CN111349179B - Avian reovirus genetic engineering vaccine - Google Patents

Abstract

The invention discloses a novel avian reovirus genetic engineering vaccine which comprises a fusion protein with a coding gene sequence shown as SEQ ID NO. 1. The antigenicity, immunogenicity and function of the vaccine are similar to those of natural protein, the expression level is higher, the immunogenicity is strong, pathogenicity to poultry is avoided, and the vaccine can be prepared by large-scale serum-free suspension culture of a bioreactor, so that the production cost of the vaccine is greatly reduced.

Description

Avian reovirus genetic engineering vaccine

Technical Field

The invention relates to a genetic engineering vaccine, in particular to an avian reovirus genetic engineering vaccine, a preparation method and application thereof, and belongs to the technical field of animal immunity drugs.

Background

Avian Reovirus (ARV) is one of the main pathogens of Avian viral arthritis (Avian viral arthritis) and tenosynovitis, belongs to the family of reoviridae, a genus orthoreovirus, and was first isolated in 1954. The ARV can cause the dyskinetic infectious diseases of the chickens, the dyskinetic infectious diseases are distributed globally, the sick chickens are mainly lamed or do not want to move, part of the chickens grow hindered, and the weight gain is obviously reduced; ARV can also cause diseases other than viral arthritis and tenosynovitis, such as malabsorption, intestinal disorders, heart and liver lesions, bluewing disease, respiratory diseases, and the like, and chickens of all ages are susceptible to the disease, and the smaller the age of the chicken at the time of infection, the higher the incidence of the disease. Infection with ARV often causes secondary infection with other diseases, causing enormous economic losses.

ARV belongs to reoviridae, members of the genus orthoreovirus, is free of a capsular membrane, is surrounded by a double-layered nucleocapsid, the genome is double-stranded RNA (dsRNA) which consists of 10 segment genes of large (L1, L2, L3), medium (M1, M2, M3) and small (S1, S2, S3, S4)3 groups, wherein the sigma B protein is coded by the S3 gene, possesses 367 amino acids, is an important component of virus capsid protein (Martinez-Costas J, Gonzalez-Lopez C, Vakharia VN, Benavente J. Possivoiding of the double-stranded RNA-binding core protein sigma A in thersistance of the antigen recovery to interference. Journal of virology, 2000, 74(3):1124 1131.), and carries a group-specific neutralizing epitope which can induce host cell fusion and make the host produce group-specific neutralizing antibody. The sigma C protein is encoded by the third Open Reading Frame (ORF) of the S1 gene, is the smallest of the viral coat proteins, is a viral-adsorbed protein with a molecular weight of 34.9kDa, and exists in monomeric and trimeric forms. The main functions of the sigma C proteins known at present are the surface antigen carrying the ARV specific neutralization reaction and the function of cell adsorption (Ni Y, Kemp M C. A comprehensive study of the antigen retrieval probability: virus Spread and replication and adsorption or expression [ J ]. AvianDisase, 1995, 39: 554-, 85(1-2): 43-54). Thus, the sigma C protein plays an important role in ARV infection and pathogenesis.

Although some avian reovirus genetic engineering subunit vaccines are proposed in documents such as CN103642758A, CN107384942A and the like, most of them are vaccines in which sigma B protein or sigma C protein is expressed individually and sigma B/sigma C protein is expressed mixedly, although sigma B, sigma C and other proteins have good protection effect, structural proteins of certain serotype viruses are used as vaccine antigens, and because sigma C protein is easy to mutate and has poor cross protection, immune failure is often caused.

Disclosure of Invention

The invention mainly aims to provide an avian reovirus genetic engineering vaccine, a preparation method and application thereof, so as to overcome the defects in the prior art.

In order to achieve the purpose, the technical scheme adopted by the invention comprises the following steps:

the embodiment of the invention provides a fusion protein, which comprises an amino acid sequence shown in SEQ ID NO. 2 or an amino acid sequence which is 95% identical to the full-length amino acid sequence of the SEQ ID NO. 2.

The embodiment of the invention also provides a coding gene of the fusion protein.

Furthermore, the coding gene comprises a nucleic acid molecule with a sequence shown as SEQ ID NO. 1 or a nucleic acid molecule with the same nucleotide sequence of more than 95% of SEQ ID NO. 1.

The embodiment of the invention also provides a recombinant gene vector, a recombinant baculovirus or an insect cell containing the encoding gene.

The embodiment of the invention also provides an immune composition, which comprises: the fusion protein; and, a pharmaceutically acceptable carrier.

The embodiment of the invention also provides a method for preparing the fusion protein, which comprises the following steps:

s1, cloning the encoding gene of the fusion protein to a baculovirus expression system transfer vector to obtain a recombinant expression vector;

s2, co-transfecting the recombinant baculovirus transfer vector and a baculovirus genome plasmid into an insect cell, and screening to obtain a recombinant baculovirus;

s3, inoculating the recombinant baculovirus into insect cells to obtain the fusion protein.

The embodiment of the invention also provides application of the fusion protein or the immune composition in preparing a detection reagent for the avian reovirus.

The embodiments also provide for the use of the fusion protein or the immunological composition in the manufacture of a medicament for inducing an immune response against an avian reovirus antigen in a subject animal.

The embodiments also provide for the use of the fusion protein or the immunological composition in the manufacture of a medicament for preventing infection of an animal by an avian reovirus.

The embodiment of the invention also provides application of the fusion protein or the immune composition in preparation of the avian reovirus genetic engineering vaccine.

Accordingly, embodiments of the present invention provide an avian reovirus genetically engineered vaccine comprising any one of the immunological compositions described above. Further, the vaccine may further comprise a pharmaceutically acceptable carrier.

The embodiment of the invention also provides application of a recombinant gene vector containing the fusion protein coding gene, a recombinant baculovirus or an insect cell in producing a reagent for detecting the infection of animals by the avian reovirus.

The embodiment of the invention also provides application of a recombinant gene vector containing the fusion protein coding gene, a recombinant baculovirus or an insect cell in producing a medicament for inducing an immune response to the avian reovirus antigen in a test animal.

The embodiment of the invention also provides application of a recombinant gene vector containing the fusion protein coding gene, a recombinant baculovirus or an insect cell in producing a medicament for preventing animals from being infected by the avian reovirus.

Compared with the prior art, the embodiment of the invention is based on the main protective epitope of the avian reovirus sigma C protein, and the novel fusion protein (which can be named as SBC fusion protein) is constructed by connecting the main protective epitope of the avian reovirus sigma C protein in series with the epitope of the sigma B protein, has wide protective capability and can almost protect the attack of all different strains of viruses, and the avian reovirus vaccine prepared by the fusion protein has the advantages of similar antigenicity, immunogenicity and function to natural proteins, higher expression level, strong immunogenicity and no pathogenicity to poultry, and can be prepared by large-scale serum-free suspension culture of a bioreactor, thereby greatly reducing the production cost of the vaccine.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are required to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 is a gel electrophoresis chart of the PCR amplification product of the SBC gene in example 1, in which the band of interest appears at the 1.0kbp position.

FIG. 2 is a gel electrophoresis chart of the colony PCR amplification product in example 1, wherein the band of interest appears at the 1.0kbp position.

FIG. 3 is a schematic diagram showing the structure of the transfer vector pVL-SBC containing the gene of interest in example 1.

FIG. 4 is a SDS-PAGE detection profile of the cell culture obtained in example 3, in which a band of interest appears around a molecular weight of about 36 kDa.

FIG. 5 is a Western Blot detection pattern of the product after SDS-PAGE in example 4.

FIG. 6 is an indirect immunofluorescence assay profile of example 5.

FIG. 7 is a map after purification of the protein in example 7.

Detailed Description

It is to be understood that the following detailed description is exemplary and is intended to provide further explanation of the invention as claimed. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of exemplary embodiments according to the invention. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, and it should be understood that when the terms "comprises" and/or "comprising" are used in this specification, they specify the presence of stated features, steps, operations, devices, components, and/or combinations thereof, unless the context clearly indicates otherwise.

One aspect of the embodiments of the present invention provides a fusion protein comprising the amino acid sequence shown in SEQ ID NO. 2 or an amino acid sequence that is 95% or more identical to the full-length amino acid sequence of SEQ ID NO. 2.

Furthermore, the fusion protein comprises sigma C protein main protective antigen epitopes and sigma B protein antigen epitopes which are connected in series, wherein the sigma C protein main protective antigen epitopes comprise epitopes of common epidemic strains, so that the sigma C protein main protective antigen epitopes can almost protect the attack of viruses of all different strains, the antibody excitation capacity is greatly enhanced and the antibody level is obviously improved due to the serial connection of the sigma C protein antigen epitopes, and the wide protective capacity is further increased by fusing the sigma B protein antigen epitopes and expressing group specificity neutralizing antibodies (group specific neutralizing antibodies).

Another aspect of the embodiment of the invention also provides a coding gene of the fusion protein, which comprises a nucleic acid molecule with a sequence shown in SEQ ID NO. 1 or a nucleic acid molecule with the same nucleotide sequence of the SEQ ID NO. 1 of more than 95 percent.

In another aspect of the embodiments of the present invention, there is provided a recombinant gene vector comprising a gene encoding the fusion protein.

In another aspect of the embodiments of the present invention, there is provided a recombinant baculovirus, which includes the gene encoding the fusion protein.

In another aspect of the embodiments of the present invention, there is provided an insect cell comprising a gene encoding the fusion protein.

Further, the insect cell may be formed by transfection with a recombinant baculovirus genome plasmid containing the gene encoding the fusion protein.

In another aspect of the embodiments of the present invention, there is also provided an immunization composition comprising: the fusion protein; and, a pharmaceutically acceptable carrier. Further, the pharmaceutically acceptable carrier includes any one or a combination of two or more of white oil, aluminum stearate, span and tween, and is not limited thereto.

Another aspect of the embodiments of the present invention also provides a method of preparing the fusion protein, which includes:

s1, cloning the encoding gene of the fusion protein to a baculovirus expression system transfer vector to obtain a recombinant expression vector;

s2, co-transfecting the recombinant baculovirus transfer vector and a baculovirus genome plasmid into an insect cell, and screening to obtain a recombinant baculovirus;

s3, inoculating the recombinant baculovirus into insect cells to obtain the fusion protein.

Further, the baculovirus expression system transfer vector includes, but is not limited to, any one of pFastBac1 and pVL1393, preferably pVL 1393.

Further, the insect cells include but are not limited to Sf9, High Five or Sf21 cells, preferably Sf9 cells.

In the above embodiment of the present invention, by using a baculovirus insect cell expression system and performing expression using insect cells such as suspension culture Sf9 cells, the expression level is high and the protein immunogenicity is good.

In another aspect of the embodiment of the invention, the application of the fusion protein or the immune composition in preparing a detection reagent for the avian reovirus is also provided.

Another aspect of an embodiment of the invention also provides the use of the fusion protein or the immunological composition in the manufacture of a medicament for inducing an immune response against an avian reovirus antigen in a subject animal.

Another aspect of an embodiment of the invention also provides the use of the fusion protein or the immunological composition in the manufacture of a medicament for preventing infection of an animal by an avian reovirus.

In another aspect of the embodiment of the invention, the fusion protein or the immune composition is used for preparing the avian reovirus genetic engineering vaccine.

Accordingly, another aspect of embodiments of the present invention provides an avian reovirus genetically engineered vaccine comprising any one of the immunological compositions described above. Further, the vaccine may further comprise a pharmaceutically acceptable carrier.

In another aspect of the embodiment of the invention, the application of the recombinant gene vector containing the fusion protein coding gene, the recombinant baculovirus or the insect cell in producing the reagent for detecting the infection of the animal with the avian reovirus is also provided.

In another aspect of the embodiments of the present invention, there is also provided a use of a recombinant gene vector, a recombinant baculovirus or an insect cell comprising a gene encoding the fusion protein in the manufacture of a medicament for inducing an immune response against an avian reovirus antigen in a subject animal.

In another aspect of the embodiment of the invention, the application of the recombinant gene vector containing the fusion protein coding gene, the recombinant baculovirus or the insect cell in the production of the medicament for preventing the animals from being infected by the avian reovirus is also provided.

Accordingly, another aspect of embodiments of the present invention also relates to a method of inducing an immune response against an avian reovirus antigen, the method comprising administering the avian reovirus genetically engineered vaccine to a subject avian animal.

Accordingly, another aspect of embodiments of the present invention also relates to a method of protecting a subject animal from infection by an avian reovirus, the method comprising administering to the subject avian animal the avian reovirus genetically engineered vaccine.

Yet another aspect of an embodiment of the invention provides a vaccine suitable for use in generating an immune response against an avian reovirus in a test avian animal, the vaccine comprising: fusion proteins of the invention and adjuvant molecules.

Further, the adjuvant can be IL-12, IL-15, IL-28, CTACK, TECK, Platelet Derived Growth Factor (PDGF), TNF α, TNF β, GM-CSF, Epidermal Growth Factor (EGF), IL-1, IL-2, IL-4, IL-5, IL-6, IL-10, IL-18, IL-21, IL-31, IL-33, or a combination thereof; and in some embodiments, can be IL-12, IL-15, IL-28 or RANTES.

Further, the adjuvant may preferably be related adjuvants produced by Suzhou Shino biotechnology, Inc. to improve the effect of the vaccine.

1. And (4) defining.

The terminology used in the description is for the purpose of describing particular embodiments only and is not intended to be limiting. As used in the specification and in the claims, the singular form of "a", "an", and "the" include plural referents unless the context clearly dictates otherwise.

To the extent that numerical ranges are recited herein, each intervening number is specifically contemplated to be within the same precision. For example, for the range of 6-9, the numbers 7 and 8 are encompassed in addition to 6 and 9, and for the range of 6.0-7.0, the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are expressly encompassed.

An "adjuvant" as used herein means any molecule added to the vaccine described herein to enhance the immunogenicity of the antigen encoded by the encoding nucleic acid sequence described below.

"antibody" as used herein means an antibody of the type IgG, IgM, IgA, IgD or IgE, or a fragment, fragment or derivative thereof, including Fab, F (ab')2, Fd, and single chain antibodies, diabodies, bispecific antibodies, bifunctional antibodies and derivatives thereof. The antibody may be an antibody isolated from a serum sample of an animal, a polyclonal antibody, an affinity purified antibody, or a mixture thereof that exhibits sufficient binding specificity for the desired epitope or a sequence derived therefrom.

"coding sequence" or "coding nucleic acid" as used in the present specification means a nucleic acid (RNA or DNA molecule) comprising a nucleotide sequence encoding a protein. The coding sequence may further include initiation and termination signals operably linked to regulatory elements including a promoter and polyadenylation signals capable of directing expression in the cells of the subject or animal to which the nucleic acid is administered.

"complement" or "complementary" as used herein means that a nucleic acid can refer to Watson-Crick (e.g., A-T/U and C-G) or Hoogsteen base pairing between nucleotides or nucleotide analogs of the nucleic acid molecule.

As used herein, "consensus" or "consensus sequence" means a polypeptide sequence based on analysis of a cohort of multiple subtypes of a particular avian reovirus antigen. Nucleic acid sequences encoding the consensus polypeptide sequence may be prepared. Vaccines comprising proteins comprising consensus sequences and/or nucleic acid molecules encoding these proteins can be used to induce broad immunity against multiple subtypes or serotypes of a particular avian reovirus antigen.

"electroporation", "electro-permeabilization" or "electrokinetic enhancement" ("EP") as used interchangeably herein means the use of transmembrane electric field pulses to induce microscopic pathways (pores) in a biological membrane; their presence allows biomolecules such as plasmids, oligonucleotides, siRNA, drugs, ions and water to flow from one side of the cell membrane to the other.

"fragment" with respect to nucleic acid sequences as used herein means a nucleic acid sequence or a portion thereof that encodes a polypeptide that is capable of eliciting an immune response in an animal that is cross-reactive with the full-length wild-type strain avian reovirus antigen. The fragment may be a DNA fragment selected from at least one of various nucleotide sequences encoding protein fragments described below.

By "fragment" or "immunogenic fragment" with respect to a polypeptide sequence is meant a polypeptide that is capable of eliciting an immune response in an animal that is cross-reactive with the full-length wild-type strain avian reovirus antigen. A fragment of a protein may comprise at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of the protein. In some embodiments, a fragment of a protein may comprise at least 20 amino acids or more, at least 30 amino acids or more, at least 40 amino acids or more, at least 50 amino acids or more, at least 60 amino acids or more, at least 70 amino acids or more, at least 80 amino acids or more, at least 90 amino acids or more, at least 100 amino acids or more, at least 110 amino acids or more, at least 120 amino acids or more of the protein, at least 130 amino acids or more, at least 140 amino acids or more, at least 150 amino acids or more, at least 160 amino acids or more, at least 170 amino acids or more, at least 180 amino acids or more, at least 190 amino acids or more, at least 200 amino acids or more, at least 210 amino acids or more, at least 220 amino acids or more, at least 230 amino acids or more, or at least 240 amino acids or more.

The term "genetic construct" as used in this specification refers to a DNA or RNA molecule comprising a nucleotide sequence encoding a protein. The coding sequence comprises an initiation signal and a termination signal operably linked to regulatory elements including a promoter and polyadenylation signal capable of directing expression in the cells of the individual to whom the nucleic acid molecule is administered. The term "expression form" as used herein refers to a genetic construct containing the necessary regulatory elements operably linked to a coding sequence encoding a protein such that the coding sequence will be expressed when present in the cells of the individual.

The term "homology" as used in the present specification refers to the degree of complementarity. There may be partial homology or complete homology (i.e., identity). Partial complementary sequences that at least partially inhibit hybridization of a fully complementary sequence to a target nucleic acid are referred to using the functional term "substantially homologous". The term "substantially homologous" as used herein when used with respect to a double-stranded nucleic acid sequence, such as a cDNA or genomic clone, means that the probe can hybridize to a strand of the double-stranded nucleic acid sequence under conditions of low stringency. The term "substantially homologous" as used herein with respect to a single-stranded nucleic acid sequence means that the probe can hybridize to a single-stranded nucleic acid template sequence (i.e., is the complement of the single-stranded nucleic acid template sequence) under low stringency conditions.

In the case of two or more nucleic acid or polypeptide sequences, "identical" or "identity" as used herein means that the sequences have a specified percentage of identical residues in a specified region. The percentage may be calculated by: optimally aligning the two sequences, comparing the two sequences over a specified region, determining the number of positions of the identical residue in the two sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions within the specified region, and multiplying the result by 100 to yield the percentage of sequence identity. Where two sequences are of different lengths or the alignment produces one or more staggered ends and the specified regions of comparison include only a single sequence, the residues of the single sequence are included in the denominator of the calculation rather than in the numerator. When comparing DNA and RNA, thymine (T) and uracil (U) can be considered equivalent. Identity can be performed manually or by using a computer sequence algorithm such as BLAST or BLAST 2.0.

As used herein, "immune response" means the activation of the immune system of a host (e.g., the immune system of an animal) in response to the introduction of an antigen, such as an avian reovirus consensus antigen. The immune response may be in the form of a cellular response or a humoral response or both.

As used herein, "nucleic acid" or "oligonucleotide" or "polynucleotide" means at least two nucleotides covalently linked together. The description of single strands also defines the sequence of the complementary strand. Thus, nucleic acids also encompass the complementary strand of the single strand described. Many variants of a nucleic acid can be used for the same purpose as a given nucleic acid. Thus, nucleic acids also encompass substantially the same nucleic acids and their complements. Single strands provide probes that can hybridize to a target sequence under stringent hybridization conditions. Thus, nucleic acids also encompass probes that hybridize under stringent hybridization conditions.

The nucleic acid may be single-stranded or double-stranded or may contain portions of both double-stranded or single-stranded sequences. The nucleic acid can be DNA, both genomic and cDNA, RNA, or a hybrid, wherein the nucleic acid can contain a combination of deoxyribonucleotides and ribonucleotides, as well as a combination of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine, and isoguanine. The nucleic acid may be obtained by chemical synthesis methods or by recombinant methods.

The expression of the gene is carried out under the control of a promoter which is spatially linked thereto. Under its control, the promoter may be positioned 5 '(upstream) or 3' (downstream) of the gene. The distance between the promoter and the gene may be about the same as the distance between the promoter and the gene it controls in the gene from which the promoter is derived. As is known in the art, this change in distance can be adjusted without loss of promoter function. By "promoter" is meant a molecule of synthetic or natural origin that is capable of conferring, activating or enhancing expression of a nucleic acid in a cell. The promoter may comprise one or more specific transcriptional regulatory sequences to further enhance expression and/or alter spatial and/or temporal expression thereof. A promoter may also contain distal enhancer or repressor elements, which can be located as much as several thousand pairs of base pairs from the start of transcription. Promoters may be obtained from sources including viruses, bacteria, fungi, plants, insects, and animals. A promoter may regulate expression of a gene component either substantially or differentially with respect to the cell, tissue or organ in which expression occurs or with respect to the developmental stage at which expression occurs or in response to an external stimulus such as a physiological stress, pathogen, metal ion or inducer. Representative examples of promoters include the phage T7 promoter, the phage T3 promoter, the SP6 promoter, the lactose operon-promoter, the tac promoter, the SV40 late promoter, the SV40 early promoter, the RSV-LTR promoter, the CMV IE promoter, the SV40 early promoter or the SV40 late promoter, and the CMVIE promoter.

"Signal peptide" and "leader sequence" refer to amino acid sequences that may be attached to the amino terminus of an avian reovirus protein as described herein. The signal peptide/leader sequence is generally indicative of the location of the protein. The signal peptide/leader sequence used in the present specification preferably promotes secretion of the protein from the cell in which it is produced. The signal peptide/leader sequence is often cleaved from the remainder of the protein, which is often referred to as the mature protein after secretion from the cell. The signal peptide/leader sequence is linked to the N-terminus of the protein.

By "stringent hybridization conditions" is meant conditions under which a first nucleic acid sequence (e.g., a probe) will hybridize to a second nucleic acid sequence (e.g., a target), such as in a complex mixture of nucleic acids. Stringent conditions are sequence dependent and will be different in different circumstances. Stringent conditions may be selected to be about 5-10 ℃ lower than the thermodynamic melting point (Tm) of the particular sequence at a defined ionic strength pH. The Tm can be the temperature (under defined ionic strength, pH, and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (at Tm, 50% of the probes are occupied at equilibrium because the target sequence is present in excess). Stringent conditions may be those in which the salt concentration is less than about 1.0M sodium ion, such as about 0.01-1.0M sodium ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature is at least about 30 ℃ for short probes (e.g., about 10-50 nucleotides) and at least about 60 ℃ for long probes (e.g., greater than about 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. For a selected or specific hybridization, the positive signal can be at least 2 to 10 times the background hybridization. Exemplary stringent hybridization conditions include the following: 50% formamide, 5 XSSC and 1% SDS, incubated at 42 ℃ or 5 XSSC, 1% SDS, incubated at 65 ℃ washed with 0.2 XSSC and 0.1% SDS at 65 ℃.

"substantially complementary" as used herein means that a first sequence is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identical to the complement of a second sequence over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 180, 270, 360, 450, 540 or more nucleotides or amino acids, or that two sequences hybridize under stringent hybridization conditions.

"substantially identical" as used herein means that the first and second sequences are at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 80%, 90%, 95%, 100%, 180%, 270%, 360, 450, 540 or more nucleotides or amino acid regions at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identical, or, in the case of nucleic acids, if the first and second sequences are substantially complementary, so are the first and second sequences, within 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 85, 540 or more nucleotide or amino acid regions.

"subtype" or "serotype": as used interchangeably herein and with respect to avian reovirus, means a genetic variant of avian reovirus such that one subtype is recognized by the immune system and separated from a different subtype.

"variant" as used herein with respect to a nucleic acid means (i) a portion or fragment of a reference nucleotide sequence; (ii) a complement of a reference nucleotide sequence or a portion thereof; (iii) a nucleic acid that is substantially identical to a reference nucleic acid or a complement thereof; or (iv) a nucleic acid that hybridizes under stringent conditions to a reference nucleic acid, its complement, or a sequence substantially identical thereto.

"variants" in the case of peptides or polypeptides differ in amino acid sequence by insertion, deletion or conservative substitution of amino acids, but retain at least one biological activity. A variant also means a protein having substantially the same amino acid sequence as a reference protein having an amino acid sequence that retains at least one biological activity. Conservative substitutions of amino acids, i.e., the replacement of an amino acid with a different amino acid of similar characteristics (e.g., hydrophilicity, extent and distribution of charged regions) are believed in the art to typically involve minor changes. As understood in the art, these minor changes may be identified in part by considering the hydropathic index of amino acids. Kate (Kyte), et al, J.Mol.biol., 157:105-132 (1982). The hydropathic index of the amino acid is based on considerations of its hydrophobicity and charge. It is known in the art that amino acids of similar hydropathic indices can be substituted and still retain protein function. In one aspect, amino acids with a hydropathic index of ± 2 are substituted. The hydrophilicity of amino acids can also be used to reveal substitutions that will result in proteins that retain biological function. Considering the hydrophilicity of amino acids in the case of peptides allows the calculation of the maximum local average hydrophilicity of the peptide, which is a useful measure that has been reported to correlate well with antigenicity and immunogenicity. As is understood in the art, substitution of amino acids with similar hydrophilicity values can result in peptides that retain biological activity (e.g., immunogenicity). Substitutions may be made with amino acids having hydrophilicity values within ± 2 of each other. Both the hydropathic index and the hydropathic value of an amino acid are affected by the specific side chain of the amino acid. Consistent with the observations, amino acid substitutions that are compatible with biological function are understood to depend on the relative similarity of these amino acids, and in particular the side chains of those amino acids, as revealed by hydrophobicity, hydrophilicity, charge, size, and other properties.

"vector" as used herein means a nucleic acid sequence containing an origin of replication. The vector may be a viral vector, a bacteriophage, a bacterial artificial chromosome, or a yeast artificial chromosome. The vector may be a DNA or RNA vector. The vector may be a self-replicating extrachromosomal vector, and is preferably a DNA vector.

2. Vaccine

The vaccines of the present invention can be designed to control the extent or intensity of an immune response in a subject animal against one or more avian reovirus serotypes. The vaccine may comprise elements or agents that inhibit its integration into the chromosome. The vaccine may be RNA encoding structural proteins of avian reovirus. An RNA vaccine can be introduced into the cells. The vaccines of the present invention may comprise avian reovirus structural proteins. Avian reovirus structural proteins are targets for immune-mediated viral clearance by inducing 1) a Cytotoxic T Lymphocyte (CTL) response, 2) a T helper cell response and/or 3) a B cell response, or preferably all of the above-mentioned responses, to achieve cross-presentation.

The antigens may comprise protein epitopes that make them particularly effective as immunogens against which an immune response against avian reovirus can be induced. The avian reovirus antigen may include full length translation products, variants thereof, fragments thereof, or combinations thereof.

Some embodiments relate to nucleic acid molecules encoding immunogenic proteins that are 95% homologous to the nucleic acid coding sequences of the present specification. Some embodiments relate to nucleic acid molecules encoding immunogenic proteins having 96% homology to the nucleic acid coding sequences of the present specification. Some embodiments relate to nucleic acid molecules encoding immunogenic proteins that have 97% homology to the nucleic acid coding sequences of the present specification. Some embodiments relate to nucleic acid molecules encoding immunogenic proteins that have 98% homology to the nucleic acid coding sequences of the present specification. Some embodiments relate to nucleic acid molecules encoding immunogenic proteins having 99% homology to the nucleic acid coding sequences of the present specification. In some embodiments, a nucleic acid molecule having a coding sequence disclosed herein that is homologous to a coding sequence of a protein disclosed herein comprises a sequence encoding an IgE leader sequence linked to the 5' end of the coding sequence encoding the homologous protein sequence disclosed herein.

In some embodiments, the nucleic acid sequence does not contain a coding sequence that encodes a leader sequence. In some embodiments, the nucleic acid sequence does not contain a coding sequence that encodes an IgE leader.

Some embodiments relate to a fragment of SEQ ID NO 1. A fragment may be at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, or at least 55% at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of SEQ ID NO. 1. The fragment may be at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to the fragment of SEQ ID No. 1. The fragment may be at least 80%, at least 85%, at least 90% at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a fragment of SEQ ID No. 1. In some embodiments, a fragment comprises a sequence encoding a leader sequence, e.g., an immunoglobulin leader, such as an IgE leader. In some embodiments, a fragment does not contain a coding sequence that encodes a leader sequence. In some embodiments, the fragment does not contain a coding leader sequence, such as, for example, a coding sequence of an IgE leader.

Some embodiments relate to proteins homologous to SEQ ID NO: 2. Some embodiments relate to immunogenic proteins having 95% homology to the protein sequence as set forth in SEQ ID NO. 2. Some embodiments relate to immunogenic proteins having 96% homology to the protein sequence as set forth in SEQ ID NO. 2. Some embodiments relate to immunogenic proteins having 97% homology to the protein sequence as set forth in SEQ ID NO. 2. Some embodiments relate to immunogenic proteins having 98% homology to the protein sequence as set forth in SEQ ID NO 2. Some embodiments relate to immunogenic proteins having 99% homology to the protein sequence as set forth in SEQ ID NO. 2.

Some embodiments relate to the same protein as SEQ ID NO 2. Some embodiments relate to immunogenic proteins having an amino acid sequence that is 80%, 85%, 91%, 92%, 93%, 95, 97%, 98%, or 99% identical over the entire amino acid sequence length of the full-length consensus amino acid sequence as set forth in seq id No. 2.

In some embodiments, the protein does not contain a leader sequence. In some embodiments, the protein does not contain an IgE leader. A fragment of a protein may comprise at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, or at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the protein. Immunogenic fragments of SEQ ID NO 2 can be provided. An immunogenic fragment can comprise at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, or at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of SEQ ID No. 2. In some embodiments, the fragment comprises a leader sequence, such as, for example, an immunoglobulin leader, such as an IgE leader. In some embodiments, the fragment does not contain a leader sequence. In some embodiments, the fragment does not contain a leader sequence, such as, for example, an IgE leader.

Immunogenic fragments of proteins having amino acid sequences homologous to the immunogenic fragment of SEQ ID NO. 2 can be provided. The immunogenic fragment can comprise at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, or at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the protein that is 295% homologous to seq id NO. Some embodiments relate to immunogenic fragments having 96% homology to the immunogenic fragments of the protein sequences of the present specification. Some embodiments relate to immunogenic fragments that are 97% homologous to immunogenic fragments of the protein sequences of the present specification. Some embodiments relate to immunogenic fragments that are 98% homologous to immunogenic fragments of the present specification protein sequences. Some embodiments relate to immunogenic fragments that are 99% homologous to immunogenic fragments of the present specification protein sequences. In some embodiments, the fragment comprises a leader sequence, such as, for example, an immunoglobulin leader sequence, such as an IgE leader. In some embodiments, the fragment does not contain a leader sequence. In some embodiments, the fragment does not contain a leader sequence, such as, for example, an IgE leader.

Immunogenic fragments of proteins having the same amino acid sequence as the immunogenic fragment of SEQ ID NO. 2 can be provided. The immunogenic fragment may comprise a protein that is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50% or at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical over the entire length of the amino acid sequence set forth in seq id No. 2, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%. In some embodiments, the fragment comprises a leader sequence, such as, for example, an immunoglobulin leader, such as an IgE leader. In some embodiments, the fragment does not contain a leader sequence. In some embodiments, the fragment does not contain a leader sequence, such as, for example, an IgE leader.

3. Vaccine constructs and plasmids

The vaccine may comprise a nucleic acid construct or plasmid encoding the avian reovirus fusion protein. The present specification provides genetic constructs that may comprise nucleic acid sequences encoding the avian reovirus fusion proteins disclosed herein. The genetic construct may be present as a functional extrachromosomal molecule. The genetic construct may be a linear minichromosome comprising a centromere, telomere or plasmid or cosmid.

The genetic construct may also be part of the genome of a recombinant viral vector, including recombinant adenovirus, recombinant adeno-associated virus, and recombinant vaccinia. The genetic construct may be part of the genetic material in a recombinant microbial vector in a live attenuated microorganism or in a cell.

The genetic construct may comprise regulatory elements for gene expression of the coding sequence of the nucleic acid. The regulatory element may be a promoter, enhancer, start codon, stop codon or polyadenylation signal.

The nucleic acid sequence may constitute a genetic construct which may be a vector. The vector is capable of expressing an antigen in cells of an animal in an amount effective to elicit an immune response in the animal. The vector may be recombinant. The vector may comprise a heterologous nucleic acid encoding an antigen. The vector may be a plasmid. The vector may be suitable for transfecting cells with nucleic acid encoding an antigen, the transformed host cells being cultured and maintained under conditions in which expression of the antigen occurs.

The coding sequence can be optimized for stability and high levels of expression. In some cases, the codons are selected to reduce the formation of RNA secondary structures, such as those due to intramolecular bonds.

The vector may comprise a heterologous nucleic acid encoding an antigen, and may further comprise a start codon that may be upstream of the antigen encoding sequence and a stop codon that may be downstream of the antigen encoding sequence. The initiation codon and the stop codon can be in frame with the antigen coding sequence. The vector further comprises a promoter operably linked to the antigen coding sequence. The promoter operably linked to the antigen-encoding sequence may be a promoter from simian virus 40(SV40), mouse mammary virus (MMTV) promoter, Human Immunodeficiency Virus (HIV) promoter such as the Bovine Immunodeficiency Virus (BIV) Long Terminal Repeat (LTR) promoter, Moloney (Moloney) virus promoter, Avian Leukemia Virus (ALV) promoter, Cytomegalovirus (CMV) promoter such as the CMV immediate early promoter, Epstein Barr Virus (EBV) promoter, or Rous Sarcoma Virus (RSV) promoter. The promoter may also be a promoter from a human gene such as human actin, human myosin, human heme, human muscle creatine or human metallothionein. The promoter may also be a tissue-specific promoter, such as a natural or synthetic muscle or skin-specific promoter.

The vector may further comprise a polyadenylation signal, which may be downstream of the avian reovirus core protein coding sequence. The polyadenylation signal may be an SV40 polyadenylation signal, an LTR polyadenylation signal, a bovine growth hormone (bGH) polyadenylation signal, a human growth hormone (hGH) polyadenylation signal, or a human β -globin polyadenylation signal. The SV40 polyadenylation signal may be a polyadenylation signal from the pCEP4 vector (Invitrogen, San Diego, CA).

The vector may also comprise an enhancer upstream of the consensus avian reovirus core protein coding sequence or the consensus avian reovirus surface antigen protein coding sequence. The enhancer is necessary for DNA expression. The enhancer may be human actin, human myosin, human hemoglobin, human muscle creatine or a viral enhancer such as one from CMV, HA, RSV or EBV.

The vector may also comprise an animal origin of replication, in order to maintain the vector extrachromosomally and to produce multiple copies of the vector in the cell. The vector may be pVAX1, pCEP4 or pREP4 from Invitrogen (San Diego, CA), which may contain the replication origin of epstein-barr virus and the nuclear antigen EBNA-1 coding region, which may produce high copy episomal replication without integration. The vector may be a pVAX1 or a pVAX1 variant, such as a variant plasmid as described in the present specification, with a variation. The variant pVax1 plasmid is a 2998 base pair variant of the backbone vector plasmid pVax1(Invitrogen, CarlsbadCA). The CMV promoter is located at base 137-724. The T7 promoter/initiation site was located at base 664-683. The multiple cloning site is located at bases 696-811. The bovine GH polyadenylation signal is at base 829-1053. The Kanamycin (Kanamycin) resistance gene is at base 1226-containing 2020. The pUC origin is at base 2320-2993.

The vector may be pSE420(Invitrogen, San Diego, Calif), which can be used to produce proteins in e. The vector may be pYES2(Invitrogen, San Diego, Calif.) which can be used to produce proteins in a Saccharomyces cerevisiae strain of yeast (Saccharomyces cerevisiae strain). The vector may also have a MAXBACTM complete baculovirus expression system (Invitrogen, San Diego, Calif.), which can be used to produce proteins in insect cells. The vector may also be pcDNA I or pcDNA3(Invitrogen, san diego, Calif.) which can be used to produce proteins in animal cells such as the Sf9 cell line. The vector may be an expression vector or system for producing a protein by conventional techniques and readily available starting materials, including Sambrook et al, Molecular Cloning and Laboratory Manual, 2 nd edition, Cold spring Harbor (1989).

The protein sequence of the SBC fusion protein of the avian reovirus can be an original sequence, an increased sequence and a truncated sequence.

The baculovirus expression system transfer vector in the recombinant baculovirus vector of the present invention includes, but is not limited to, pFastBac1, pVL1393, pFastBac dual, etc., and pVL1393 is preferably used. The promoter can be selected from, but not limited to, P10 promoter, PH promoter, prawn beta-actin gene promoter, OpIE promoter, and other baculovirus promoters. Wherein the transcription termination signal may be selected from any one of, but not limited to, SV40polyA transfection termination signal, HSV tkpolyA transfection termination signal or OpIE polyA termination signal, and other transcription termination signals are also possible. Wherein the insect cell line may be selected from but not limited to Sf9, High Five, S2 or Sf21 cells, preferably Sf 9. The animal of the invention mainly refers to poultry.

The principle of the invention lies in that a recombinant baculovirus shuttle plasmid is constructed, and the plasmid contains an expression gene for expressing the avian reovirus fusion protein. The encoding gene of the avian reovirus fusion protein can use a P10 promoter, a PH promoter, a prawn beta-actin gene promoter, an OpIE promoter and the like, and the corresponding transcription termination signal can be an SV40polyA transfection termination signal, an HSV tk polyA transfection termination signal, an OpIE polyA termination signal and the like. Furthermore, the shuttle plasmid and baculovirus genome plasmid can be constructed to co-transfect insect cells, recombinant baculovirus can be obtained through screening, and the recombinant baculovirus can be inoculated into Sf9 cells to simultaneously express the avian reovirus fusion protein.

Specifically, the designed codon-optimized fusion protein coding gene can be cloned to the BamH I and Pst I enzyme cutting sites of the pVL1393 plasmid vector to construct recombinant plasmidGroup shuttleAnd (3) a carrier. And then co-transfecting the Sf9 cells with the constructed recombinant shuttle vector and the baculovirus genome plasmid to obtain the recombinant baculovirus.

The fusion protein is expressed by using baculovirus and Sf9 cells, the antigenicity, immunogenicity and function of the obtained fusion protein are similar to those of natural protein, the expression level is higher, the immunogenicity is strong, and the fusion protein is not pathogenic to poultry.

The invention is further illustrated by the following examples, which are not intended to limit the scope of the invention. The reagents and starting materials used in the following examples are commercially available, and the test methods in which specific conditions are not specified are generally carried out under conventional conditions or conditions recommended by the respective manufacturers. Further, unless otherwise indicated, the assays, detection methods, and preparations disclosed herein are performed using molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA techniques, and techniques conventional in the art. These techniques are well described in the literature, and may be found in particular in the study of the MOLECULAR CLONING, Sambrook et al: a LABORATORYMANUAL, Second edition, Cold Spring Harbor Laboratory Press, 1989and third edition, 2001; ausubel et al, Current PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987 and periodic updates; the series METHODS IN ENZYMOLOGY, Academic Press, San Diego; wolffe, CHROMATIN STRUCTURE AND FUNCTION, third edition, Academic Press, San Diego, 1998; (iii) METHODS IN ENZYMOLOGY, Vol.304, Chromatin (P.M.Wassarman and A.P.Wolffe, eds.), Academic Press, San Diego, 1999; and Methodsin Molecular BIOLOGY, Vol.119, Chromatin Protocols (P.B.Becker, ed.) Humana Press, Totowa, 1999, etc.

Example 1 construction and characterization of the transfer vector pVL-SBC

1. SBC gene amplification A codon-optimized SBC gene (SEQ ID NO: 1) was synthesized by Nanjing Kingsrey Biotech Co., Ltd and cloned into pMD19 vector to obtain pMD19-SBC plasmid vector. PCR amplification was performed using pMD19-SBC as a template, SBC-F (SEQ ID NO: 3), SBC-R as a primer (SEQ ID NO: 4), and the specific amplification system is shown in Table 1. The reaction conditions are as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 95 ℃ for 45 sec, renaturation at 60 ℃ for 45 sec, and extension at 72 ℃ for 30 sec for 30 cycles. Followed by extension at 72 ℃ for 10 minutes and storage at 4 ℃.

TABLE 1 amplification System for SBC genes

2. The purified PCR product was recovered from the SBC gene and pVL1393 plasmid ligated gel (see FIG. 1 for corresponding characterization), and the pVL1393 plasmid vector and the purified PCR product were digested simultaneously with BamHI and pstI at 37 ℃ for 3 hours, and the specific digestion reaction system is shown in Table 2. Then, the plasmid and the PCR product which are purified by using the gel recovery purification kit are respectively purified, and the plasmid and the PCR product which are purified and digested by the enzyme T4 are connected in a water bath at 16 ℃ overnight, and the specific connection reaction system is shown in Table 3.

TABLE 2 SBC gene and pVL1393 plasmid digestion reaction system

TABLE 3 SBC Gene and pVL1393 plasmid ligation System

3. Transformation of ligation products 10. mu.l of ligation product was added to 100. mu.l of DH 5. alpha. competent cells and mixed well, ice-cooled for 30 minutes, heat shocked in a water bath at 42 ℃ for 90 seconds, ice-cooled for 2 minutes and added to 900. mu.l of LB medium. After culturing at 37 ℃ for 1 hour, 1ml of the suspension was concentrated to 100. mu.l and applied to LB solid medium containing 100. mu.g/ml ampicillin, and cultured at 37 ℃ for 16 hours.

4. Extraction of recombinant plasmid 4 single colonies on the plate were picked to contain Amp^rAnd (4) culturing the strain in 1ml of resistant culture medium for 2 hours, and carrying out colony PCR by using the strain liquid as a template and using SBC-F and SBC-R primers. The reaction conditions are as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 95 ℃ for 45 seconds, renaturation at 60 ℃ for 45 seconds, extension at 72 ℃ for 2 minutes, 30 cycles; then the extension is carried out for 10 minutes at 72 ℃,preserving at 4 ℃. The PCR product was gel electrophoresed, EB stained, and the gel electrophoresed under UV light. A DNA band with the molecular weight of about 1.0kb appears in the sample to be detected (the corresponding characterization result is shown in figure 2), and the sample is judged to be positive; otherwise, the result was negative. The identified positive clones were sequenced, the sequences selected and the strains deposited in the correct orientation. The schematic diagram of the constructed transfer vector pVL-SBC containing the target gene is shown in FIG. 3.

Example 2 construction and acquisition of recombinant baculovirus rBac-SBC

Transfection of 1 Sf9 cells 2 × 10 was seeded in 6cm tissue culture dishes⁶Sf9 cells with a confluency of 50-70%. After the cells adhered (about 15 minutes), the medium was removed and 1ml of transfection buffer A (BD bioscience. com, cat. 554740) was added. 0.5ug of BD Baculogold Linear cultured BaculovirusDNA and 2ug of pVL-SBC plasmid were mixed in a sterile EP tube, left for 5min, and 1ml of transfection reagent B (BD bioscience. com, cat. 554740) was added and mixed well. Then 1ml of the transfection reagent B/DNA mixture was pipetted into the tissue culture dish and incubated at 27 ℃ for 4 hours. After removing the transfection complex, the cells were washed three times with cell culture medium, 3ml of fresh medium was added, the cells were cultured at 27 ℃ to observe the cytopathic condition and the recombinant baculovirus was harvested.

2 purification of recombinant Virus (plaque assay) 2-2.5 × 10 was plated in 6cm tissue culture dishes⁶Sf9 cells were left at room temperature for 5 minutes. Gradient dilution (dilution ratio: 10)^-4～10^-7) The above-described co-transfected viral supernatants. Then, 1ml of the diluted virus was added to each petri dish, and left at room temperature for 1 hour with shaking appropriately every 15 minutes to allow the virus to be sufficiently infected.

Preparing 2% low concentration agarose with sterile water, and heating to 60 deg.C with microwave to melt it completely. Then the mixture is put into a water bath kettle at the temperature of 42 ℃ for constant temperature, and then 1 volume of 2 XGrace culture medium is added and mixed evenly.

The cell culture dish was aspirated from the culture supernatant, the cell surface was covered with 4ml of 1% agarose, while all air bubbles were aspirated, and the agarose solidified after 10-15 minutes. The culture dish was placed in a humid environment, incubated at 27 ℃ for 7 days, and plaque was observed. Plaques were marked on petri dishes, picked using a pipette tip, inoculated in 700ul of SFM medium and shaken overnight at 4 ℃. And (4) harvesting cell culture to obtain the recombinant virus, namely the F0 generation virus, which can be used for amplification and production of the virus.

In addition, recombinant baculoviruses were constructed with the following proteins (table 4, table 5) according to the above example:

TABLE 4

TABLE 5

Example 3SDS-PAGE detection

The cell culture harvested in example 2 was subjected to SDS-PAGE detection while using Sf9 cells infected with empty baculovirus as a negative control. The specific operation is as follows: mu.l of the harvested cell culture was taken, 10. mu.l of 5 Xloadingbuffer was added, the mixture was centrifuged at 12000r/min for 1 minute in a boiling water bath for 5 minutes, and the supernatant was subjected to SDS-PAGE gel (12% strength gel) electrophoresis, and the gel was stained and decolored after electrophoresis to observe the band of interest. As shown in FIG. 4, the band of interest appeared around a molecular weight of about 36kDa, and the negative control had no band at the corresponding position.

Example 4Western Blot identification

The product after SDS-PAGE electrophoresis in example 3 was transferred to an NC (nitrocellulose) membrane, blocked with 5% skim milk for 2 hours, incubated with chicken-derived anti-ARV positive serum for 2 hours, rinsed, incubated with secondary goat anti-chicken polyclonal antibody labeled with HRP for 2 hours, rinsed, and then added dropwise with an enhanced chemiluminescent fluorescent substrate and photographed using a chemiluminescent imager. As shown in FIG. 5, the recombinant baculovirus expression sample had a band of interest, and the negative control had no band of interest, indicating that the antigen protein of interest was correctly expressed in Sf9 cells.

Example 5 Indirect immunofluorescence assay

Sf9 cell suspension transfected by rBac-SBC (cell concentration of 2.5 × 10) is added into a 96-well cell culture plate, and the suspension is 100 mul/well⁵～4.0×10⁵piece/mL), 4 wells are inoculated, the mixture is kept still at 27 ℃ for 15 minutes, Sf9 cells are attached to the bottom wall of the culture plate, and then 10 mul of virus seeds diluted by 10 times are added into each well. Meanwhile, a blank cell control is set. After inoculation, the cells are placed in a constant-temperature incubator at 27 ℃ for culture for 72-96 hours, the culture solution is discarded, and cold methanol/acetone (1: 1) is used for fixation. Firstly reacting with chicken source anti-ARV multi-antiserum, then reacting with FITC labeled goat anti-chicken IgG, and observing the result by an inverted fluorescence microscope. As shown in FIG. 6, no fluorescence could be observed when the cells inoculated with the empty baculovirus Sf9, while fluorescence could be observed when the cells inoculated with the recombinant baculovirus Sf9 indicated that the target antigen was correctly expressed in Sf9 cells and the recombinant baculovirus was correctly constructed.

EXAMPLE 6 bioreactor serum-free suspension culture of insect cells

Aseptically culturing Sf9 insect cells in 1000ml shake flask for 3-4 days until the concentration reaches 3-5 × 10⁶When the cell/mL is more than 95 percent in activity, inoculating the cells into a 5L bioreactor, wherein the inoculation concentration is 3-8 × 10⁵When the cell concentration reaches 3-55 × 10⁶At cell/mL, cells were seeded into a 50L bioreactor and grown to a concentration of 3-55 × 10⁶cell/mL, inoculating into a 500L bioreactor until the cell concentration reaches 2-85 × 10⁶When the cell/mL is obtained, the recombinant baculovirus rBac-SBC is inoculated, and the culture conditions of the reactor are that the pH value is 6.0-6.5, the temperature is 25-27 ℃, the dissolved oxygen is 30-80 percent, and the stirring speed is 100-180 rpm. In view of the optimum conditions for cell culture, it is preferable to set pH6.2, the temperature at the stage of cell culture at 27 ℃, the dissolved oxygen at 50%, and the stirring speed at 100-180 rpm. After further culturing for 5-9 days after infection, one thousandth of the final concentration BEI (diethylene imine, CAS number 109-97-7) is added, after 48 h of action at 37 ℃, two thousandth of the final concentration Na is added₂S₂O₃The inactivation is terminated. Cell culture supernatant is harvested by centrifugation or hollow fiber filtration, and stock solution is stored at 2-8 ℃.

Example 7 protein purification

1. Purifying the harvested stock solution by cation exchange chromatography

The strong cation particle chromatography packing POROS 50HS is used for carrying out particle exchange chromatography, and the packing is disinfected by 0.5M NaOH before use. The vaccine stock was then equilibrated with microfiltration buffer (20 mM PBS, pH = 7.4) at room temperature, and then loaded onto the column at a rate of 125mL/min, followed by elution with rinse buffer a (0.05M MOPS (sodium salt), pH =7.0, 0.5M NaCl) for 8 column volumes. Elution was then performed with a linear gradient from 0% buffer B to 100% buffer B (0.05M MOPS (sodium salt), pH =7.0, 1.5M NaCl), where a total of 10 column volumes were eluted with linear elution, and then the 10 column volumes were harvested separately. After linear elution, 2 column volumes were eluted with buffer B and collected separately. The eluate from each column volume was subjected to SDS-PAGE, and the collected samples containing the higher concentration of the target protein were pooled and placed in a 2L sterile plastic bottle at 4 ℃ to define sample 1. The fraction collected under the last elution peak (A280) was then sterile filtered and stored at 4 ℃ and defined as sample 2.

2. Hydroxyapatite hydrophobic chromatography

Using a pre-packed Hydroxyapatite column (CHT; (Ceramic hydro xyapatite Type II Media), first, 50 mM MOPS (sodium salt) was used, pH =7.0, 1.25M NaCl was used for equilibration, then the above sample 1 was loaded at 90 cm/h, after loading, 8 volumes of equilibration solution (50 mM MOPS (sodium salt), pH =7.0, 1.25M NaCl) were used for elution until the UV value was zero, then, eluent (0.2M phosphate, pH =7.0, 1.25M NaCl) was used for gradient elution, the concentration of eluent was from 0% to 100%, the rate was still 90 cm/h, the elution volume was 4 column volumes, and the eluates were separately harvested and detected, and the eluate containing the target protein was determined according to SDS-PAGE detection, thereby purifying the target protein.

The purified target protein was quantified using BCA total protein and then the purity of the target protein was determined by combining a gray-scale scan, and the purified protein was shown in FIG. 7, with a target protein concentration of 312. mu.g/mL and a purity of 92%.

Example 8 agar amplification assay

The titer of the expressed recombinant SBC protein was determined using the agar amplification method.

Detecting one: punching plum blossom holes on an agarose gel plate, adding ARV S1133 strain positive serum in the middle of the plum blossom holes, and adding 2 diluted recombinant SBC proteins of 1, 2, 3, 4, 5 and 6 power around the plum blossom holes respectively. After incubation in an inverted position for 72 h, the line of precipitation was observed. The maximum dilution at which a precipitate line appears is its agar titer. The agar titer detection results are as follows: the SBC protein agarose titer is 1: 64.

And (2) detecting: a quincunx well was punched on an agarose gel plate, and recombinant SBC protein diluted 2 times was added to the middle of the quincunx well, and positive sera of S1133, LN02, 1733, 138, and 916 were added to the periphery, respectively. After incubation in an inverted position for 72 h, the line of precipitation was observed. The results show that: a clear line of precipitation appeared between each positive serum and the antigen well.

And (3) detection: a quincuncial hole is punched on 3 agarose gel plates, recombinant SBC-A, SBC-B or SBC-E fusion protein is added in the middle of the quincuncial hole, and S1133, LN02, 1733, 138 and 916 positive serums are respectively added around each plate. After incubation in an inverted position for 72 h, the line of precipitation was observed. The results are shown in Table 6.

TABLE 6 detection results of agar titer

And (4) detecting: the wells were punched on 2 agarose gel plates, ARV- σ B or ARV- σ C was added to the middle of the wells, and positive sera of S1133, LN02, 1733, 138 and 916 were added to the periphery of each plate. After incubation in an inverted position for 72 h, the line of precipitation was observed. The results are shown in Table 7.

TABLE 7 agar titer test results

EXAMPLE 9 preparation of the vaccine

The recombinant protein stock solution expressed in example 7 was diluted with physiological saline so that the concentration of the antigen protein reached 1:4 when the positive serum of strain S1133 was used for detection of agar titer, and then the diluted vaccine stock solution and the oil adjuvant were formulated into an oil emulsion vaccine at a ratio of 2: 3. Specifically, 1429g of white oil, 70.2g of span, 8.43g of aluminum stearate and 53.3g of tween are added into 1L of mixed vaccine stock solution. Then crushing and emulsifying by an emulsifying crusher to prepare an oil emulsion adjuvant inactivated vaccine, and storing at 4 ℃ after quality inspection is qualified.

Example 10 immunoassay

Test one: 0.2ml of the vaccine prepared in example 9 was intramuscularly injected into 15 and 10 SPF chickens of 21 to 28 days old, and 5 were used as controls. On 28 days after immunization, each chicken was bled, and serum was separated and antibody detection was performed using an antibody ELISA kit manufactured by IDEXX. The ELISA antibodies in the immune group are all positive, and the ELISA antibodies in the control group are all negative.

And (2) test II: cell culture supernatants obtained by infecting Sf9 cells with 7 recombinant baculoviruses prepared in example 2 were diluted with physiological saline, and the diluted proteins were mixed in equal proportions or added individually to a white oil adjuvant, emulsified and mixed using a high-speed shear emulsifier, and stored at 4 ℃.

270 SPF chickens of 21-28 days old are taken and randomly divided into 9 groups, each group comprises 30 SPF chickens, 0.2 mL/SBC vaccine prepared by the recombinant fusion protein SBC of the patent is subcutaneously inoculated on the neck and back of the first group, 0.2 mL/SBC vaccine prepared by different antigen proteins SBC-A, SBC-B, SBC-C, SBC-D, SBC-E, S1133 strain ARV-sigma B and S1133 strain ARV-sigma C is respectively inoculated on the last seven groups, the 9 th group is used as a negative control, and the vaccine prepared by Sf9 cell culture harvested by the empty-rod virus through emulsification is immunized. Blood was collected 28 days after immunization of all chickens, and serum was isolated and subjected to ELISA antibody titer measurement, and the results of the measurement are shown in Table 8.

Dividing the 8 groups of the blood-collected chickens into 3 groups, 10 chickens in each group, and attacking the standard virulent AV2311, 138 strains and 916 strains of Chinese medicine inspection institute with foot pads in a dose of 1 × 10^4.0ELD₅₀Only, observed for 7 days, the survival rate was recorded as shown in Table 8.

TABLE 8 antibody titer and survival ratio of chicken immune challenge

It is to be understood that the above-described embodiments are part of the present invention, and not all embodiments. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention as claimed, but is merely representative of selected embodiments of the invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Sequence listing

<110> Suzhou Shino Biotechnology Ltd

Novel <120> avian reovirus genetic engineering vaccine

<160>11

<170>SIPOSequenceListing 1.0

<210>1

<211>999

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>1

ggatccatga tctccgctag cctgcaggac atgacccaca cactggacga cgttaccgct 60

aacctggacg gtctgcgcac caccgtgacc gccctgcaga tctccgctaa cctccaggac 120

atgacccaca ccctggacga cgtgaccgct aacctcgacg gcctgcgcac caccgtgaca 180

gccctgcaga tctccgctaa cctgcaggac atgactcaca tcctggacga cgtgaccgcc 240

aacctggacg gcctgcgtac caccgtgacc gctctgcaga tctctgctga cctgcagaac 300

gtgacccgtg ccctcgacga cgtgacagct aacctggacg gtatgcgtgt gactatcact 360

accctgcagg aatccgactt gcagggagtg gtgagcagcc tgggtcaggc taacagcacc 420

ctgaccgaac tgagcaagga actgcgtcag ctgagctccc tcctggacca gtacgctgtg 480

gctctagaaa gcatcgctga ccactacgac gaaatctcac agcgtatggt ggacgaacct 540

gaaaacgacg aagtggctcc tctggacatc gtcacccgca ctgaatccat ccgctctgac 600

aagaccgttg accctgactt ctggacatac cctctagaac gccgtagcga tgatagccgc 660

cgtgacatcg ctgccagctg ttggcgtatg atcgacgcta gcagccgtag cctgaccctg 720

cctaactgtc tcgtgagccc tagcctgcac tcccgtagcg tgttcggcca gatgcagaca 780

accaccacca tctacgacgt ggccgctagc ggcaaggctg tgaagttctc ccctatggtg 840

gccaccctga gccagcgtga cgctggtcct gtgaagctgg ctaacgctga ccctgctgaa 900

ggcgtgtact ccttctggac ctcccacttc gctttctccc ctctgatcgg cggtgtgggt 960

atcaccggcc agtacgctcg tgaaagctga taagaattc 999

<210>2

<211>327

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>2

Met Ile Ser Ala Ser Leu Gln Asp Met Thr His Thr Leu Asp Asp Val

1 5 10 15

Thr Ala Asn Leu Asp Gly Leu Arg Thr Thr Val Thr Ala Leu Gln Ile

20 25 30

Ser Ala Asn Leu Gln Asp Met Thr His Thr Leu Asp Asp Val Thr Ala

35 40 45

Asn Leu Asp Gly Leu Arg Thr Thr Val Thr Ala Leu Gln Ile Ser Ala

50 55 60

Asn Leu Gln Asp Met Thr His Ile Leu Asp Asp Val Thr Ala Asn Leu

65 70 75 80

Asp Gly Leu Arg Thr Thr Val Thr Ala Leu Gln Ile Ser Ala Asp Leu

85 90 95

Gln Asn Val Thr Arg Ala Leu Asp Asp Val Thr Ala Asn Leu Asp Gly

100 105 110

Met Arg Val Thr Ile Thr Thr Leu Gln Glu Ser Asp Leu Gln Gly Val

115 120 125

Val Ser Ser Leu Gly Gln Ala Asn Ser Thr Leu Thr Glu Leu Ser Lys

130 135 140

Glu Leu Arg Gln Leu Ser Ser Leu Leu Asp Gln Tyr Ala Val Ala Leu

145 150 155 160

Glu Ser Ile Ala Asp His Tyr Asp Glu Ile Ser Gln Arg Met Val Asp

165 170 175

Glu Pro Glu Asn Asp Glu Val Ala Pro Leu Asp Ile Val Thr Arg Thr

180 185 190

Glu Ser Ile Arg Ser Asp Lys Thr Val Asp Pro Asp Phe Trp Thr Tyr

195 200 205

Pro Leu Glu Arg Arg Ser Asp Asp Ser Arg Arg Asp Ile Ala Ala Ser

210 215 220

Cys Trp Arg Met Ile Asp Ala Ser Ser Arg Ser Leu Thr Leu Pro Asn

225 230 235 240

Cys Leu Val Ser Pro Ser Leu His Ser Arg Ser Val Phe Gly Gln Met

245 250 255

Gln Thr Thr Thr Thr Ile Tyr Asp Val Ala Ala Ser Gly Lys Ala Val

260 265 270

Lys Phe Ser Pro Met Val Ala Thr Leu Ser Gln Arg Asp Ala Gly Pro

275 280 285

Val Lys Leu Ala Asn Ala Asp Pro Ala Glu Gly Val Tyr Ser Phe Trp

290 295 300

Thr Ser His Phe Ala Phe Ser Pro Leu Ile Gly Gly Val Gly Ile Thr

305 310 315 320

Gly Gln Tyr Ala Arg Glu Ser

325

<210>3

<211>38

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>3

ataggatcca tgatctccgc tagcctgcag gacatgac 38

<210>4

<211>35

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>4

atagaattct tatcagcttt cacgagcgta ctggc 35

<210>5

<211>909

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>5

ggatccatga tctccgctag cctgcaggac atgacccaca cactggacga cgttaccgct 60

aacctggacg gtctgcgcac caccgtgacc gccctgcaga tctccgctaa cctccaggac 120

atgacccaca ccctggacga cgtgaccgct aacctcgacg gcctgcgcac caccgtgaca 180

gccctgcaga tctccgctaa cctgcaggac atgactcaca tcctggacga cgtgaccgcc 240

aacctggacg gcctgcgtac caccgtgacc gctctgcaga tctctgctga cctgcagaac 300

gtgacccgtg ccctcgacga cgtgacagct aacctggacg gtatgcgtgtgactatcact 360

accctgcagc tcctggacca gtacgctgtg gctctagaaa gcatcgctga ccactacgac 420

gaaatctcac agcgtatggt ggacgaacct gaaaacgacg aagtggctcc tctggacatc 480

gtcacccgca ctgaatccat ccgctctgac aagaccgttg accctgactt ctggacatac 540

cctctagaac gccgtagcga tgatagccgc cgtgacatcg ctgccagctg ttggcgtatg 600

atcgacgcta gcagccgtag cctgaccctg cctaactgtc tcgtgagccc tagcctgcac 660

tcccgtagcg tgttcggcca gatgcagaca accaccacca tctacgacgt ggccgctagc 720

ggcaaggctg tgaagttctc ccctatggtg gccaccctga gccagcgtga cgctggtcct 780

gtgaagctgg ctaacgctga ccctgctgaa ggcgtgtact ccttctggac ctcccacttc 840

gctttctccc ctctgatcgg cggtgtgggt atcaccggcc agtacgctcg tgaaagctga 900

taagaattc 909

<210>6

<211>909

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>6

ggatccatga tctccgctag cctgcaggac atgacccaca cactggacga cgttaccgct 60

aacctggacg gtctgcgcac caccgtgacc gccctgcaga tctccgctaa cctccaggac 120

atgacccaca ccctggacga cgtgaccgct aacctcgacg gcctgcgcac caccgtgaca 180

gccctgcaga tctccgctaa cctgcaggac atgactcaca tcctggacga cgtgaccgcc 240

aacctggacg gcctgcgtac caccgtgacc gctctgcagg aatccgactt gcagggagtg 300

gtgagcagcc tgggtcaggc taacagcacc ctgaccgaac tgagcaagga actgcgtcag 360

ctgagctccc tcctggacca gtacgctgtg gctctagaaa gcatcgctga ccactacgac 420

gaaatctcac agcgtatggt ggacgaacct gaaaacgacg aagtggctcc tctggacatc 480

gtcacccgca ctgaatccat ccgctctgac aagaccgttg accctgactt ctggacatac 540

cctctagaac gccgtagcga tgatagccgc cgtgacatcg ctgccagctg ttggcgtatg 600

atcgacgcta gcagccgtag cctgaccctg cctaactgtc tcgtgagccc tagcctgcac 660

tcccgtagcg tgttcggcca gatgcagaca accaccacca tctacgacgt ggccgctagc 720

ggcaaggctg tgaagttctc ccctatggtg gccaccctga gccagcgtga cgctggtcct 780

gtgaagctgg ctaacgctga ccctgctgaa ggcgtgtact ccttctggac ctcccacttc 840

gctttctccc ctctgatcgg cggtgtgggt atcaccggcc agtacgctcg tgaaagctga 900

taagaattc 909

<210>7

<211>909

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>7

ggatccatga tctccgctag cctgcaggac atgacccaca cactggacga cgttaccgct 60

aacctggacg gtctgcgcac caccgtgacc gccctgcaga tctccgctaa cctccaggac 120

atgacccaca ccctggacga cgtgaccgct aacctcgacg gcctgcgcac caccgtgaca 180

gccctgcaga tctctgctga cctgcagaac gtgacccgtg ccctcgacga cgtgacagct 240

aacctggacg gtatgcgtgt gactatcact accctgcagg aatccgactt gcagggagtg 300

gtgagcagcc tgggtcaggc taacagcacc ctgaccgaac tgagcaagga actgcgtcag 360

ctgagctccc tcctggacca gtacgctgtg gctctagaaa gcatcgctga ccactacgac 420

gaaatctcac agcgtatggt ggacgaacct gaaaacgacg aagtggctcc tctggacatc 480

gtcacccgca ctgaatccat ccgctctgac aagaccgttg accctgactt ctggacatac 540

cctctagaac gccgtagcga tgatagccgc cgtgacatcg ctgccagctg ttggcgtatg 600

atcgacgcta gcagccgtag cctgaccctg cctaactgtc tcgtgagccc tagcctgcac 660

tcccgtagcg tgttcggcca gatgcagaca accaccacca tctacgacgt ggccgctagc 720

ggcaaggctg tgaagttctc ccctatggtg gccaccctga gccagcgtga cgctggtcct 780

gtgaagctgg ctaacgctga ccctgctgaa ggcgtgtact ccttctggac ctcccacttc 840

gctttctccc ctctgatcgg cggtgtgggt atcaccggcc agtacgctcg tgaaagctga 900

taagaattc 909

<210>8

<211>909

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>8

ggatccatga tctccgctag cctgcaggac atgacccaca cactggacga cgttaccgct 60

aacctggacg gtctgcgcac caccgtgacc gccctgcaga tctccgctaa cctgcaggac 120

atgactcaca tcctggacga cgtgaccgcc aacctggacg gcctgcgtac caccgtgacc 180

gctctgcaga tctctgctga cctgcagaac gtgacccgtg ccctcgacga cgtgacagct 240

aacctggacg gtatgcgtgt gactatcact accctgcagg aatccgactt gcagggagtg 300

gtgagcagcc tgggtcaggc taacagcacc ctgaccgaac tgagcaagga actgcgtcag 360

ctgagctccc tcctggacca gtacgctgtg gctctagaaa gcatcgctga ccactacgac 420

gaaatctcac agcgtatggt ggacgaacct gaaaacgacg aagtggctcc tctggacatc 480

gtcacccgca ctgaatccat ccgctctgac aagaccgttg accctgactt ctggacatac 540

cctctagaac gccgtagcga tgatagccgc cgtgacatcg ctgccagctg ttggcgtatg 600

atcgacgcta gcagccgtag cctgaccctg cctaactgtc tcgtgagccc tagcctgcac 660

tcccgtagcg tgttcggcca gatgcagaca accaccacca tctacgacgt ggccgctagc 720

ggcaaggctg tgaagttctc ccctatggtg gccaccctga gccagcgtga cgctggtcct 780

gtgaagctgg ctaacgctga ccctgctgaa ggcgtgtact ccttctggac ctcccacttc 840

gctttctccc ctctgatcgg cggtgtgggt atcaccggcc agtacgctcg tgaaagctga 900

taagaattc 909

<210>9

<211>909

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>9

ggatccatga tctccgctaa cctccaggac atgacccaca ccctggacga cgtgaccgct 60

aacctcgacg gcctgcgcac caccgtgaca gccctgcaga tctccgctaa cctgcaggac 120

atgactcaca tcctggacga cgtgaccgcc aacctggacg gcctgcgtac caccgtgacc 180

gctctgcaga tctctgctga cctgcagaac gtgacccgtg ccctcgacga cgtgacagct 240

aacctggacg gtatgcgtgt gactatcact accctgcagg aatccgactt gcagggagtg 300

gtgagcagcc tgggtcaggc taacagcacc ctgaccgaac tgagcaagga actgcgtcag 360

ctgagctccc tcctggacca gtacgctgtg gctctagaaa gcatcgctga ccactacgac 420

gaaatctcac agcgtatggt ggacgaacct gaaaacgacg aagtggctcc tctggacatc 480

gtcacccgca ctgaatccat ccgctctgac aagaccgttg accctgactt ctggacatac 540

cctctagaac gccgtagcga tgatagccgc cgtgacatcg ctgccagctg ttggcgtatg 600

atcgacgcta gcagccgtag cctgaccctg cctaactgtc tcgtgagccc tagcctgcac 660

tcccgtagcg tgttcggcca gatgcagaca accaccacca tctacgacgt ggccgctagc 720

ggcaaggctg tgaagttctc ccctatggtg gccaccctga gccagcgtga cgctggtcct 780

gtgaagctgg ctaacgctga ccctgctgaa ggcgtgtact ccttctggac ctcccacttc 840

gctttctccc ctctgatcgg cggtgtgggt atcaccggcc agtacgctcg tgaaagctga 900

taagaattc 909

<210>10

<211>1104

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>10

atggaggtac gtgtgccaaa ctttcactcg ttcgttgaag gaataacatc tagctatttg 60

aagactcctg cttgctggaa tgcacagaca gcctgggaca ctgtgacttt tcacgtccct 120

gatgtaatta gagttggcaa tgcgtattgt tgctctcaat gttgtggtgt actttattac 180

gggactctgc ccgcggatgg aaattacttc cctcatcaca aatgccatca gcaacagtac 240

aggaccgata ccccactgct ccggtatgtg cgaattggca gaacgactga gcatctgttg 300

gaccaatatg ctgttgcgct ggagtctatt gctgatcact atgatgaaat cagtcaacgc 360

atggtcgatg agccagagaa cgatgaagtc gcgccccttg acattgtaac gcgtactgaa 420

tctatccgaa gtgataagac ggttgacccg gacttttgga cttacccgct tgagcgacgt 480

tctgatgatt ctcgtcgaga catcgccgca tcatgctgga gaatgattga tgcatcatca 540

cgtagtctca ctcttccaaa ttgtcttgtg tccccgtctt tgcattctcg ttccgtcttt 600

ggtcaaatgc aaacgaccac caccatatac gatgttgcgg cgtcgggaaa ggccgttaaa 660

ttttctccga tggtggctac actatcgcaa cgtgatgctg gccctgtaaa gcttgcgaat 720

gctgacccag cggaaggtgt atattcattt tggacgtcgc acttcgcctt ctcaccgctc 780

attggtggag ttgggattac gggacagtac gctcgtgagt cataccatca cgtgggtcat 840

ccagtgattg ggagtggtaa gaaggcgtca cactacaaaa atctgtttat ggaatcatgg 900

cgtgggtggt caaagtcagc tttcgcatgc gctacaggaa tggagccagc tgaatgtgaa 960

tctcgtctga ggggacatgc tcgcactatg cttggacgct ctctgccgaa cgtctgtgac 1020

gacgaggttg ctcagcagtc tggcgccgtg ctaacgtccc tgcagaagac taccaagttc 1080

actgttgtgg agtgtggttg gtaa 1104

<210>11

<211>981

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>11

atggcgggtc tcaatccatc gcagcgaaga gaggtcgtca gcttgatact gtcattgact 60

tcgaacgtga ctataagtca tggcgatttg acgccgatct atgaacggct gaccaatcta 120

gaagcgtcta cggagttatt acatcgctcc atttccgata tatccactac tgtctcaaat 180

atttctgcaa gtttacaaga catgacccat accttggatg atgtaactgc taatttagac 240

ggtttgagga ccactgttac tgcacttcag gattccgtct ccattctgtc tacaaatgtg 300

actgacttaa cgaacacatc ctctgcgcac gcggcgacac tatcttcact tcaaactacg 360

gttgacggaa acttcactgc catctccaat ttgaagagtg atgtatcgtc gaacggttta 420

gctattacag atctgcagga tcgtgttaaa tcattggagt ctaccgcgag tcatggtcta 480

tctttttcgc ctccacttag tgtcgctgac ggcgtggttt cattagacat ggacccctac 540

ttctgttctc aacgagtttc tttaacatca tactcggcgg aggctcaact aatgcaattt 600

cggtggatgg cacggggtac taacggatca tctgatacca ttgacatgac cgttaacgct 660

cactgtcatg gaagacgcac tgattatatg atgtcgtcca cgggaaatct cacggtcact 720

agtaacgtcg tgttattaac cttcgattta agttacataa cgcctatccc atcagaccta 780

gcacgtcttg ttcccagtgc gggattccaa gctgcgtcgt tccctgtgga cgtatcattc 840

acccgcgatt ctgcgactca tgcgtaccaa gcgtatgggg tgtactcgag ctcacgtgtc 900

ttcacaatta ctttcccaac cggaggtgat ggtgcagcga acattcgttc cttgaccgtg 960

cgtaccggca tcgacaccta a 981

Claims (9)

1. The amino acid sequence of the fusion protein is shown as SEQ ID NO. 2.

2. The gene encoding the fusion protein of claim 1.

3. The coding gene of claim 2, wherein: the sequence of the coding gene is shown as SEQID NO. 1.

4. A recombinant gene vector or a recombinant baculovirus comprising the encoding gene of claim 2 or 3.

5. An immunological composition characterized by comprising: a fusion protein of claim 1; and, a pharmaceutically acceptable carrier.

6. The immunogenic composition of claim 5, wherein: the pharmaceutically acceptable carrier comprises one or more of white oil, aluminum stearate, span and Tween.

7. The method of producing a fusion protein according to claim 1, comprising:

s1, cloning the encoding gene of the fusion protein to a baculovirus expression system transfer vector to obtain a recombinant baculovirus transfer vector;

s2, co-transfecting the insect cells with the recombinant baculovirus transfer vector and the baculovirus genome plasmid, and screening to obtain recombinant baculovirus;

s3, inoculating the recombinant baculovirus into insect cells to obtain the fusion protein;

the baculovirus expression system transfer vector comprises any one of pFastBac1 and pVL 1393;

the insect cells include Sf9, High Five or Sf21 cells.

8. Use of the fusion protein of claim 1 or the immunogenic composition of claim 5 or 6 in the manufacture of a medicament for inducing an immune response against an avian reovirus antigen in a subject animal or for preventing infection of an animal by an avian reovirus.

9. Use of the fusion protein of claim 1 or the immunogenic composition of claim 5 or 6 in the preparation of an avian reovirus genetically engineered vaccine.

Images