln Phe Thr Tyr Asp His Ile Gln Ala His
530 535 540
Val Asn Asp Met Leu Ser Arg Ile Ala Ala Ala Trp Cys Glu Leu Gln
545 550 555 560
Asn Lys Asp Arg Thr Leu Trp Gly Glu Met Ser Arg Leu Asn Pro Ser
565 570 575
Ala Val Ala Thr Ala Ala Leu Gly Gln Arg Val Ser Ala Arg Met Leu
580 585 590
Gly Asp Val Met Ala Ile Ser Arg Cys Val Glu Val Arg Gly Gly Val
595 600 605
Tyr Val Gln Asn Ser Met Arg Val Pro Gly Glu Arg Gly Thr Cys Tyr
610 615 620
Ser Arg Pro Leu Val Thr Phe Glu His Asn Gly Thr Gly Val Ile Glu
625 630 635 640
Gly Gln Leu Gly Asp Asp Asn Glu Leu Leu Ile Ser Arg Asp Leu Ile
645 650 655
Glu Pro Cys Thr Gly Asn His Arg Arg Tyr Phe Lys Leu Gly Gly Gly
660 665 670
Tyr Val Tyr Tyr Glu Asp Tyr Ser Tyr Val Arg Met Val Glu Val Pro
675 680 685
Glu Thr Ile Ser Thr Arg Val Thr Leu Asn Leu Thr Leu Leu Glu Asp
690 695 700
Arg Glu Phe Leu Pro Leu Glu Val Tyr Thr Arg Glu Glu Leu Ala Asp
705 710 715 720
Thr Gly Leu Leu Asp Tyr Ser Glu Ile Gln Arg Arg Asn Gln Leu His
725 730 735
Ala Leu Lys Phe Tyr Asp Ile Asp Arg Val Val Lys Val Asp His Asn
740 745 750
Val Val Leu Leu Arg Gly Ile Ala Asn Phe Phe Gln Gly Leu Gly Asp
755 760 765
Val Gly Ala Ala Val Gly Lys Val Val Leu Gly Ala Thr Gly Ala Val
770 775 780
Ile Ser Ala Val Gly Gly Met Val Ser Phe Leu Ser Asn Pro Phe Gly
785 790 795 800
Ala Leu Ala Ile Gly Leu Leu Val Leu Ala Gly Leu Val Ala Ala Phe
805 810 815
Leu Ala Tyr Arg His Ile Ser Arg Leu Arg Arg Asn Pro Met Lys Ala
820 825 830
Leu Tyr Pro Val Thr Thr Lys Ala Leu Lys Glu Asp Gly Val Glu Glu
835 840 845
Asp Asp Val Asp Glu Ala Lys Leu Asp Gln Ala Arg Asp Met Ile Arg
850 855 860
Tyr Met Ser Ile Val Ser Ala Leu Glu Gln Gln Glu His Lys Ala Arg
865 870 875 880
Lys Lys Asn Ser Gly Pro Ala Leu Leu Ala Ser Arg Val Gly Ala Met
885 890 895
Ala Thr Arg Arg Arg His Tyr Gln Arg Leu Glu Asn Glu Asp Pro Asp
900 905 910
Ala Pro
<210> 16
<211> 2247
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 16
tctagagcca ccatgctact agtaaatcag tcacaccaag gcttcaataa ggaacacaca 60
agcaagatgg taagcgctat tgttttatat gtgcttttgg cggcggcggc gcattctgcc 120
tttgcggcgg ccgtgacgcg ggccgcctcg gcctcgcccg cgcccgggac gggcgccacc 180
ccagacggct tctccgcgga ggagtccctc gaggagatcg acggggccgt ctcccccggc 240
ccctcggacg cccccgacgg cgagtacggc gacctggacg cgcgcacggc cgtgcgcgcg 300
gccgcgaccg agcgggaccg cttctacgtc tgcccgccgc cgtccggctc cacggtggtg 360
cgcctggagc ccgagcaggc ctgccccgag tactcgcagg ggcgcaactt cacggagggg 420
atcgccgtgc tcttcaagga gaacatcgcc ccgcacaagt tcaaggccca catctactac 480
aagaacgtca tcgtcacgac cgtgtggtcc gggagcacgt acgcggccat cacgaaccgc 540
ttcacggacc gcgtgcccgt ccccgtgcag gagatcacgg acgtgatcga ccgccgcggc 600
aagtgcgtct ccaaggccga gtacgtgcgc aacaaccaca aggtgaccgc cttcgaccgc 660
gacgagaacc ccgtcgaggt ggacctgcgc ccctcgcgcc tgaacgcgct cggcacccgc 720
ggctggcaca ccaccaacga cacctacacc aagatcggcg ccgcgggctt ctaccacacg 780
ggcacctccg tcaactgcat cgtcgaggag gtggaggcgc gctccgtgta cccctacgac 840
tccttcgccc tgtccacggg ggacatcgtg tacatgtccc ccttctacgg cctgcgcgag 900
ggggcccacg gggagcacat cggctacgcg cccgggcgct tccagcaggt ggagcactac 960
taccccatcg acctggactc gcgcctccgc gcctccgaga gcgtgacgcg caactttctg 1020
cgcacgccgc acttcacggt ggcctgggac tgggccccca agacgcggcg cgtgtgcagc 1080
ctggccaagt ggcgcgaggc cgaggagatg atccgcgacg agacgcgcga cgggtccttc 1140
cgcttcacgt cgcgggccct gggcgcctcc ttcgtcagcg acgtcacgca gctcgacctg 1200
cagcgcgtgc acctgggcga ctgcgtcctc cgcgaggcct cggaggccat cgacgccatc 1260
taccggcggc gctacaacaa cacgcacgtg ctggccggcg acaagcccga ggtgtacctc 1320
gcccgcgggg gcttcgtggt ggccttccgc ccgctgatct cgaacgagct ggcgcagctg 1380
tacgcgcgcg agctcgagcg cctcggcctc gccggcgtcg tgggccccgc gtcccccgcg 1440
gccgcccgtc gggcccggcg ctcccccggc ccggcgggga cgcccgagcc gccggccgtc 1500
aacggcacgg ggcacctgcg catcaccacg ggctcggccg agtttgcgcg cctgcagttc 1560
acctacgacc acatccaggc gcacgtgaac gacatgctga gccgcatcgc ggccgcctgg 1620
tgcgagctgc agaacaagga ccgcaccctg tggggcgaga tgtcgcgcct gaaccccagc 1680
gccgtggcca cggccgcgct gggccagcgc gtctcggcgc gcatgctcgg cgacgtgatg 1740
gccatctcgc ggtgcgtgga ggtgcgcggc ggcgtgtacg tgcagaactc catgcgcgtg 1800
cccggcgagc gcggcacgtg ctacagccgc ccgctggtga ccttcgagca caacggcacg 1860
ggcgtgatcg agggccagct cggcgacgac aacgagctcc tcatctcgcg cgacctcatc 1920
gagccctgca ccggcaacca ccggcgctac tttaagctgg gcggcgggta cgtgtactac 1980
gaggactaca gctacgtgcg catggtggag gtgcccgaga cgatcagcac gcgggtgacc 2040
ctgaacctga cgctgctcga ggaccgcgag ttcctgcccc tcgaggtgta cacgcgcgag 2100
gagctcgccg acacgggcct cctggactac agcgagatcc agcgccgcaa ccagctgcac 2160
gcgctcaagt tctacgacat tgaccgcgtg gtcaaggtgg accacaacgg atcgggctct 2220
catcaccatc accatcacta gaagctt 2247
<210> 17
<211> 2229
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 17
atgctactag taaatcagtc acaccaaggc ttcaataagg aacacacaag caagatggta 60
agcgctattg ttttatatgt gcttttggcg gcggcggcgc attctgcctt tgcggcggcc 120
gtgacgcggg ccgcctcggc ctcgcccgcg cccgggacgg gcgccacccc agacggcttc 180
tccgcggagg agtccctcga ggagatcgac ggggccgtct cccccggccc ctcggacgcc 240
cccgacggcg agtacggcga cctggacgcg cgcacggccg tgcgcgcggc cgcgaccgag 300
cgggaccgct tctacgtctg cccgccgccg tccggctcca cggtggtgcg cctggagccc 360
gagcaggcct gccccgagta ctcgcagggg cgcaacttca cggaggggat cgccgtgctc 420
ttcaaggaga acatcgcccc gcacaagttc aaggcccaca tctactacaa gaacgtcatc 480
gtcacgaccg tgtggtccgg gagcacgtac gcggccatca cgaaccgctt cacggaccgc 540
gtgcccgtcc ccgtgcagga gatcacggac gtgatcgacc gccgcggcaa gtgcgtctcc 600
aaggccgagt acgtgcgcaa caaccacaag gtgaccgcct tcgaccgcga cgagaacccc 660
gtcgaggtgg acctgcgccc ctcgcgcctg aacgcgctcg gcacccgcgg ctggcacacc 720
accaacgaca cctacaccaa gatcggcgcc gcgggcttct accacacggg cacctccgtc 780
aactgcatcg tcgaggaggt ggaggcgcgc tccgtgtacc cctacgactc cttcgccctg 840
tccacggggg acatcgtgta catgtccccc ttctacggcc tgcgcgaggg ggcccacggg 900
gagcacatcg gctacgcgcc cgggcgcttc cagcaggtgg agcactacta ccccatcgac 960
ctggactcgc gcctccgcgc ctccgagagc gtgacgcgca actttctgcg cacgccgcac 1020
ttcacggtgg cctgggactg ggcccccaag acgcggcgcg tgtgcagcct ggccaagtgg 1080
cgcgaggccg aggagatgat ccgcgacgag acgcgcgacg ggtccttccg cttcacgtcg 1140
cgggccctgg gcgcctcctt cgtcagcgac gtcacgcagc tcgacctgca gcgcgtgcac 1200
ctgggcgact gcgtcctccg cgaggcctcg gaggccatcg acgccatcta ccggcggcgc 1260
tacaacaaca cgcacgtgct ggccggcgac aagcccgagg tgtacctcgc ccgcgggggc 1320
ttcgtggtgg ccttccgccc gctgatctcg aacgagctgg cgcagctgta cgcgcgcgag 1380
ctcgagcgcc tcggcctcgc cggcgtcgtg ggccccgcgt cccccgcggc cgcccgtcgg 1440
gcccggcgct cccccggccc ggcggggacg cccgagccgc cggccgtcaa cggcacgggg 1500
cacctgcgca tcaccacggg ctcggccgag tttgcgcgcc tgcagttcac ctacgaccac 1560
atccaggcgc acgtgaacga catgctgagc cgcatcgcgg ccgcctggtg cgagctgcag 1620
aacaaggacc gcaccctgtg gggcgagatg tcgcgcctga accccagcgc cgtggccacg 1680
gccgcgctgg gccagcgcgt ctcggcgcgc atgctcggcg acgtgatggc catctcgcgg 1740
tgcgtggagg tgcgcggcgg cgtgtacgtg cagaactcca tgcgcgtgcc cggcgagcgc 1800
ggcacgtgct acagccgccc gctggtgacc ttcgagcaca acggcacggg cgtgatcgag 1860
ggccagctcg gcgacgacaa cgagctcctc atctcgcgcg acctcatcga gccctgcacc 1920
ggcaaccacc ggcgctactt taagctgggc ggcgggtacg tgtactacga ggactacagc 1980
tacgtgcgca tggtggaggt gcccgagacg atcagcacgc gggtgaccct gaacctgacg 2040
ctgctcgagg accgcgagtt cctgcccctc gaggtgtaca cgcgcgagga gctcgccgac 2100
acgggcctcc tggactacag cgagatccag cgccgcaacc agctgcacgc gctcaagttc 2160
tacgacattg accgcgtggt caaggtggac cacaacggat cgggctctca tcaccatcac 2220
catcactag 2229
<210> 18
<211> 742
<212> PRT
<213>artificial sequence (Artificial Sequence)
<400> 18
Met Leu Leu Val Asn Gln Ser His Gln Gly Phe Asn Lys Glu His Thr
1 5 10 15
Ser Lys Met Val Ser Ala Ile Val Leu Tyr Val Leu Leu Ala Ala Ala
20 25 30
Ala His Ser Ala Phe Ala Ala Ala Val Thr Arg Ala Ala Ser Ala Ser
35 40 45
Pro Ala Pro Gly Thr Gly Ala Thr Pro Asp Gly Phe Ser Ala Glu Glu
50 55 60
Ser Leu Glu Glu Ile Asp Gly Ala Val Ser Pro Gly Pro Ser Asp Ala
65 70 75 80
Pro Asp Gly Glu Tyr Gly Asp Leu Asp Ala Arg Thr Ala Val Arg Ala
85 90 95
Ala Ala Thr Glu Arg Asp Arg Phe Tyr Val Cys Pro Pro Pro Ser Gly
100 105 110
Ser Thr Val Val Arg Leu Glu Pro Glu Gln Ala Cys Pro Glu Tyr Ser
115 120 125
Gln Gly Arg Asn Phe Thr Glu Gly Ile Ala Val Leu Phe Lys Glu Asn
130 135 140
Ile Ala Pro His Lys Phe Lys Ala His Ile Tyr Tyr Lys Asn Val Ile
145 150 155 160
Val Thr Thr Val Trp Ser Gly Ser Thr Tyr Ala Ala Ile Thr Asn Arg
165 170 175
Phe Thr Asp Arg Val Pro Val Pro Val Gln Glu Ile Thr Asp Val Ile
180 185 190
Asp Arg Arg Gly Lys Cys Val Ser Lys Ala Glu Tyr Val Arg Asn Asn
195 200 205
His Lys Val Thr Ala Phe Asp Arg Asp Glu Asn Pro Val Glu Val Asp
210 215 220
Leu Arg Pro Ser Arg Leu Asn Ala Leu Gly Thr Arg Gly Trp His Thr
225 230 235 240
Thr Asn Asp Thr Tyr Thr Lys Ile Gly Ala Ala Gly Phe Tyr His Thr
245 250 255
Gly Thr Ser Val Asn Cys Ile Val Glu Glu Val Glu Ala Arg Ser Val
260 265 270
Tyr Pro Tyr Asp Ser Phe Ala Leu Ser Thr Gly Asp Ile Val Tyr Met
275 280 285
Ser Pro Phe Tyr Gly Leu Arg Glu Gly Ala His Gly Glu His Ile Gly
290 295 300
Tyr Ala Pro Gly Arg Phe Gln Gln Val Glu His Tyr Tyr Pro Ile Asp
305 310 315 320
Leu Asp Ser Arg Leu Arg Ala Ser Glu Ser Val Thr Arg Asn Phe Leu
325 330 335
Arg Thr Pro His Phe Thr Val Ala Trp Asp Trp Ala Pro Lys Thr Arg
340 345 350
Arg Val Cys Ser Leu Ala Lys Trp Arg Glu Ala Glu Glu Met Ile Arg
355 360 365
Asp Glu Thr Arg Asp Gly Ser Phe Arg Phe Thr Ser Arg Ala Leu Gly
370 375 380
Ala Ser Phe Val Ser Asp Val Thr Gln Leu Asp Leu Gln Arg Val His
385 390 395 400
Leu Gly Asp Cys Val Leu Arg Glu Ala Ser Glu Ala Ile Asp Ala Ile
405 410 415
Tyr Arg Arg Arg Tyr Asn Asn Thr His Val Leu Ala Gly Asp Lys Pro
420 425 430
Glu Val Tyr Leu Ala Arg Gly Gly Phe Val Val Ala Phe Arg Pro Leu
435 440 445
Ile Ser Asn Glu Leu Ala Gln Leu Tyr Ala Arg Glu Leu Glu Arg Leu
450 455 460
Gly Leu Ala Gly Val Val Gly Pro Ala Ser Pro Ala Ala Ala Arg Arg
465 470 475 480
Ala Arg Arg Ser Pro Gly Pro Ala Gly Thr Pro Glu Pro Pro Ala Val
485 490 495
Asn Gly Thr Gly His Leu Arg Ile Thr Thr Gly Ser Ala Glu Phe Ala
500 505 510
Arg Leu Gln Phe Thr Tyr Asp His Ile Gln Ala His Val Asn Asp Met
515 520 525
Leu Ser Arg Ile Ala Ala Ala Trp Cys Glu Leu Gln Asn Lys Asp Arg
530 535 540
Thr Leu Trp Gly Glu Met Ser Arg Leu Asn Pro Ser Ala Val Ala Thr
545 550 555 560
Ala Ala Leu Gly Gln Arg Val Ser Ala Arg Met Leu Gly Asp Val Met
565 570 575
Ala Ile Ser Arg Cys Val Glu Val Arg Gly Gly Val Tyr Val Gln Asn
580 585 590
Ser Met Arg Val Pro Gly Glu Arg Gly Thr Cys Tyr Ser Arg Pro Leu
595 600 605
Val Thr Phe Glu His Asn Gly Thr Gly Val Ile Glu Gly Gln Leu Gly
610 615 620
Asp Asp Asn Glu Leu Leu Ile Ser Arg Asp Leu Ile Glu Pro Cys Thr
625 630 635 640
Gly Asn His Arg Arg Tyr Phe Lys Leu Gly Gly Gly Tyr Val Tyr Tyr
645 650 655
Glu Asp Tyr Ser Tyr Val Arg Met Val Glu Val Pro Glu Thr Ile Ser
660 665 670
Thr Arg Val Thr Leu Asn Leu Thr Leu Leu Glu Asp Arg Glu Phe Leu
675 680 685
Pro Leu Glu Val Tyr Thr Arg Glu Glu Leu Ala Asp Thr Gly Leu Leu
690 695 700
Asp Tyr Ser Glu Ile Gln Arg Arg Asn Gln Leu His Ala Leu Lys Phe
705 710 715 720
Tyr Asp Ile Asp Arg Val Val Lys Val Asp His Asn Gly Ser Gly Ser
725 730 735
His His His His His His
740
<210> 19
<211> 2970
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 19
atgctactag taaatcagtc acaccaaggc ttcaataagg aacacacaag caagatggta 60
agcgctattg ttttatatgt gcttttggcg gcggcggcgc attctgcctt tgcggcggcc 120
gtgacgcggg ccgcctcggc ctcgcccgcg cccgggacgg gcgccacccc agacggcttc 180
tccgcggagg agtccctcga ggagatcgac ggggccgtct cccccggccc ctcggacgcc 240
cccgacggcg agtacggcga cctggacgcg cgcacggccg tgcgcgcggc cgcgaccgag 300
cgggaccgct tctacgtctg cccgccgccg tccggctcca cggtggtgcg cctggagccc 360
gagcaggcct gccccgagta ctcgcagggg cgcaacttca cggaggggat cgccgtgctc 420
ttcaaggaga acatcgcccc gcacaagttc aaggcccaca tctactacaa gaacgtcatc 480
gtcacgaccg tgtggtccgg gagcacgtac gcggccatca cgaaccgctt cacggaccgc 540
gtgcccgtcc ccgtgcagga gatcacggac gtgatcgacc gccgcggcaa gtgcgtctcc 600
aaggccgagt acgtgcgcaa caaccacaag gtgaccgcct tcgaccgcga cgagaacccc 660
gtcgaggtgg acctgcgccc ctcgcgcctg aacgcgctcg gcacccgcgg ctggcacacc 720
accaacgaca cctacaccaa gatcggcgcc gcgggcttct accacacggg cacctccgtc 780
aactgcatcg tcgaggaggt ggaggcgcgc tccgtgtacc cctacgactc cttcgccctg 840
tccacggggg acatcgtgta catgtccccc ttctacggcc tgcgcgaggg ggcccacggg 900
gagcacatcg gctacgcgcc cgggcgcttc cagcaggtgg agcactacta ccccatcgac 960
ctggactcgc gcctccgcgc ctccgagagc gtgacgcgca actttctgcg cacgccgcac 1020
ttcacggtgg cctgggactg ggcccccaag acgcggcgcg tgtgcagcct ggccaagtgg 1080
cgcgaggccg aggagatgat ccgcgacgag acgcgcgacg ggtccttccg cttcacgtcg 1140
cgggccctgg gcgcctcctt cgtcagcgac gtcacgcagc tcgacctgca gcgcgtgcac 1200
ctgggcgact gcgtcctccg cgaggcctcg gaggccatcg acgccatcta ccggcggcgc 1260
tacaacaaca cgcacgtgct ggccggcgac aagcccgagg tgtacctcgc ccgcgggggc 1320
ttcgtggtgg ccttccgccc gctgatctcg aacgagctgg cgcagctgta cgcgcgcgag 1380
ctcgagcgcc tcggcctcgc cggcgtcgtg ggccccgcgt cccccgcggc cgcccgtcgg 1440
gcccggcgct cccccggccc ggcggggacg cccgagccgc cggccgtcaa cggcacgggg 1500
cacctgcgca tcaccacggg ctcggccgag tttgcgcgcc tgcagttcac ctacgaccac 1560
atccaggcgc acgtgaacga catgctgagc cgcatcgcgg ccgcctggtg cgagctgcag 1620
aacaaggacc gcaccctgtg gggcgagatg tcgcgcctga accccagcgc cgtggccacg 1680
gccgcgctgg gccagcgcgt ctcggcgcgc atgctcggcg acgtgatggc catctcgcgg 1740
tgcgtggagg tgcgcggcgg cgtgtacgtg cagaactcca tgcgcgtgcc cggcgagcgc 1800
ggcacgtgct acagccgccc gctggtgacc ttcgagcaca acggcacggg cgtgatcgag 1860
ggccagctcg gcgacgacaa cgagctcctc atctcgcgcg acctcatcga gccctgcacc 1920
ggcaaccacc ggcgctactt taagctgggc ggcgggtacg tgtactacga ggactacagc 1980
tacgtgcgca tggtggaggt gcccgagacg atcagcacgc gggtgaccct gaacctgacg 2040
ctgctcgagg accgcgagtt cctgcccctc gaggtgtaca cgcgcgagga gctcgccgac 2100
acgggcctcc tggactacag cgagatccag cgccgcaacc agctgcacgc gctcaagttc 2160
tacgacattg accgcgtggt caaggtggac cacaacggat caggcggggg tgggtccgga 2220
ggaggtggct cgggatctga gcccagaggg cccacaatca agccctgtcc tccatgcaaa 2280
tgcccagcac ctaacctctt gggtggacca tccgtcttca tcttccctcc aaagatcaag 2340
gatgtactca tgatctccct gagccccata gtcacatgtg tggtggtgga tgtgagcgag 2400
gatgacccag atgtccagat cagctggttt gtgaacaacg tggaagtaca cacagctcag 2460
acacaaaccc atagagagga ttacaacagt actctccggg tggtcagtgc cctccccatc 2520
cagcaccagg actggatgag tggcaaggag ttcaaatgca aggtcaacaa caaagacctg 2580
ccagcgccca tcgagagaac catctcaaaa cccaaagggt cagtaagagc tccacaggta 2640
tatgtcttgc ctccaccaga agaagagatg actaagaaac aggtcactct gacctgcatg 2700
gtcacagact tcatgcctga agacatttac gtggagtgga ccaacaacgg gaaaacagag 2760
ctaaactaca agaacactga accagtcctg gactctgatg gttcttactt catgtacagc 2820
aagctgagag tggaaaagaa gaactgggtg gaaagaaata gctactcctg ttcagtggtc 2880
cacgagggtc tgcacaatca ccacacgact aagagcttct cccggactcc gggtaaagga 2940
tcgggctctc atcaccatca ccatcactag 2970
<210> 20
<211> 989
<212> PRT
<213>artificial sequence (Artificial Sequence)
<400> 20
Met Leu Leu Val Asn Gln Ser His Gln Gly Phe Asn Lys Glu His Thr
1 5 10 15
Ser Lys Met Val Ser Ala Ile Val Leu Tyr Val Leu Leu Ala Ala Ala
20 25 30
Ala His Ser Ala Phe Ala Ala Ala Val Thr Arg Ala Ala Ser Ala Ser
35 40 45
Pro Ala Pro Gly Thr Gly Ala Thr Pro Asp Gly Phe Ser Ala Glu Glu
50 55 60
Ser Leu Glu Glu Ile Asp Gly Ala Val Ser Pro Gly Pro Ser Asp Ala
65 70 75 80
Pro Asp Gly Glu Tyr Gly Asp Leu Asp Ala Arg Thr Ala Val Arg Ala
85 90 95
Ala Ala Thr Glu Arg Asp Arg Phe Tyr Val Cys Pro Pro Pro Ser Gly
100 105 110
Ser Thr Val Val Arg Leu Glu Pro Glu Gln Ala Cys Pro Glu Tyr Ser
115 120 125
Gln Gly Arg Asn Phe Thr Glu Gly Ile Ala Val Leu Phe Lys Glu Asn
130 135 140
Ile Ala Pro His Lys Phe Lys Ala His Ile Tyr Tyr Lys Asn Val Ile
145 150 155 160
Val Thr Thr Val Trp Ser Gly Ser Thr Tyr Ala Ala Ile Thr Asn Arg
165 170 175
Phe Thr Asp Arg Val Pro Val Pro Val Gln Glu Ile Thr Asp Val Ile
180 185 190
Asp Arg Arg Gly Lys Cys Val Ser Lys Ala Glu Tyr Val Arg Asn Asn
195 200 205
His Lys Val Thr Ala Phe Asp Arg Asp Glu Asn Pro Val Glu Val Asp
210 215 220
Leu Arg Pro Ser Arg Leu Asn Ala Leu Gly Thr Arg Gly Trp His Thr
225 230 235 240
Thr Asn Asp Thr Tyr Thr Lys Ile Gly Ala Ala Gly Phe Tyr His Thr
245 250 255
Gly Thr Ser Val Asn Cys Ile Val Glu Glu Val Glu Ala Arg Ser Val
260 265 270
Tyr Pro Tyr Asp Ser Phe Ala Leu Ser Thr Gly Asp Ile Val Tyr Met
275 280 285
Ser Pro Phe Tyr Gly Leu Arg Glu Gly Ala His Gly Glu His Ile Gly
290 295 300
Tyr Ala Pro Gly Arg Phe Gln Gln Val Glu His Tyr Tyr Pro Ile Asp
305 310 315 320
Leu Asp Ser Arg Leu Arg Ala Ser Glu Ser Val Thr Arg Asn Phe Leu
325 330 335
Arg Thr Pro His Phe Thr Val Ala Trp Asp Trp Ala Pro Lys Thr Arg
340 345 350
Arg Val Cys Ser Leu Ala Lys Trp Arg Glu Ala Glu Glu Met Ile Arg
355 360 365
Asp Glu Thr Arg Asp Gly Ser Phe Arg Phe Thr Ser Arg Ala Leu Gly
370 375 380
Ala Ser Phe Val Ser Asp Val Thr Gln Leu Asp Leu Gln Arg Val His
385 390 395 400
Leu Gly Asp Cys Val Leu Arg Glu Ala Ser Glu Ala Ile Asp Ala Ile
405 410 415
Tyr Arg Arg Arg Tyr Asn Asn Thr His Val Leu Ala Gly Asp Lys Pro
420 425 430
Glu Val Tyr Leu Ala Arg Gly Gly Phe Val Val Ala Phe Arg Pro Leu
435 440 445
Ile Ser Asn Glu Leu Ala Gln Leu Tyr Ala Arg Glu Leu Glu Arg Leu
450 455 460
Gly Leu Ala Gly Val Val Gly Pro Ala Ser Pro Ala Ala Ala Arg Arg
465 470 475 480
Ala Arg Arg Ser Pro Gly Pro Ala Gly Thr Pro Glu Pro Pro Ala Val
485 490 495
Asn Gly Thr Gly His Leu Arg Ile Thr Thr Gly Ser Ala Glu Phe Ala
500 505 510
Arg Leu Gln Phe Thr Tyr Asp His Ile Gln Ala His Val Asn Asp Met
515 520 525
Leu Ser Arg Ile Ala Ala Ala Trp Cys Glu Leu Gln Asn Lys Asp Arg
530 535 540
Thr Leu Trp Gly Glu Met Ser Arg Leu Asn Pro Ser Ala Val Ala Thr
545 550 555 560
Ala Ala Leu Gly Gln Arg Val Ser Ala Arg Met Leu Gly Asp Val Met
565 570 575
Ala Ile Ser Arg Cys Val Glu Val Arg Gly Gly Val Tyr Val Gln Asn
580 585 590
Ser Met Arg Val Pro Gly Glu Arg Gly Thr Cys Tyr Ser Arg Pro Leu
595 600 605
Val Thr Phe Glu His Asn Gly Thr Gly Val Ile Glu Gly Gln Leu Gly
610 615 620
Asp Asp Asn Glu Leu Leu Ile Ser Arg Asp Leu Ile Glu Pro Cys Thr
625 630 635 640
Gly Asn His Arg Arg Tyr Phe Lys Leu Gly Gly Gly Tyr Val Tyr Tyr
645 650 655
Glu Asp Tyr Ser Tyr Val Arg Met Val Glu Val Pro Glu Thr Ile Ser
660 665 670
Thr Arg Val Thr Leu Asn Leu Thr Leu Leu Glu Asp Arg Glu Phe Leu
675 680 685
Pro Leu Glu Val Tyr Thr Arg Glu Glu Leu Ala Asp Thr Gly Leu Leu
690 695 700
Asp Tyr Ser Glu Ile Gln Arg Arg Asn Gln Leu His Ala Leu Lys Phe
705 710 715 720
Tyr Asp Ile Asp Arg Val Val Lys Val Asp His Asn Gly Ser Gly Gly
725 730 735
Gly Gly Ser Gly Gly Gly Gly Ser Gly Ser Glu Pro Arg Gly Pro Thr
740 745 750
Ile Lys Pro Cys Pro Pro Cys Lys Cys Pro Ala Pro Asn Leu Leu Gly
755 760 765
Gly Pro Ser Val Phe Ile Phe Pro Pro Lys Ile Lys Asp Val Leu Met
770 775 780
Ile Ser Leu Ser Pro Ile Val Thr Cys Val Val Val Asp Val Ser Glu
785 790 795 800
Asp Asp Pro Asp Val Gln Ile Ser Trp Phe Val Asn Asn Val Glu Val
805 810 815
His Thr Ala Gln Thr Gln Thr His Arg Glu Asp Tyr Asn Ser Thr Leu
820 825 830
Arg Val Val Ser Ala Leu Pro Ile Gln His Gln Asp Trp Met Ser Gly
835 840 845
Lys Glu Phe Lys Cys Lys Val Asn Asn Lys Asp Leu Pro Ala Pro Ile
850 855 860
Glu Arg Thr Ile Ser Lys Pro Lys Gly Ser Val Arg Ala Pro Gln Val
865 870 875 880
Tyr Val Leu Pro Pro Pro Glu Glu Glu Met Thr Lys Lys Gln Val Thr
885 890 895
Leu Thr Cys Met Val Thr Asp Phe Met Pro Glu Asp Ile Tyr Val Glu
900 905 910
Trp Thr Asn Asn Gly Lys Thr Glu Leu Asn Tyr Lys Asn Thr Glu Pro
915 920 925
Val Leu Asp Ser Asp Gly Ser Tyr Phe Met Tyr Ser Lys Leu Arg Val
930 935 940
Glu Lys Lys Asn Trp Val Glu Arg Asn Ser Tyr Ser Cys Ser Val Val
945 950 955 960
His Glu Gly Leu His Asn His His Thr Thr Lys Ser Phe Ser Arg Thr
965 970 975
Pro Gly Lys Gly Ser Gly Ser His His His His His His
980 985
<210> 21
<211> 32
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 21
gcggccgtga cgcgggccgc ctcggcctcg cc 32
<210> 22
<211> 31
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 22
gttgtggtcc accttgacca cgcggtcaat g 31

Claims (10)

1. the recombinant baculovirus transfer vector containing porcine pseudorabies virus gB protein gene, which is characterized in that believed with GP67 Number peptide-gB-His label is that foreign gene is inserted into the restriction enzyme site between the BamHI of baculovirus transfer vector and EcoRI respectively Between place and XbaI and HindIII at restriction enzyme site；
The gB is the gene for encoding the gB albumen of C-terminal transmembrane fragment missing；The gB of the coding C-terminal transmembrane fragment missing The nucleotide sequence of the gene of albumen is as shown in SEQ ID No.1.
2. the construction method of recombinant baculovirus transfer vector described in claim 1, which comprises the following steps:
(1) using PRV genome as template, the gB segment of PCR amplification C-terminal transmembrane fragment missing；
(2) the gB segment that C-terminal transmembrane fragment lacks is connect with carrier is carrier and obtains the recombinant vector containing gB；
(3) using the recombinant vector containing gB as template, with the first primer to PCR amplification is carried out, obtaining the first pcr amplification product is GP67 signal peptide-gB-His label target fragment；
Using first pcr amplification product as template, add restriction enzyme site respectively, obtain to both ends be connected separately with BamHI and GP67 signal peptide-gB-His label the target fragment of EcoRI restriction enzyme site and both ends are connected separately with XbaI and HindIII digestion GP67 signal peptide-gB-His label the target fragment in site；
(4) both ends are connected separately with to the GP67 signal peptide-gB-His label purpose piece of BamHI and EcoRI restriction enzyme site GP67 signal peptide-gB-His label the target fragment that section and both ends are connected separately with XbaI and HindIII restriction enzyme site is connected to In baculovirus transfer vector, the recombinant baculovirus transfer vector containing porcine pseudorabies virus gB protein gene is obtained；
The first primer to include for gB 5 ' end addition GP67 signal peptides forward primer and for gB 3 ' end addition His labels Reverse primer, the nucleotide sequence of the forward primer is as shown in SEQ ID No.3 and SEQ ID No.4；The reverse primer Nucleotide sequence as shown in SEQ ID No.5；
Addition restriction enzyme site must arrive the GP67 signal peptide-gB-His label that both ends are connected separately with BamHI and EcoRI restriction enzyme site The method of target fragment includes carrying out PCR amplification using SEQ ID No.6 and SEQ ID No.7 to obtain；
Addition restriction enzyme site must arrive the GP67 signal peptide-gB-His mark that both ends are connected separately with XbaI and HindIII restriction enzyme site The method of label target fragment includes carrying out PCR amplification using SEQ ID No.8 and SEQ ID No.9 to obtain.
3. the recombinant baculovirus transfer vector containing porcine pseudorabies virus gB-IgGFc antigen-4 fusion protein gene, feature exist In being inserted into baculovirus transfer vector respectively using GP67 signal peptide-gB-IgGFc fusion protein-His label as foreign gene At restriction enzyme site between BamHI and EcoRI between XbaI and HindIII at restriction enzyme site；
The nucleotides sequence of the gB-IgGFc fusion protein be classified as coding C-terminal transmembrane fragment missing gB albumen gene and The coded sequence of IgGFc albumen is linked in sequence to obtain by catenation sequence；The gB albumen of the coding C-terminal transmembrane fragment missing Gene nucleotide sequence as shown in SEQ ID No.1；The nucleotide sequence such as SEQ of the coded sequence of the IgGFc albumen Shown in ID No.2.
4. the recombinant baculovirus containing porcine pseudorabies virus gB-IgGFc antigen-4 fusion protein gene described in a kind of claim 3 turns The construction method of transfer body, which comprises the following steps:
(1) using PRV genome as template, the gB segment of PCR amplification C-terminal transmembrane fragment missing and artificial synthesized IgGFc-His Segment；
(2) the gB segment of C-terminal transmembrane fragment missing or IgGFc-His segment are connect with carrier is carrier respectively, is obtained Recombinant vector containing gB or the recombinant vector containing IgGFc-His；
(3) using the recombinant vector containing gB as template, with the first primer to PCR amplification is carried out, obtaining the first pcr amplification product is GP67 signal peptide-gB-His label target fragment；
(4) using the GP67 signal peptide-gB-His label target fragment and the recombinant vector containing IgGFc-His as template, with Two primer pairs carry out fusion DNA vaccine amplification, and the second pcr amplification product of acquisition is GP67 signal peptide-gB-IgGFc-His label purpose Segment；
Using second pcr amplification product as template, add restriction enzyme site respectively, obtain to both ends be connected separately with BamHI and GP67 signal peptide-gB-IgGFc-His label the target fragment of EcoRI restriction enzyme site and both ends be connected separately with XbaI and GP67 signal peptide-gB-His label the target fragment of HindIII restriction enzyme site；
(5) both ends are connected separately with to the GP67 signal peptide-gB-IgGFc-His label of BamHI and EcoRI restriction enzyme site Target fragment and both ends are connected separately with the GP67 signal peptide-gB-IgGFc-His label mesh of XbaI and HindIII restriction enzyme site Segment be connected in baculovirus transfer vector, obtain the weight containing porcine pseudorabies virus gB-IgGFc antigen-4 fusion protein gene Group baculovirus transfer vector.
5. construction method according to claim 4, which is characterized in that second primer pair includes such as SEQ ID No.10 institute It is shown as the forward primer of 5 ' the end addition GP67 signal peptide sequences of gB, 3 ' the end additions as SEQ ID No.11 show gB are homologous The reverse primer of arm sequence, as SEQ ID No.12 show the forward primer and such as of 5 ' the end addition homology arm sequences of IgGFc SEQ ID No.13 show the reverse primer of 3 ' the end addition His sequence labels of IgGFc.
6. a kind of recombinant baculovirus for expressing porcine pseudorabies virus gB albumen, which is characterized in that will be described in claim 1 Recombinant baculovirus transfer vector is transfected to insect cell, and lesion occurs in culture to cell, is collected supernatant and is obtained.
7. a kind of recombinant baculovirus for expressing porcine pseudorabies virus gB-IgGFc fusion protein, which is characterized in that by right It is required that recombinant baculovirus transfer vector described in 3 is transfected to insect cell, there is lesion in culture to cell, collects supernatant and obtains It arrives.
8. the recombinant baculovirus transfer vector of claim 1 or 3 or the recombinant baculovirus of claim 6 or 7 are in life Produce the application in the vaccine of porcine pseudorabies.
9. a kind of subunit vaccine for preventing and treating porcine pseudorabies, which is characterized in that including one of adjuvant and following albumen: power Benefit require 6 described in recombinant baculovirus expression porcine pseudorabies virus gB albumen and it is as claimed in claim 7 recombination it is rod-shaped The gB-IgGFc fusion protein of expressing viral.
10. subunit vaccine according to claim 9, which is characterized in that the concentration of the porcine pseudorabies virus gB albumen For 200~300 μ g/ml；The concentration of the gB-IgGFc fusion protein is 150~200 μ g/ml.
CN201910354221.1A 2019-04-29 2019-04-29 Recombinant baculovirus transfer vector containing porcine pseudorabies virus gB protein gene, recombinant baculovirus, preparation method and application Active CN110066827B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910354221.1A CN110066827B (en) 2019-04-29 2019-04-29 Recombinant baculovirus transfer vector containing porcine pseudorabies virus gB protein gene, recombinant baculovirus, preparation method and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910354221.1A CN110066827B (en) 2019-04-29 2019-04-29 Recombinant baculovirus transfer vector containing porcine pseudorabies virus gB protein gene, recombinant baculovirus, preparation method and application

Publications (2)

Publication Number Publication Date
CN110066827A true CN110066827A (en) 2019-07-30
CN110066827B CN110066827B (en) 2020-12-15

Family

ID=67369458

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910354221.1A Active CN110066827B (en) 2019-04-29 2019-04-29 Recombinant baculovirus transfer vector containing porcine pseudorabies virus gB protein gene, recombinant baculovirus, preparation method and application

Country Status (1)

Country Link
CN (1) CN110066827B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114908056A (en) * 2022-05-18 2022-08-16 华中农业大学 Recombinant CHO cell line for expressing porcine PRV gDFc or gBFc fusion protein and construction method and application thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104248757A (en) * 2014-09-30 2014-12-31 普莱柯生物工程股份有限公司 Porcine pseudorabies virus vaccine composition and preparation method and application thereof
US20160331826A1 (en) * 2015-05-15 2016-11-17 Reber Genetics Co., Ltd. Novel baculovirus display vectors and uses thereof
CN106267182A (en) * 2015-06-29 2017-01-04 普莱柯生物工程股份有限公司 The preparation method of a kind of porcine pseudorabies virus subunit vaccine and vaccine combination and application

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104248757A (en) * 2014-09-30 2014-12-31 普莱柯生物工程股份有限公司 Porcine pseudorabies virus vaccine composition and preparation method and application thereof
US20160331826A1 (en) * 2015-05-15 2016-11-17 Reber Genetics Co., Ltd. Novel baculovirus display vectors and uses thereof
CN106267182A (en) * 2015-06-29 2017-01-04 普莱柯生物工程股份有限公司 The preparation method of a kind of porcine pseudorabies virus subunit vaccine and vaccine combination and application

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
MARÍA SOLEDAD SERENA等: "Production of pseudorabies virus recombinant glycoprotein B and its use in an agar gel immunodiffusion (AGID) test for detection of antibodies with sensitivity and specificity equal to the virus neutralization assay", 《JOURNAL OF VIROLOGICAL METHODS》 *
周金龙等: "伪狂犬病病毒gE基因在昆虫细胞中的表达", 《中国兽医科学》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114908056A (en) * 2022-05-18 2022-08-16 华中农业大学 Recombinant CHO cell line for expressing porcine PRV gDFc or gBFc fusion protein and construction method and application thereof
CN114908056B (en) * 2022-05-18 2024-04-16 华中农业大学 Recombinant CHO cell line expressing pig PRV gDFc or gBFc fusion protein and construction method and application thereof

Also Published As

Publication number Publication date
CN110066827B (en) 2020-12-15

Similar Documents

Publication Publication Date Title
CN111560074B (en) Novel coronavirus S protein single-region subunit nano vaccine based on helicobacter pylori ferritin
CN112076315A (en) Nano antigen particle fused with new coronavirus S protein and ferritin subunit, new coronavirus vaccine, and preparation method and application thereof
CN112876570B (en) African swine fever virus vaccine and preparation method thereof
CN109943592A (en) Recombinant baculovirus transfer vector, recombinant baculovirus and the preparation method and application of the protein gene of gD containing porcine pseudorabies virus
CN113186173B (en) Novel coronavirus pneumonia vaccine based on attenuated influenza virus vector
CN110606873B (en) Porcine circovirus type 2d and type 3Cap protein bigeminal subunit vaccine and preparation method and application thereof
CN108586618B (en) Preparation and application of porcine epidemic diarrhea subunit vaccine
CN110317278B (en) Fusion protein of SVV and FMDV, encoding gene, expression vector, cell line, engineering bacterium, vaccine and application thereof
CN111825768B (en) Self-assembly ferritin-based nano antigen particle, influenza vaccine and preparation method
KR20190110605A (en) Swine Coronavirus Vaccine
WO2023051850A1 (en) Recombinant fusion protein derived from hr region of s2 protein of sars-cov-2 and application of recombinant fusion protein
CN107337718A (en) A kind of gene for encoding carrying Cap gene of porcine circovirus type 2 and its application
CN109880838A (en) A kind of recombinant virus and its preparation method and application of the O-shaped foot-and-mouth disease virus multi-epitope gene of secreting, expressing pig
CN113201507A (en) Recombinant pseudorabies virus and vaccine composition thereof
CN104292339A (en) Recombinant protein containing SARS virus RBD antigen and baculovirus displaying RBD protein
CN108359015B (en) Porcine rotavirus VP fusion protein reconstruction body and preparation method and application thereof
CN102210860B (en) Mycobacterium tuberculosis TB10.4-F1 fusion protein vaccine and preparation method thereof
CN112142851B (en) Subunit fusion protein tG on rabies virus surface and preparation method and application thereof
CN106279431B (en) A kind of pig circular ring virus subunit inactivated vaccine
CN104293740B (en) Recombinant baculovirus of surface display SARS bivalent antigens and its preparation method and application
CN104292338B (en) Recombinant protein containing SARS virus N antigen and baculovirus displaying N protein
CN109200281A (en) The subunit vaccine of single stranded circle DNA virus GyV3 and its preparation
CN102134278A (en) Preparation of subunit vaccine for mucosal immune in circovirus genetic engineering and application thereof
CN110746496B (en) PAL recombinant protein of Acinetobacter baumannii, encoding gene thereof and application of PAL recombinant protein and encoding gene
CN110066827A (en) Recombinant baculovirus transfer vector, recombinant baculovirus and the preparation method and application of the protein gene of gB containing porcine pseudorabies virus

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant