CN110279855B

CN110279855B - Novel genetic engineering vaccine of porcine Seneca virus, preparation method and application thereof

Info

Publication number: CN110279855B
Application number: CN201910649670.9A
Authority: CN
Inventors: 曹文龙; 孔迪; 滕小锘; 易小萍; 张大鹤
Original assignee: Suzhou Shinuo Biotechnology Co ltd
Current assignee: Suzhou Womei Biology Co ltd
Priority date: 2019-07-18
Filing date: 2019-07-18
Publication date: 2020-04-03
Anticipated expiration: 2039-07-18
Also published as: CN110279855A

Abstract

The invention discloses an immune composition, which comprises: porcine Seneca virus structural proteins VP3 and VP1 proteins, and porcine Seneca virus structural proteins VP2 and/or VP4 proteins. Further, the immune composition can also comprise a structural protein VP0 of the porcine Seneca virus. The immune composition can be used for preparing a novel genetic engineering subunit vaccine of the porcine Seneca virus, the antigenicity, the immunogenicity and the function of the vaccine are similar to those of natural protein, the expression level is higher, the immunogenicity is strong, no pathogenicity is caused to animals, and the vaccine can be prepared by large-scale serum-free suspension culture of a bioreactor, so that the production cost of the vaccine is greatly reduced.

Description

Novel genetic engineering vaccine of porcine Seneca virus, preparation method and application thereof

Technical Field

The invention relates to a genetic engineering vaccine, in particular to a novel genetic engineering vaccine of porcine Seneca virus, a preparation method and application thereof, belonging to the technical field of animal immunity drugs.

Background

Seneca Valley Virus (SVV) disease is an animal infectious disease caused by the A-type Seneca Valley Virus (SVVA) of the picornaviridae family, which primarily infects pigs, which are susceptible to various age stages. SVV infection causes vesicular lesions of the nasal kisses and the coronal belts of the hooves of pigs, and is accompanied with clinical manifestations of lameness, anorexia, lethargy and the like, and the death rate of newborn piglets is remarkably increased. The infection caused by SVV can not be distinguished from clinical symptoms caused by foot-and-mouth disease, swine vesicular disease, vesicular stomatitis and the like, the spreading characteristic of the infection is similar to that of the foot-and-mouth disease virus, and the infection is mixed with the foot-and-mouth disease virus, so that the prevention and control of the foot-and-mouth disease are seriously interfered. Since the disease is a newly discovered infectious disease of animals, no commercial vaccine is available worldwide so far.

Although some researchers have conducted vaccine research on related recombinant Virus Like Particles (VLPs), the proposed schemes are more or less insufficient and difficult to meet the requirements of practical application. For example, some researchers use E.coli to express three proteins, VP1, VP0, and VP3, respectively, and then assemble them in vitro. However, the protein purification in this way is difficult, and the efficiency of protein in vitro assembly is very low. Researchers also use several baculoviruses to respectively express VP1, VP0 and VP3, and then several viruses co-infect Sf9 cells so as to co-express the three proteins, but the mode needs a large virus infection complex number, and the same cell needs to be infected with 2 or more than 2 viruses at the same time, so that the problem of low efficiency exists. In addition, researchers also use insect cells to express proteins P1, P2, P3 or P1 and 3BC, and expect that the structural proteins are subjected to protease digestion into VP1, VP3 and VP0 by expressing the structural proteins and protease, however, the protease expressed in the mode is toxic, the yield of the structural proteins is low, the protease digestion efficiency is low, and the generated cleaved VP1, VP3 and VP0 proteins are few.

Disclosure of Invention

The invention mainly aims to provide a novel genetic engineering vaccine of porcine Seneca virus, a preparation method and application thereof, so as to overcome the defects in the prior art.

In order to achieve the purpose, the technical scheme adopted by the invention comprises the following steps:

embodiments of the present invention provide an immune composition, comprising:

the structural protein VP3 protein of porcine Seneca virus,

structural protein VP1 protein of porcine Seneca virus, and

structural protein VP2 protein and/or VP4 protein of porcine Seneca virus;

the encoding gene of the VP3 protein comprises a nucleic acid molecule with a sequence shown as SEQ ID NO.1 or a nucleic acid molecule which is 95% identical to the nucleotide sequence of SEQ ID NO. 1;

the encoding gene of the VP1 protein comprises a nucleic acid molecule with a sequence shown as SEQ ID NO. 4 or a nucleic acid molecule which is 95% identical to the nucleotide sequence of SEQ ID NO. 4;

the encoding gene of the VP2 protein comprises a nucleic acid molecule with a sequence shown as SEQ ID NO. 3 or a nucleic acid molecule which is 95% identical to the nucleotide sequence of SEQ ID NO. 3;

the coding gene of the VP4 protein comprises a nucleic acid molecule with a sequence shown in SEQ ID NO. 5 or a nucleic acid molecule with a nucleotide sequence which is 95% identical to the nucleotide sequence of SEQ ID NO. 5.

In some embodiments of the invention, the VP3 protein comprises the amino acid sequence of SEQ ID NO:23 or an amino acid sequence that is 95% or more identical to the full-length amino acid sequence of SEQ ID NO: 23.

In some embodiments of the invention, the VP1 protein comprises the amino acid sequence of SEQ ID NO. 18 or an amino acid sequence that is 95% or more identical to the full-length amino acid sequence of SEQ ID NO. 18.

In some embodiments of the invention, the VP2 protein comprises the amino acid sequence of SEQ ID NO. 17 or an amino acid sequence that is 95% or more identical to the full-length amino acid sequence of SEQ ID NO. 17.

In some embodiments of the invention, the VP4 protein comprises the amino acid sequence of SEQ ID NO. 19 or an amino acid sequence that is 95% or more identical to the full-length amino acid sequence of SEQ ID NO. 19.

In some embodiments of the invention, the immune composition further comprises a structural protein VP0 protein of porcine Seneca virus, and the encoding gene of VP0 protein comprises a nucleic acid molecule with the sequence shown in SEQ ID NO. 2 or a nucleic acid molecule with 95% of nucleotide sequence identity to SEQ ID NO. 2.

In some embodiments of the invention, the VP0 protein comprises the amino acid sequence of SEQ ID No. 16 or an amino acid sequence that is 95% or more identical to the full length amino acid sequence of SEQ ID No. 16.

In some embodiments of the invention, the expression cassette of the VP1 protein has a sequence as shown in SEQ ID NO:21 or is 95% identical or more to the nucleotide sequence of SEQ ID NO: 21.

In some embodiments of the invention, the expression cassette of the VP2 protein has a sequence as shown in SEQ ID NO:20 or is 95% identical or more to the nucleotide sequence of SEQ ID NO: 20.

In some embodiments of the invention, the expression cassette of the VP4 protein has a sequence as shown in SEQ ID NO. 22 or is 95% identical or more to the nucleotide sequence of SEQ ID NO. 22.

In some more specific embodiments of the present invention, the immunological composition is a composition comprising the VP3, VP1, VP2 proteins.

In some more specific embodiments of the present invention, the immunological composition is a composition comprising the VP3, VP1, VP4 proteins.

In some more specific embodiments of the present invention, the immunological composition is a composition comprising the VP3, VP1, VP2, VP4 proteins.

In some more specific embodiments of the present invention, the immunological composition is a composition comprising the VP3, VP1, VP2, VP0 proteins.

In some more specific embodiments of the present invention, the immunological composition is a composition comprising the VP3, VP1, VP4, VP0 proteins.

In some more specific embodiments of the present invention, the immune composition is a composition comprising the VP3, VP1, VP2, VP4, and VP0 proteins.

The embodiment of the invention also provides a method for preparing any one of the immune compositions, which comprises the following steps:

s1, cloning the genes of the porcine Seneca virus structural protein to the same shuttle vector to obtain a recombinant shuttle vector;

s2, transforming the recombinant shuttle vector into DH10Bac bacteria containing the baculovirus genome plasmid, and directionally inserting a target gene expression frame in the recombinant shuttle vector into the baculovirus genome plasmid to obtain the recombinant baculovirus genome plasmid containing the target gene expression frame;

s3, transfecting the recombinant baculovirus genome plasmid into an insect cell to obtain a recombinant baculovirus;

s4, inoculating the obtained recombinant baculovirus into insect cells, and producing the recombinant porcine epinakavirus structural protein in a reactor in a large scale;

s5, adding the recombinant porcine Seneca virus structural protein obtained in the step S4 into an adjuvant to obtain the immune composition.

In some embodiments of the present invention, the step S1 includes: cloning the coding gene of the porcine Seneca virus structural protein VP3, the expression frame of the porcine Seneca virus structural protein VP1 and the expression frame of any one or two of the porcine Seneca virus structural proteins VP2 and VP4 to the same shuttle vector to obtain the recombinant shuttle vector.

In some embodiments of the present invention, the step S1 includes: cloning the coding gene of porcine Seneca virus structural protein VP3, the expression frame of porcine Seneca virus structural protein VP1, the expression frame of any one or two of porcine Seneca virus structural protein VP2 and VP4, and the coding gene of porcine Seneca virus structural protein VP0 to the same shuttle vector, and obtaining the recombinant shuttle vector.

In some preferred embodiments of the present invention, the step S1 includes: and cloning the coding genes of the porcine Seneca virus structural proteins VP3 and VP0 and the expression cassettes of the porcine Seneca virus structural proteins VP1, VP2 and VP4 to the same shuttle vector to obtain the recombinant shuttle vector.

In some embodiments of the invention, the shuttle vector includes, but is not limited to, pFastBac 1, pVL1393 or pFastBac Dual, among others, wherein pFastBac Dual may preferably be employed.

In some embodiments of the invention, the insect cells include, but are not limited to, Sf9, High Five, S2, Sf21 cells, and the like, wherein Sf9 may be preferably used.

In the previous embodiments of the invention, one virus is used to co-express optimized VP1 and VP3 proteins and any one, two or three proteins selected from VP2, VP4 and VP0 simultaneously. More preferably, five proteins of VP1, VP3, VP2, VP4 and VP0 are co-expressed at the same time by using one virus. VP1, VP3 and VP0 proteins are capable of auto-assembling into VLPs of SVV. The VP1, VP3, VP2 and VP4 proteins can also be automatically assembled into VLPs, so that a plurality of proteins are co-expressed by using one baculovirus, so that the assembling efficiency of VLPs is greatly improved.

The embodiment of the invention also provides application of the immune composition in producing a reagent for detecting the infection of the animals by the porcine Seneca virus.

The embodiments also provide for the use of the immunological composition for the manufacture of a medicament for inducing an immune response against porcine Seneca virus antigen in a subject animal.

The embodiment of the invention also provides application of the immune composition in producing a medicament for preventing the infection of the animals by the porcine Seneca virus.

In some more specific embodiments of the invention, the use of the immune composition as a novel genetically engineered subunit vaccine of porcine Seneca virus is provided.

Accordingly, the embodiment of the present invention provides a swine seneca virus genetic engineering subunit vaccine, which comprises any one of the immune compositions described above.

The embodiment of the invention also provides a nucleic acid molecule composition, which comprises:

the gene is used for coding the structural protein VP3 protein of the porcine Seneca virus, and comprises a nucleotide sequence shown in SEQ ID NO.1 or a nucleic acid molecule which is 95 percent identical with the nucleotide sequence of SEQ ID NO. 1;

the gene is used for coding the structural protein VP1 protein of the porcine Seneca virus, and comprises the nucleotide sequence shown in SEQ ID NO. 4 or a nucleic acid molecule which is more than 95 percent identical with the nucleotide sequence of SEQ ID NO. 4.

In some embodiments of the invention, the nucleic acid molecule composition further comprises:

the gene is used for encoding the structural protein VP2 protein of the porcine Seneca virus, and comprises a nucleotide sequence shown as SEQ ID NO. 3 or a nucleic acid molecule which is 95 percent identical with the nucleotide sequence of SEQ ID NO. 3.

the gene is used for coding the structural protein VP4 protein of the porcine Seneca virus, and comprises a nucleotide sequence shown as SEQ ID NO. 5 or a nucleic acid molecule which is 95 percent identical with the nucleotide sequence of SEQ ID NO. 5.

the gene is used for coding the structural protein VP0 protein of the porcine Seneca virus, and comprises a nucleotide sequence shown as SEQ ID NO. 2 or a nucleic acid molecule which is 95 percent identical with the nucleotide sequence of the SEQ ID NO. 2.

In some more specific embodiments of the present invention, the expression cassette of the VP1 protein has a sequence shown in SEQ ID NO. 21 or is 95% identical to or more than 95% identical to the nucleotide sequence of SEQ ID NO. 21.

In some more specific embodiments of the present invention, the expression cassette of the VP2 protein has a sequence shown in SEQ ID NO. 20 or is 95% identical to or more than 95% identical to the nucleotide sequence of SEQ ID NO. 20.

In some more specific embodiments of the present invention, the expression cassette of the VP4 protein has a sequence shown in SEQ ID NO. 22 or is 95% identical to or more than 95% identical to the nucleotide sequence of SEQ ID NO. 22.

The embodiment of the invention also provides application of the nucleic acid molecule composition in producing a reagent for detecting the infection of the animals by the porcine Seneca virus.

The embodiments also provide the use of the nucleic acid molecule composition for the manufacture of a medicament for inducing an immune response against porcine Seneca virus antigen in a test animal.

The embodiment of the invention also provides application of the nucleic acid molecule composition in producing a medicament for preventing the infection of the animals by the porcine Seneca virus.

Compared with the prior art, the technical scheme provided by the embodiment of the invention has the following outstanding advantages and effects: three, four or all of five proteins, namely three, four or all of optimized VP1, VP0 and VP3, VP2 and VP4 protein sequences, are simultaneously expressed by using one baculovirus, the expressed proteins can be spontaneously assembled into SVV VLPs, and the VLPs comprise VP0, VP2 and VP4, can be better assembled with VP1 and VP3, have high assembly efficiency, are similar to natural proteins in antigenicity, immunogenicity and functions, have high expression level and strong immunogenicity, are not pathogenic to pigs, can be applied as a novel genetic engineering subunit vaccine of the porcine Seneca virus, can be prepared by using a bioreactor in large-scale serum-free suspension culture, and greatly reduce the production cost of the vaccine.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are required to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 shows a gel electrophoresis result of a PCR product obtained by PCR amplification of the VP3 protein gene, in which a band of about 0.7kbp is observed; wherein 1 is SVV-VP3 gene, 2 is negative control, and M is molecular weight marker;

FIG. 2 shows the results of gel electrophoresis of PCR products obtained after PCR amplification of a plurality of colony samples transformed with the VP3 protein gene, showing that a positive sample was present in the vicinity of a 0.7kbp band. Wherein 1-5 are products obtained after PCR amplification of colony samples transformed by VP3 protein genes, 6 is a non-positive sample, and M is a molecular weight marker;

FIG. 3 shows a gel electrophoresis result of a PCR product obtained by PCR amplification of the VP0 protein gene, in which a band of about 1.1kbp was observed; wherein 1 is SVV-VP0 gene, 2 is negative control, and M is molecular weight marker;

FIG. 4 shows the results of gel electrophoresis of PCR products obtained after PCR amplification of a plurality of colony samples transformed with the VP0 protein gene, showing that a positive sample was present in the vicinity of the 1.1kbp band. Wherein 1-5 are products obtained after PCR amplification of colony samples transformed by VP0 protein genes, 6 is a non-positive sample, and M is a molecular weight marker;

FIG. 5 shows a gel electrophoresis result of a PCR product obtained by PCR amplification of the VP2 protein expression cassette, in which a band of about 1.6kbp was observed; wherein 1 is SVV-VP2 protein expression frame gene, 2 is negative control, and M is molecular weight marker;

FIG. 6 shows the results of gel electrophoresis of PCR products obtained after PCR amplification of a colony sample transformed with a plurality of VP2 protein expression cassettes, showing a positive sample in the vicinity of the 11.6kbp band. 1-5 are products obtained after PCR amplification of colony samples transformed by VP2 protein expression frames, 6 is a non-positive sample, and M is a molecular weight marker;

FIG. 7 shows a gel electrophoresis result of a PCR product obtained by PCR amplification of the VP1 protein expression cassette, in which a band of about 1.5kbp was observed; wherein 1 is SVV-VP1 protein expression frame gene, 2 is negative control, and M is molecular weight marker;

FIG. 8 shows the results of gel electrophoresis of PCR products obtained after PCR amplification of a colony sample transformed with a plurality of VP1 protein expression cassettes, showing a positive sample in the vicinity of the 1.5kbp band. 1-5 are products obtained after PCR amplification of colony samples transformed by VP1 protein expression frames, 6 is a non-positive sample, and M is a molecular weight marker;

FIG. 9 shows a gel electrophoresis result of a PCR product obtained by PCR amplification of the VP4 protein expression cassette, in which a band of approximately 0.9kbp was observed; wherein 1 is SVV-VP4 protein expression frame gene, 2 is negative control, and M is molecular weight marker;

FIG. 10 shows the results of gel electrophoresis of PCR products obtained after PCR amplification of a colony sample transformed with a plurality of VP4 protein expression cassettes, showing a positive sample in the vicinity of a 0.9kbp band. 1-5 are products obtained after PCR amplification of colony samples transformed by VP4 protein expression frames, 6 is a non-positive sample, and M is a molecular weight marker;

FIG. 11 is a diagram of constructed transfer vector Dual-VP3-VP0-VP2-VP1-VP4 containing a target gene;

FIG. 12 shows the SDS-PAGE gel electrophoresis of the cell culture supernatant harvested in example 3, wherein the cell culture of the VP3-VP0-VP2-VP1-VP4 recombinant protein showed the desired bands around the molecular weights of about 37kDa, 35kDa, 31kDa, 26kDa and 9kDa, respectively; wherein 1 is a negative control, 2 is the cell culture harvested in example 3, and M is a molecular weight marker;

FIG. 13 shows the Western Blot detection result of the product after SDS-PAGE in example 4; wherein 1 is a negative control, 2 is a recombinant baculovirus expression sample, and M is a molecular weight marker;

FIG. 14 shows the results of electron microscope observation;

FIG. 15 shows the results after protein purification.

Detailed Description

It is to be understood that the following detailed description is exemplary and is intended to provide further explanation of the invention as claimed. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of exemplary embodiments according to the invention. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, and it should be understood that when the terms "comprises" and/or "comprising" are used in this specification, they specify the presence of stated features, steps, operations, devices, components, and/or combinations thereof, unless the context clearly indicates otherwise.

One aspect of an embodiment of the present invention provides an immunological composition comprising:

the structural protein VP3 protein of porcine Seneca virus, and the coding gene thereof comprises nucleic acid molecules with the sequence shown as SEQ ID NO.1 or nucleic acid molecules with the nucleotide sequence of SEQ ID NO.1 being more than 95 percent identical;

the structural protein VP1 protein of porcine Seneca virus, and the coding gene thereof comprises nucleic acid molecules with the sequence shown as SEQ ID NO. 4 or nucleic acid molecules with the nucleotide sequence of SEQ ID NO. 4 being more than 95 percent identical; and

the structural protein VP2 protein and/or VP4 protein of porcine Seneca virus.

The immune composition can be applied to a porcine Seneca virus genetic engineering subunit vaccine.

Accordingly, another aspect of embodiments of the present invention also relates to a method of inducing an immune response against a porcine Seneca virus antigen, the method comprising administering the porcine Seneca virus genetically engineered subunit vaccine to a subject animal.

Accordingly, another aspect of embodiments of the present invention also relates to a method of protecting a subject animal from infection by porcine seneca virus, the method comprising administering to the subject animal the porcine seneca virus genetically engineered subunit vaccine.

Another aspect of the embodiments of the invention provides a vaccine suitable for inducing an immune response against porcine Seneca virus that can be a plasmid comprising the nucleic acid molecules described above, the nucleic acid molecules can be incorporated into viral particles, the vaccine can further comprise an adjuvant molecule, the adjuvant can be IL-12, IL-15, IL-28, CTACK, TECK, Platelet Derived Growth Factor (PDGF), TNF α, TNF β, GM-CSF, Epidermal Growth Factor (EGF), IL-1, IL-2, IL-4, IL-5, IL-6, IL-10, IL-18, IL-21, IL-31, IL-33, or a combination thereof, and in some embodiments, can be IL-12, IL-RAN15, IL-28, or TES.

The vaccine provided by the embodiment of the invention comprises a protein molecule composition. The present specification provides a protein selected from the group consisting of: a protein comprising SEQ ID NO 16, 17, 18, 19 or 23; a protein that is 95% identical over the entire length of the amino acid sequence of SEQ ID NO 16, 17, 18, 19 or 23; 16, 17, 18, 19 or 23; a protein that is 95% identical to a fragment of SEQ ID NO 16, 17, 18, 19 or 23.

Yet another aspect of embodiments of the present invention provides a protein composition selected from the group consisting of: (a) 16, 17, 18, 19 or 23; (b) a protein that is 95% identical over the entire amino acid sequence length of the full-length sequence as set forth in SEQ ID NO 16, 17, 18, 19 or 23; (c) an immunogenic fragment of SEQ ID NO 16, 17, 18, 19 or 23 comprising 20 or more amino acids of SEQ ID NO 16, 17, 18, 19 or 23; and (d) an immunogenic fragment comprising 20 or more amino acids of a protein that is 95% identical over the entire length of the amino acid sequence of SEQ ID NO 16, 17, 18, 19 or 23. Of course, another aspect of the embodiments of the present invention also provides a protein composition, further comprising one or a combination of protein molecules selected from the group consisting of: (a) 16, 17 or 19; (b) a protein that is 95% identical over the entire amino acid sequence length of the full-length sequence as set forth in SEQ ID NO 16, 17 or 19; (c) an immunogenic fragment of SEQ ID NO 16, 17 or 19 comprising 20 or more amino acids of SEQ ID NO 16, 17 or 19; and (d) an immunogenic fragment comprising 20 or more amino acids of a protein that is 95% identical over the entire length of the amino acid sequence of SEQ ID NO 16, 17 or 19.

Another aspect of the embodiments of the present invention also provides a nucleic acid molecule composition comprising a sequence encoding one or more of the protein molecules described above. In some embodiments, the nucleic acid molecule comprises a sequence selected from the group consisting of seq id no:1, 2, 3, 4 or 5; a nucleic acid sequence that is 95% identical over the entire length of the nucleotide sequence of

SEQ ID NO

1, 2, 3, 4 or 5; 1, 2, 3, 4 or 5; a nucleotide sequence 95% identical to a fragment of

SEQ ID NO

1, 2, 3, 4 or 5. The nucleic acid molecule composition may further comprise one or a combination of nucleic acid molecules selected from the group consisting of: 20, 21 or 22; a nucleic acid sequence that is 95% identical over the entire length of the nucleotide sequence of SEQ ID NO 20, 21 or 22; 20, 21 or 22; a nucleotide sequence that is 95% identical to a fragment of SEQ ID NO 20, 21 or 22.

Yet another aspect of embodiments of the present invention provides a method of inducing an immune response against porcine Seneca virus, the method comprising the steps of: administering to the individual a porcine seneca virus antigen and/or a composition thereof.

Another aspect of embodiments of the invention also provides a method of protecting an individual from infection by porcine seneca virus. The method comprises the following steps: administering to the individual a prophylactically effective amount of a nucleic acid molecule or composition comprising such a nucleic acid sequence; wherein the nucleic acid sequence is expressed in cells of the individual and induces a protective immune response against a protein encoded by the nucleic acid sequence.

Yet another aspect of embodiments of the invention provides a method of inducing an immune response against a porcine seneca virus antigen, the method comprising administering to a subject animal a nucleic acid molecule of the invention.

Yet another aspect of embodiments of the present invention provides a method of protecting a subject animal from infection by porcine seneca virus, the method comprising administering to the subject animal a nucleic acid molecule of the present invention.

Yet another aspect of embodiments of the invention provides a vaccine suitable for use in generating an immune response in a subject against porcine Sendai virus, the vaccine comprising a nucleic acid molecule of the invention and an adjuvant molecule, the adjuvant may be IL-12, IL-15, IL-28, CTACK, TECK, Platelet Derived Growth Factor (PDGF), TNF α, TNF β, GM-CSF, Epidermal Growth Factor (EGF), IL-1, IL-2, IL-4, IL-5, IL-6, IL-10, IL-18, IL-21, IL-31, IL-33, or a combination thereof, and in some embodiments, IL-12, IL-15, IL-28, or TES.

Another aspect of the embodiments of the invention provides a vaccine further comprising one or more nucleic acid molecules as described above and one or more proteins encoded by the nucleic acid molecules.

1. And (4) defining.

The terminology used in the description is for the purpose of describing particular embodiments only and is not intended to be limiting. As used in the specification and in the claims, the singular form of "a", "an", and "the" include plural referents unless the context clearly dictates otherwise.

To the extent that numerical ranges are recited herein, each intervening number is specifically contemplated to be within the same precision. For example, for the range of 6-9, the numbers 7 and 8 are encompassed in addition to 6 and 9, and for the range of 6.0-7.0, the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are expressly encompassed.

An "adjuvant" as used herein means any molecule added to the vaccine described herein to enhance the immunogenicity of the antigen encoded by the encoding nucleic acid sequence described below.

"antibody" as used herein means an antibody of the type IgG, IgM, IgA, IgD or IgE, or a fragment, fragment or derivative thereof, including Fab, F (ab')2, Fd, and single chain antibodies, diabodies, bispecific antibodies, bifunctional antibodies and derivatives thereof. The antibody may be an antibody isolated from a serum sample of an animal, a polyclonal antibody, an affinity purified antibody, or a mixture thereof that exhibits sufficient binding specificity for the desired epitope or a sequence derived therefrom.

"coding sequence" or "coding nucleic acid" as used in the present specification means a nucleic acid (RNA or DNA molecule) comprising a nucleotide sequence encoding a protein. The coding sequence may further include initiation and termination signals operably linked to regulatory elements including a promoter and polyadenylation signals capable of directing expression in the cells of the subject or animal to which the nucleic acid is administered.

"complement" or "complementary" as used herein means that a nucleic acid can refer to Watson-Crick (e.g., A-T/U and C-G) or Hoogsteen base pairing between nucleotides or nucleotide analogs of the nucleic acid molecule.

As used herein, "consensus" or "consensus sequence" means a polypeptide sequence based on analysis of multiple subtypes of a queue of specific porcine seneca virus antigens. Nucleic acid sequences encoding the consensus polypeptide sequence may be prepared. Vaccines comprising proteins comprising consensus sequences and/or nucleic acid molecules encoding these proteins can be used to induce broad immunity against multiple subtypes or serotypes of a particular porcine seneca virus antigen.

"electroporation", "electro-permeabilization" or "electrokinetic enhancement" ("EP") as used interchangeably herein means the use of transmembrane electric field pulses to induce microscopic pathways (pores) in a biological membrane; their presence allows biomolecules such as plasmids, oligonucleotides, siRNA, drugs, ions and water to flow from one side of the cell membrane to the other.

"fragment" with respect to nucleic acid sequences as used herein means a nucleic acid sequence or a portion thereof that encodes a polypeptide that is capable of eliciting an immune response in an animal that is cross-reactive with the full-length wild-type strain porcine seneca virus antigen. The fragment may be a DNA fragment selected from at least one of various nucleotide sequences encoding protein fragments described below.

By "fragment" or "immunogenic fragment" with respect to a polypeptide sequence is meant a polypeptide capable of eliciting an immune response in an animal that is cross-reactive with the full-length wild-type strain porcine epinakavirus antigen. A fragment of a protein may comprise at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of the protein. In some embodiments, a fragment of a protein may comprise at least 20 amino acids or more, at least 30 amino acids or more, at least 40 amino acids or more, at least 50 amino acids or more, at least 60 amino acids or more, at least 70 amino acids or more, at least 80 amino acids or more, at least 90 amino acids or more, at least 100 amino acids or more, at least 110 amino acids or more, at least 120 amino acids or more of the protein, at least 130 amino acids or more, at least 140 amino acids or more, at least 150 amino acids or more, at least 160 amino acids or more, at least 170 amino acids or more, at least 180 amino acids or more, at least 190 amino acids or more, at least 200 amino acids or more, at least 210 amino acids or more, at least 220 amino acids or more, at least 230 amino acids or more, or at least 240 amino acids or more.

The term "genetic construct" as used in this specification refers to a DNA or RNA molecule comprising a nucleotide sequence encoding a protein. The coding sequence comprises an initiation signal and a termination signal operably linked to regulatory elements including a promoter and polyadenylation signal capable of directing expression in the cells of the individual to whom the nucleic acid molecule is administered. The term "expression form" as used herein refers to a genetic construct containing the necessary regulatory elements operably linked to a coding sequence encoding a protein such that the coding sequence will be expressed when present in the cells of the individual.

The term "homology" as used in the present specification refers to the degree of complementarity. There may be partial homology or complete homology (i.e., identity). Partial complementary sequences that at least partially inhibit hybridization of a fully complementary sequence to a target nucleic acid are referred to using the functional term "substantially homologous". The term "substantially homologous" as used herein when used with respect to a double-stranded nucleic acid sequence, such as a cDNA or genomic clone, means that the probe can hybridize to a strand of the double-stranded nucleic acid sequence under conditions of low stringency. The term "substantially homologous" as used herein with respect to a single-stranded nucleic acid sequence means that the probe can hybridize to a single-stranded nucleic acid template sequence (i.e., is the complement of the single-stranded nucleic acid template sequence) under low stringency conditions.

In the case of two or more nucleic acid or polypeptide sequences, "identical" or "identity" as used herein means that the sequences have a specified percentage of identical residues in a specified region. The percentage may be calculated by: optimally aligning the two sequences, comparing the two sequences over a specified region, determining the number of positions of the identical residue in the two sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions within the specified region, and multiplying the result by 100 to yield the percentage of sequence identity. Where two sequences are of different lengths or the alignment produces one or more staggered ends and the specified regions of comparison include only a single sequence, the residues of the single sequence are included in the denominator of the calculation rather than in the numerator. When comparing DNA and RNA, thymine (T) and uracil (U) can be considered equivalent. Identity can be performed manually or by using a computer sequence algorithm such as BLAST or BLAST 2.0.

As used herein, "immune response" means the activation of the immune system of a host (e.g., the immune system of an animal) in response to the introduction of an antigen, such as a porcine seneca virus consensus antigen. The immune response may be in the form of a cellular response or a humoral response or both.

As used herein, "nucleic acid" or "oligonucleotide" or "polynucleotide" means at least two nucleotides covalently linked together. The description of single strands also defines the sequence of the complementary strand. Thus, nucleic acids also encompass the complementary strand of the single strand described. Many variants of a nucleic acid can be used for the same purpose as a given nucleic acid. Thus, nucleic acids also encompass substantially the same nucleic acids and their complements. Single strands provide probes that can hybridize to a target sequence under stringent hybridization conditions. Thus, nucleic acids also encompass probes that hybridize under stringent hybridization conditions.

The nucleic acid may be single-stranded or double-stranded or may contain portions of both double-stranded or single-stranded sequences. The nucleic acid can be DNA, both genomic and cDNA, RNA, or a hybrid, wherein the nucleic acid can contain a combination of deoxyribonucleotides and ribonucleotides, as well as a combination of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine, and isoguanine. The nucleic acid may be obtained by chemical synthesis methods or by recombinant methods.

The expression of the gene is carried out under the control of a promoter which is spatially linked thereto. Under its control, the promoter may be positioned 5 '(upstream) or 3' (downstream) of the gene. The distance between the promoter and the gene may be about the same as the distance between the promoter and the gene it controls in the gene from which the promoter is derived. As is known in the art, this change in distance can be adjusted without loss of promoter function. By "promoter" is meant a molecule of synthetic or natural origin that is capable of conferring, activating or enhancing expression of a nucleic acid in a cell. The promoter may comprise one or more specific transcriptional regulatory sequences to further enhance expression and/or alter spatial and/or temporal expression thereof. A promoter may also contain distal enhancer or repressor elements, which can be located as much as several thousand pairs of base pairs from the start of transcription. Promoters may be obtained from sources including viruses, bacteria, fungi, plants, insects, and animals. A promoter may regulate expression of a gene component either substantially or differentially with respect to the cell, tissue or organ in which expression occurs or with respect to the developmental stage at which expression occurs or in response to an external stimulus such as a physiological stress, pathogen, metal ion or inducer. Representative examples of promoters include the phage T7 promoter, the phage T3 promoter, the SP6 promoter, the lactose operon-promoter, the tac promoter, the SV40 late promoter, the SV40 early promoter, the RSV-LTR promoter, the CMV IE promoter, the SV40 early promoter or the SV40 late promoter, and the CMVIE promoter.

"Signal peptide" and "leader sequence" refer to amino acid sequences that can be attached to the amino terminus of a porcine Seneca virus protein as described herein. The signal peptide/leader sequence is generally indicative of the location of the protein. The signal peptide/leader sequence used in the present specification preferably promotes secretion of the protein from the cell in which it is produced. The signal peptide/leader sequence is often cleaved from the remainder of the protein, which is often referred to as the mature protein after secretion from the cell. The signal peptide/leader sequence is linked to the N-terminus of the protein.

By "stringent hybridization conditions" is meant conditions under which a first nucleic acid sequence (e.g., a probe) will hybridize to a second nucleic acid sequence (e.g., a target), such as in a complex mixture of nucleic acids. Stringent conditions are sequence dependent and will be different in different circumstances. Stringent conditions may be selected to be about 5-10 ℃ lower than the thermodynamic melting point (Tm) of the particular sequence at a defined ionic strength pH. The Tm can be the temperature (under defined ionic strength, pH, and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (at Tm, 50% of the probes are occupied at equilibrium because the target sequence is present in excess). Stringent conditions may be those in which the salt concentration is less than about 1.0M sodium ion, such as about 0.01-1.0M sodium ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature is at least about 30 ℃ for short probes (e.g., about 10-50 nucleotides) and at least about 60 ℃ for long probes (e.g., greater than about 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. For a selected or specific hybridization, the positive signal can be at least 2 to 10 times the background hybridization. Exemplary stringent hybridization conditions include the following: 50% formamide, 5 XSSC and 1% SDS, incubated at 42 ℃ or 5 XSSC, 1% SDS, incubated at 65 ℃ washed with 0.2 XSSC and 0.1% SDS at 65 ℃.

"substantially complementary" as used herein means that a first sequence is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identical to the complement of a second sequence over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 180, 270, 360, 450, 540 or more nucleotides or amino acids, or that two sequences hybridize under stringent hybridization conditions.

"substantially identical" as used herein means that the first and second sequences are at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 80%, 90%, 95%, 100%, 180%, 270%, 360, 450, 540 or more nucleotides or amino acid regions at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identical, or, in the case of nucleic acids, if the first and second sequences are substantially complementary, so are the first and second sequences, within 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 85, 540 or more nucleotide or amino acid regions.

"subtype" or "serotype": as used interchangeably herein and with respect to porcine seneca virus, means a genetic variant of porcine seneca virus such that one subtype is recognized by the immune system and separated from different subtypes.

"variant" as used herein with respect to a nucleic acid means (i) a portion or fragment of a reference nucleotide sequence; (ii) a complement of a reference nucleotide sequence or a portion thereof; (iii) a nucleic acid that is substantially identical to a reference nucleic acid or a complement thereof; or (iv) a nucleic acid that hybridizes under stringent conditions to a reference nucleic acid, its complement, or a sequence substantially identical thereto.

"variants" in the case of peptides or polypeptides differ in amino acid sequence by insertion, deletion or conservative substitution of amino acids, but retain at least one biological activity. A variant also means a protein having substantially the same amino acid sequence as a reference protein having an amino acid sequence that retains at least one biological activity. Conservative substitutions of amino acids, i.e., the replacement of an amino acid with a different amino acid of similar characteristics (e.g., hydrophilicity, extent and distribution of charged regions) are believed in the art to typically involve minor changes. As understood in the art, these minor changes may be identified in part by considering the hydropathic index of amino acids. Kate (Kyte), et al, J.Mol.biol., 157:105-132 (1982). The hydropathic index of the amino acid is based on considerations of its hydrophobicity and charge. It is known in the art that amino acids of similar hydropathic indices can be substituted and still retain protein function. In one aspect, amino acids with a hydropathic index of ± 2 are substituted. The hydrophilicity of amino acids can also be used to reveal substitutions that will result in proteins that retain biological function. Considering the hydrophilicity of amino acids in the case of peptides allows the calculation of the maximum local average hydrophilicity of the peptide, which is a useful measure that has been reported to correlate well with antigenicity and immunogenicity. As is understood in the art, substitution of amino acids with similar hydrophilicity values can result in peptides that retain biological activity (e.g., immunogenicity). Substitutions may be made with amino acids having hydrophilicity values within ± 2 of each other. Both the hydropathic index and the hydropathic value of an amino acid are affected by the specific side chain of the amino acid. Consistent with the observations, amino acid substitutions that are compatible with biological function are understood to depend on the relative similarity of these amino acids, and in particular the side chains of those amino acids, as revealed by hydrophobicity, hydrophilicity, charge, size, and other properties.

"vector" as used herein means a nucleic acid sequence containing an origin of replication. The vector may be a viral vector, a bacteriophage, a bacterial artificial chromosome, or a yeast artificial chromosome. The vector may be a DNA or RNA vector. The vector may be a self-replicating extrachromosomal vector, and is preferably a DNA vector.

2. Vaccine

The vaccines of the present invention can be designed to control the extent or magnitude of an immune response in a subject animal against one or more porcine seneca virus serotypes. The vaccine may comprise elements or agents that inhibit its integration into the chromosome. The vaccine may be RNA encoding structural proteins of porcine seneca virus. An RNA vaccine can be introduced into the cells. The vaccine of the present invention may comprise porcine seneca virus structural proteins. Porcine Seneca virus structural proteins are targets for immune-mediated viral clearance by inducing 1) a Cytotoxic T Lymphocyte (CTL) response, 2) a T helper cell response, and/or 3) a B cell response, or preferably all of the above-mentioned responses, to achieve cross-presentation.

The antigens may comprise protein epitopes that make them particularly effective as immunogens against which an immune response against porcine Seneca virus can be induced. The porcine seneca virus antigen can include a full-length translation product, a variant thereof, a fragment thereof, or a combination thereof.

Some embodiments relate to nucleic acid molecules encoding immunogenic proteins that are 95% homologous to the nucleic acid coding sequences of the present specification. Some embodiments relate to nucleic acid molecules encoding immunogenic proteins having 96% homology to the nucleic acid coding sequences of the present specification. Some embodiments relate to nucleic acid molecules encoding immunogenic proteins that have 97% homology to the nucleic acid coding sequences of the present specification. Some embodiments relate to nucleic acid molecules encoding immunogenic proteins that have 98% homology to the nucleic acid coding sequences of the present specification. Some embodiments relate to nucleic acid molecules encoding immunogenic proteins having 99% homology to the nucleic acid coding sequences of the present specification. In some embodiments, a nucleic acid molecule having a coding sequence disclosed herein that is homologous to a coding sequence of a protein disclosed herein comprises a sequence encoding an IgE leader sequence linked to the 5' end of the coding sequence encoding the homologous protein sequence disclosed herein.

In some embodiments, the nucleic acid sequence does not contain a coding sequence that encodes a leader sequence. In some embodiments, the nucleic acid sequence does not contain a coding sequence that encodes an IgE leader.

Some embodiments relate to fragments of

SEQ ID NO

1, 2, 3, 4 or 5. A fragment may be at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, or at least 55% at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of SEQ ID No.1, 2, 3, 4, or 5. The fragment may be at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to a fragment of SEQ ID No.1, 2, 3, 4 or 5. Fragments may be at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to fragments of SEQ ID NO.1, 2, 3, 4 or 5. In some embodiments, a fragment comprises a sequence encoding a leader sequence, e.g., an immunoglobulin leader, such as an IgE leader. In some embodiments, a fragment does not contain a coding sequence that encodes a leader sequence. In some embodiments, the fragment does not contain a coding leader sequence, such as, for example, a coding sequence of an IgE leader.

Some embodiments relate to proteins homologous to SEQ ID NO 16, 17, 18, 19 or 23. Some embodiments relate to immunogenic proteins having 95% homology to the protein sequence as set forth in SEQ ID NO 16, 17, 18, 19 or 23. Some embodiments relate to immunogenic proteins having 96% homology to the protein sequence as set forth in SEQ ID NO 16, 17, 18, 19 or 23. Some embodiments relate to immunogenic proteins having 97% homology to the protein sequence as set forth in SEQ ID NO 16, 17, 18, 19 or 23. Some embodiments relate to immunogenic proteins having 98% homology to the protein sequence as set forth in SEQ ID NO 16, 17, 18, 19 or 23. Some embodiments relate to immunogenic proteins having 99% homology to the protein sequence as set forth in SEQ ID NO 16, 17, 18, 19 or 23.

Some embodiments relate to the same protein as SEQ ID NO 16, 17, 18, 19 or 23. Some embodiments relate to immunogenic proteins having an amino acid sequence that is 80% identical over the entire amino acid sequence length of the full length consensus amino acid sequence as set forth in SEQ ID NOs 16, 17, 18, 19, or 23. Some embodiments relate to immunogenic proteins having an amino acid sequence that is 85% identical over the entire amino acid sequence length of the full length consensus amino acid sequence as set forth in SEQ ID NOs 16, 17, 18, 19, or 23. Some embodiments relate to immunogenic proteins having an amino acid sequence that is 90% identical over the entire amino acid sequence length of the full length consensus amino acid sequence as set forth in SEQ ID NOs 16, 17, 18, 19, or 23. Some embodiments relate to immunogenic proteins having an amino acid sequence that is 91% identical over the entire amino acid sequence length of the full length consensus amino acid sequence as set forth in SEQ ID NOs 16, 17, 18, 19, or 23. Some embodiments relate to immunogenic proteins having an amino acid sequence that is 92% identical over the entire amino acid sequence length of the full length consensus amino acid sequence as set forth in SEQ ID NOs 16, 17, 18, 19, or 23. Some embodiments relate to immunogenic proteins having an amino acid sequence that is 93% identical over the entire amino acid sequence length of the full length consensus amino acid sequence as set forth in SEQ ID NOs 16, 17, 18, 19, or 23. Some embodiments relate to immunogenic proteins having an amino acid sequence that is 94% identical over the entire amino acid sequence length of the full length consensus amino acid sequence as set forth in SEQ ID NOs 16, 17, 18, 19, or 23. Some embodiments relate to immunogenic proteins having an amino acid sequence that is 95% identical over the entire amino acid sequence length of the full length consensus amino acid sequence as set forth in SEQ ID NOs 16, 17, 18, 19, or 23. Some embodiments relate to immunogenic proteins having an amino acid sequence that is 96% identical over the entire amino acid sequence length of the full-length consensus amino acid sequence as set forth in SEQ ID NO 16, 17, 18, 19, or 23. Some embodiments relate to immunogenic proteins having an amino acid sequence that is 97% identical over the entire amino acid sequence length of the full length consensus amino acid sequence as set forth in SEQ ID NOs 16, 17, 18, 19, or 23. Some embodiments relate to immunogenic proteins having an amino acid sequence that is 98% identical over the entire amino acid sequence length of the full length consensus amino acid sequence as set forth in SEQ ID NO 16, 17, 18, 19, or 23. Some embodiments relate to immunogenic proteins having an amino acid sequence that is 99% identical over the entire amino acid sequence length of the full length consensus amino acid sequence as set forth in SEQ ID NOs 16, 17, 18, 19, or 23.

In some embodiments, the protein does not contain a leader sequence. In some embodiments, the protein does not contain an IgE leader. A fragment of a protein may comprise at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, or at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the protein. Immunogenic fragments of SEQ ID NO 16, 17, 18, 19 or 23 may be provided. An immunogenic fragment can comprise at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, or at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of SEQ ID No. 16, 17, 18, 19, or 23. In some embodiments, the fragment comprises a leader sequence, such as, for example, an immunoglobulin leader, such as an IgE leader. In some embodiments, the fragment does not contain a leader sequence. In some embodiments, the fragment does not contain a leader sequence, such as, for example, an IgE leader.

Immunogenic fragments of proteins having amino acid sequences homologous to the immunogenic fragments of SEQ ID NO 16, 17, 18, 19 or 23 can be provided. The immunogenic fragment can comprise at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, or at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the protein that is 16, 17, 18, 19, or 2395% homologous to SEQ ID NO. Some embodiments relate to immunogenic fragments having 96% homology to the immunogenic fragments of the protein sequences of the present specification. Some embodiments relate to immunogenic fragments that are 97% homologous to immunogenic fragments of the protein sequences of the present specification. Some embodiments relate to immunogenic fragments that are 98% homologous to immunogenic fragments of the present specification protein sequences. Some embodiments relate to immunogenic fragments that are 99% homologous to immunogenic fragments of the present specification protein sequences. In some embodiments, the fragment comprises a leader sequence, such as, for example, an immunoglobulin leader sequence, such as an IgE leader. In some embodiments, the fragment does not contain a leader sequence. In some embodiments, the fragment does not contain a leader sequence, such as, for example, an IgE leader.

Immunogenic fragments of proteins having the same amino acid sequence as the immunogenic fragments of SEQ ID NO 16, 17, 18, 19 or 23 can be provided. The immunogenic fragment may comprise a protein that is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50% or at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical over the entire length of the amino acid sequence set forth in SEQ ID No. 16, 17, 18, 19 or 23, at least 80%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%. In some embodiments, the fragment comprises a leader sequence, such as, for example, an immunoglobulin leader, such as an IgE leader. In some embodiments, the fragment does not contain a leader sequence. In some embodiments, the fragment does not contain a leader sequence, such as, for example, an IgE leader.

3. Vaccine constructs and plasmids

The vaccine may comprise a nucleic acid construct or plasmid encoding a porcine seneca virus structural protein, a porcine seneca virus antigen, and a combination of porcine seneca virus structural proteins/antigens. The present disclosure provides genetic constructs that may comprise nucleic acid sequences encoding porcine seneca virus antigens disclosed herein, including protein sequences, sequences homologous to protein sequences, fragments of protein sequences, and sequences homologous to fragments of protein sequences. In addition, the present specification provides genetic constructs that can comprise a nucleic acid sequence encoding a porcine seneca virus surface antigen disclosed herein (including protein sequences, sequences homologous to protein sequences, fragments of protein sequences, and sequences homologous to fragments of protein sequences). The genetic construct may be present as a functional extrachromosomal molecule. The genetic construct may be a linear minichromosome comprising a centromere, telomere or plasmid or cosmid.

The genetic construct may also be part of the genome of a recombinant viral vector, including recombinant adenovirus, recombinant adeno-associated virus, and recombinant vaccinia. The genetic construct may be part of the genetic material in a recombinant microbial vector in a live attenuated microorganism or in a cell.

The genetic construct may comprise regulatory elements for gene expression of the coding sequence of the nucleic acid. The regulatory element may be a promoter, enhancer, start codon, stop codon or polyadenylation signal.

The nucleic acid sequence may constitute a genetic construct which may be a vector. The vector is capable of expressing an antigen in cells of an animal in an amount effective to elicit an immune response in the animal. The vector may be recombinant. The vector may comprise a heterologous nucleic acid encoding an antigen. The vector may be a plasmid. The vector may be suitable for transfecting cells with nucleic acid encoding an antigen, the transformed host cells being cultured and maintained under conditions in which expression of the antigen occurs.

The coding sequence can be optimized for stability and high levels of expression. In some cases, the codons are selected to reduce the formation of RNA secondary structures, such as those due to intramolecular bonds.

The vector may comprise a heterologous nucleic acid encoding an antigen, and may further comprise a start codon that may be upstream of the antigen encoding sequence and a stop codon that may be downstream of the antigen encoding sequence. The initiation codon and the stop codon can be in frame with the antigen coding sequence. The vector further comprises a promoter operably linked to the antigen coding sequence. The promoter operably linked to the antigen-encoding sequence may be a promoter from simian virus 40(SV40), mouse mammary virus (MMTV) promoter, Human Immunodeficiency Virus (HIV) promoter such as the Bovine Immunodeficiency Virus (BIV) Long Terminal Repeat (LTR) promoter, Moloney (Moloney) virus promoter, Avian Leukemia Virus (ALV) promoter, Cytomegalovirus (CMV) promoter such as the CMV immediate early promoter, Epstein Barr Virus (EBV) promoter, or Rous Sarcoma Virus (RSV) promoter. The promoter may also be a promoter from a human gene such as human actin, human myosin, human heme, human muscle creatine or human metallothionein. The promoter may also be a tissue-specific promoter, such as a natural or synthetic muscle or skin-specific promoter.

The vector may further comprise a polyadenylation signal, which may be downstream of the porcine Seneca virus core protein coding sequence, which polyadenylation signal may be the SV40 polyadenylation signal, the LTR polyadenylation signal, the bovine growth hormone (bGH) polyadenylation signal, the human growth hormone (hGH) polyadenylation signal, or the human β -globin polyadenylation signal the SV40 polyadenylation signal may be the polyadenylation signal from the pCEP4 vector (Invitrogen, San Diego, CA).

The vector may also comprise an enhancer upstream of the consensus porcine seneca virus core protein coding sequence or the consensus porcine seneca virus surface antigen protein coding sequence. The enhancer is necessary for DNA expression. The enhancer may be human actin, human myosin, human hemoglobin, human muscle creatine or a viral enhancer such as one from CMV, HA, RSV or EBV.

The vector may also comprise an animal origin of replication, in order to maintain the vector extrachromosomally and produce multiple copies of the vector in the cell. The vector may be pVAX1, pCEP4 or pREP4 from Invitrogen (San Diego, CA), which may contain the replication origin of epstein-barr virus and the nuclear antigen EBNA-1 coding region, which may produce high copy episomal replication without integration. The vector may be a pVAX1 or a pVAX1 variant, such as a variant plasmid as described in the present specification, with a variation. The variant pVax1 plasmid is a 2998 base pair variant of the backbone vector plasmid pVax1(Invitrogen, CarlsbadCA). The CMV promoter is located at base 137-724. The T7 promoter/initiation site was located at base 664-683. The multiple cloning site is located at bases 696-811. The bovine GH polyadenylation signal is at base 829-1053. The Kanamycin (Kanamycin) resistance gene is at base 1226-containing 2020. The pUC origin is at base 2320-2993.

The vector may be pSE420(Invitrogen, San Diego, Calif), which can be used to produce proteins in e. The vector may be pYES2(Invitrogen, San Diego, Calif.) which can be used to produce proteins in a Saccharomyces cerevisiae strain of yeast (Saccharomyces cerevisiae strain). The vector may also have a MAXBACTM complete baculovirus expression system (Invitrogen, San Diego, Calif.), which can be used to produce proteins in insect cells. The vector may also be pcDNAI or pcDNA3(Invitrogen, san Diego, Calif.), which may be used to produce proteins in animal cells such as the Sf9 cell line. The vector may be an expression vector or system for producing a protein by conventional techniques and readily available starting materials, including Sambrook et al, Molecular Cloning and Laboratory Manual, 2 nd edition, Cold spring Harbor (1989).

The protein sequences of the porcine Seneca virus structural proteins VP1, VP3, VP0, VP2, VP4 in the present invention can be the original, added and truncated sequences, the viral expression vector expresses any three, four or Five of these Five proteins simultaneously, of which VP1 and VP3 are the structural proteins that must be expressed.

The principle of the present invention lies in that a recombinant Baculovirus shuttle plasmid is constructed, which comprises expression genes for expressing any three or four or five of the five proteins VP, VP and VP, wherein VP and VP proteins are essential, genes encoding VP and VP structural proteins VP, and VP of porcine epinasc virus, wherein expression cassettes for VP and VP can be obtained by using any one of the P promoter, PH promoter, prawn-actin gene promoter, opee promoter (without being limited to using these four promoters, and possibly other promoters), the genes encoding VP and VP structural proteins and VP of porcine epinasc virus, and the transcription termination signals of the expression cassettes for VP, VP and VP can be HSV 40 a transfection termination signal, tk polyA transfection termination signal, opee a termination signal (without being limited to using these three transcription termination signals, and possibly other transcription termination signals), and thus, the expression of these proteins simultaneously or three of VP, vadvid, VP and VP are capable of being obtained by constructing a recombinant Baculovirus shuttle plasmid, which can be assembled into a Baculovirus shuttle plasmid, which can be automatically assembled, wherein the expression of VP and VP viral vector can be obtained by using three or three VP and VP proteins.

Specifically, optimized and synthesized VP and VP protein encoding genes of SVV are firstly cloned below a PH promoter and a P promoter of a pFastBacDual vector respectively to construct a Dual-VP-VP vector, and then a VP protein expression cassette is inserted at a SnaB I cleavage site of the Dual-VP vector, wherein the expression cassette comprises a prawn-actin gene promoter, an optimized VP gene and an SV polyA transcription termination signal, so as to construct a Dual-VP-VP-VP vector, and a VP protein expression cassette is inserted at an Avr II cleavage site of the Dual-VP-VP-VP vector, wherein the expression cassette comprises an OpIE promoter, which is a second early regulator promoter in Orgypsis multicapsis nuclear virus (OpenMNPV), and the optimized VP gene and the OpIE polyA transcription termination signal, so as to construct a Dual-VP-VP-VP vector, and the optimized VP protein expression cassette are inserted at the VP protein expression cassette, and the recombinant VP-VP-VP-VP-VP protein expression cassette is constructed after transfection, wherein the expression cassette is expressed by the strain promoter, the strain is expressed after the porcine adenovirus vector is expressed after the optimized and the recombinant baculovirus vector is transfected.

Thus, five proteins are simultaneously expressed by using one baculovirus and Sf9 cell, namely optimized protein sequences of the porcine Seneca virus VP1, VP0, VP3, VP2 and VP4, the five expressed proteins can be spontaneously assembled into VLPs, and the VLPs can be better assembled with VP1 and VP3 due to the inclusion of VP0, VP2 and VP4, so that the assembly efficiency is high. The invention simultaneously expresses five proteins of VP1, VP3, VP2, VP4 and VP0, VP1, VP3 and VP0 can be assembled into VLP, VP1, VP3, VP2 and VP4 can also be assembled into VLP, and the five proteins are co-expressed, so that the assembly efficiency of VLP is greatly improved. The antigenicity, immunogenicity and function of the formed SVV VLP are similar to those of natural protein, the expression level is higher, the immunogenicity is strong, and the SVV VLP has no pathogenicity to pigs.

The technical solution of the present invention is explained in detail below with reference to several more specific embodiments.

Example 1 construction and characterization of the transfer vector Dual-VP3-VP0-VP2-VP1-VP4

1. Construction and identification of transfer vector Dual-VP3

1.1 VP3 Gene amplification and purification A codon-optimized SVV VP3 gene (SEQ ID NO:1) was synthesized by Nanjing Kinshire and cloned into a pUC17 vector to obtain a pUC-VP3 plasmid vector. PCR amplification was carried out using pUC-VP3 plasmid as template and VP3-F, VP3-R as upstream and downstream primers (gene sequences of VP3-F, VP3-R are shown in SEQ ID NO.6 and 7), and the amplification system is shown in Table 1.

TABLE 1VP 3 Gene amplification System

The reaction conditions are as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 45 seconds, annealing at 54 ℃ for 45 seconds, extension at 72 ℃ for 1 minute, 35 cycles; extension at 72 ℃ for 10 min.

The size of the target gene was verified by subjecting the PCR product to gel electrophoresis, and as shown in FIG. 1, a band of interest appeared at a position of about 0.7kbp, and the target gene was successfully amplified, and then recovered and purified using a gel recovery and purification kit.

1.2 digestion and purification the PCR amplification product of pFastBac Dual plasmid and VP3 gene was digested simultaneously with BamHI and Hind III at 37 ℃ for 3 hours, and the specific digestion reaction systems are shown in tables 2 and 3.

And (3) performing gel electrophoresis on the enzyme digestion product, and purifying the enzyme digestion pFastBacDual plasmid and the VP3 gene fragment by using a gel recovery and purification kit respectively.

TABLE 2 enzyme digestion reaction system of VP3 gene

TABLE 3 pFastbac Dual plasmid digestion reaction System

1.3 ligation the double-digested pFastBac Dual plasmid and the product of the VP3 gene digestion were ligated overnight using T4DNA ligase in a water bath at 16 ℃. The specific ligation reaction system is shown in Table 4.

TABLE 4 VP3 Gene and pFastBac Dual plasmid ligation System

1.4 transformation 10. mu.l of the ligation product was added to 100. mu.l of DH5 α competent cells and mixed well, ice-cooled for 30 minutes, heat shocked in a water bath at 42 ℃ for 90 seconds, ice-cooled for 2 minutes again, 900. mu.l of LB liquid medium without Amp was added, and cultured at 37 ℃ for 1 hour, 1.0ml of the bacterial solution was concentrated to 100. mu.l and spread on LB solid medium with Amp, and cultured at 37 ℃ for 16 hours.

1.5 colony PCR and sequencing identification Single colonies on the picked plates were inoculated respectively to LB liquid medium, cultured at 37 ℃ for 2 hours, colony PCR identification was performed with the bacterial solution as template and VP3-F and VP3-R as primers, the PCR product was subjected to gel electrophoresis to verify the size of the target gene, as shown in FIG. 2, the sample with 0.7kbp band appeared was a positive sample. And (4) sending the bacteria liquid with positive identification to a sequencing company for sequencing, and selecting the bacteria liquid with correct sequencing for storage.

2. Construction and identification of transfer vector Dual-VP3-VP0

2.1 amplification and purification of VP0 Gene codon-optimized SVV VP0 gene (SEQ ID NO:2) was synthesized by Nanjing Kinshire and cloned into pUC17 vector to obtain pUC-VP0 plasmid vector. PCR amplification was carried out using pUC-VP0 plasmid as template and VP0-F, VP0-R as upstream and downstream primers (gene sequences of VP0-F, VP0-R are shown in SEQ ID NO.8 and 9), and the amplification system is shown in Table 5.

TABLE 5 VP0 Gene amplification System

The size of the target gene was verified by subjecting the PCR product to gel electrophoresis, and as shown in FIG. 3, a band of interest appeared at a position of about 1.1kbp, and the target gene was successfully amplified, and then recovered and purified using a gel recovery and purification kit.

2.2 digestion and purification the PCR amplification product of Dual-VP3 plasmid and VP0 gene was digested simultaneously with Xho I and Kpn I at 37 ℃ for 3 hours, and the specific digestion reaction systems are shown in tables 6 and 7.

And (3) performing gel electrophoresis on the enzyme digestion product, and purifying the enzyme digestion pFastBacDual plasmid and the VP0 gene fragment by using a gel recovery and purification kit respectively.

TABLE 6 enzyme digestion reaction system of VP0 gene

TABLE 7 Dual-VP3 plasmid digestion reaction System

2.3 ligation the double digested Dual-VP3 plasmid and the VP0 gene digest were ligated using T4DNA ligase in a water bath at 16 ℃ overnight. The specific ligation reaction system is shown in Table 8.

TABLE 8 connection System of VP0 Gene and Dual-VP3 plasmid

2.4 transformation 10. mu.l of the ligation product was added to 100. mu.l of DH5 α competent cells and mixed well, ice-cooled for 30 minutes, heat shocked in a water bath at 42 ℃ for 90 seconds, ice-cooled for 2 minutes again, 900. mu.l of LB liquid medium without Amp was added, and cultured at 37 ℃ for 1 hour, 1.0ml of the bacterial solution was concentrated to 100. mu.l and spread on LB solid medium with Amp, and cultured at 37 ℃ for 16 hours.

2.5 colony PCR and sequencing identification Single colonies on the picked plates were inoculated into LB liquid medium, cultured at 37 ℃ for 2 hours, colony PCR identification was performed using the bacterial solution as template, VP0-F and VP0-R as primers, the PCR product was subjected to gel electrophoresis to verify the size of the target gene, as shown in FIG. 4, and the sample with a 1.1kbp band was found to be a positive sample. And (4) sending the bacteria liquid with positive identification to a sequencing company for sequencing, and selecting the bacteria liquid with correct sequencing for storage.

3. Construction and identification of transfer vector Dual-VP3-VP0-VP2

3.1 amplification and purification of VP2 Gene expression cassette the SVV VP2 gene expression cassette (SEQ ID NO:20) was synthesized by Nanjing Kinshire and cloned into pUC17 vector to obtain pUC-VP2 plasmid vector, which included the promoter of prawn β -actin gene, codon optimized SVV VP2 gene and SV40poly A stop signal sequence, PCR amplification was performed using pUC-VP2 plasmid as template and VP2-F, VP2-R as upstream and downstream primers (the gene sequences of VP2-F, VP2-R are shown in SEQ ID NO.10 and 11), and the amplification system is shown in Table 9.

TABLE 9 VP2 Gene amplification System

The size of the target gene was verified by subjecting the PCR product to gel electrophoresis, and as shown in FIG. 5, a band of interest appeared at a position of about 1.6kbp, and the target gene was successfully amplified, and then recovered and purified using a gel recovery and purification kit.

3.2 digestion and purification the PCR amplification products of the Dual-VP3-VP0 plasmid and the VP2 gene expression cassette were digested with SnaBI at 37 ℃ for 3 hours, and the specific digestion reaction systems are shown in tables 10 and 11.

And (3) performing gel electrophoresis on the enzyme digestion product, and purifying the PCR amplification product of the enzyme digestion Dual-VP3-VP0 plasmid and VP2 gene expression cassette by using a gel recovery purification kit respectively.

TABLE 10 enzyme digestion reaction system of VP2 gene

TABLE 11 Dual-VP3-VP0 plasmid digestion reaction System

3.3 ligation the double digested Dual-VP3-VP0 plasmid and the VP2 gene expression cassette cleavage product were ligated using T4DNA ligase in a water bath at 16 ℃ overnight. The specific ligation reaction system is shown in Table 12.

TABLE 12 PCR product of gene expression cassette for VP2 and Dual-VP3-VP0 plasmid ligation System

3.4 transformation 10. mu.l of the ligation product was added to 100. mu.l of DH5 α competent cells and mixed well, ice-cooled for 30 minutes, heat shocked in a water bath at 42 ℃ for 90 seconds, ice-cooled for 2 minutes again, 900. mu.l of LB liquid medium without Amp was added, and cultured at 37 ℃ for 1 hour, 1.0ml of the bacterial solution was concentrated to 100. mu.l and spread on LB solid medium with Amp, and cultured at 37 ℃ for 16 hours.

3.5 colony PCR and sequencing identification Single colonies on the picked plates were inoculated respectively to LB liquid medium, cultured at 37 ℃ for 2 hours, colony PCR identification was performed using the bacterial solution as template, VP2-F and VP2-R as primers, the PCR product was subjected to gel electrophoresis to verify the size of the target gene, as shown in FIG. 6, the sample with a 1.6kbp band was found to be a positive sample. And (4) sending the bacteria liquid with positive identification to a sequencing company for sequencing, and selecting the bacteria liquid with correct sequencing for storage.

4. Construction and identification of transfer vector Dual-VP3-VP0-VP2-VP1

4.1 amplification and purification of VP1 Gene expression cassette an SVV VP1 gene expression cassette (SEQ ID NO:21) was synthesized by Nanjing Kingsler and cloned into a pUC17 vector to obtain a pUC-VP1 plasmid vector, the VP1 gene expression cassette comprising an OpIE promoter, a codon optimized SVV VP1 gene and an OpIE poly A transcription termination signal sequence. PCR amplification was carried out using pUC-VP1 plasmid as template and VP1-F, VP1-R as upstream and downstream primers (gene sequences of VP1-F, VP1-R are shown in SEQ ID NO.12 and 13), and the amplification system is shown in Table 13.

TABLE 13 VP1 Gene expression cassette amplification System

The size of the target gene was verified by subjecting the PCR product to gel electrophoresis, and as shown in FIG. 7, a band of interest appeared at a position of about 1.5kbp, and the target gene was successfully amplified, and then recovered and purified using a gel recovery and purification kit.

4.2 digestion and purification the PCR amplification products of the Dual-VP3-VP0-VP2 plasmid and the VP1 gene expression cassette were digested simultaneously for 3 hours at 37 ℃ with AvrII endonuclease, and the specific digestion reaction systems are shown in tables 14 and 15.

And (3) performing gel electrophoresis on the enzyme digestion product, and purifying the enzyme digestion Dual-VP3-VP0-VP2 plasmid and VP1 gene expression cassette PCR amplification product by using a gel recovery purification kit respectively.

TABLE 14 enzyme digestion reaction system for PCR product of gene expression cassette VP1

TABLE 15 Dual-VP3-VP0-VP2 plasmid digestion reaction System

4.3 ligation the double digested Dual-VP3-VP0-VP2 plasmid and the VP1 gene expression cassette digest were ligated using T4DNA ligase in a water bath at 16 ℃ overnight. The specific ligation reaction system is shown in Table 16.

TABLE 16 VP1 Gene expression cassette and Dual-VP3-VP0-VP2 plasmid ligation System

4.4 transformation 10. mu.l of the ligation product was added to 100. mu.l of DH5 α competent cells and mixed well, ice-cooled for 30 minutes, heat shocked in a water bath at 42 ℃ for 90 seconds, ice-cooled for 2 minutes again, 900. mu.l of LB liquid medium without Amp was added, and cultured at 37 ℃ for 1 hour, 1.0ml of the bacterial solution was concentrated to 100. mu.l and spread on LB solid medium with Amp, and cultured at 37 ℃ for 16 hours.

4.5 colony PCR and sequencing identification Single colonies on the picked plates were inoculated into LB liquid medium, cultured at 37 ℃ for 2 hours, colony PCR identification was performed using the bacterial solution as template, VP1-F and VP1-R as primers, the PCR product was subjected to gel electrophoresis to verify the size of the target gene, as shown in FIG. 8, and the sample with a 1.5kbp band was found to be a positive sample. And (4) sending the bacteria liquid with positive identification to a sequencing company for sequencing, and selecting the bacteria liquid with correct sequencing for storage.

Construction of Dual-VP3-VP0-VP2-VP1-VP4 vector

5.1 amplification and purification of VP4 Gene expression cassette SVV VP4 gene expression cassette (SEQ ID NO:22) was synthesized by Nanjing Kinshire and cloned into pUC17 vector to obtain pUC-VP4 plasmid vector, where the VP4 gene expression cassette includes prawn β -actin, codon-optimized SVV VP4 gene and SV40poly A transcription termination signal sequence, PCR amplification was performed using pUC-VP4 plasmid as template and VP4-F, VP4-R as upstream and downstream primers (the gene sequences of VP4-F, VP4-R are shown in SEQ ID NO.14 and 15), and the amplification system is shown in Table 17.

TABLE 17 VP4 Gene expression cassette amplification System

The size of the target gene was verified by subjecting the PCR product to gel electrophoresis, and as shown in FIG. 9, a band of interest appeared at a position of approximately 0.9kbp, and the target gene was successfully amplified, and then recovered and purified using a gel recovery and purification kit.

5.2 digestion and purification the Dual-VP3-VP0-VP2-VP1 plasmid and the VP4 gene expression cassette PCR amplification product were digested simultaneously with BsrGI endonuclease at 37 ℃ for 3 hours, and the specific digestion reaction systems are shown in tables 18 and 19.

And (3) performing gel electrophoresis on the enzyme digestion product, and purifying the enzyme digestion product of the Dual-VP3-VP0-VP2-VP1 plasmid and the VP4 gene expression frame PCR amplification product by using a gel recovery and purification kit respectively.

TABLE 18 enzyme digestion reaction system for PCR product of gene expression cassette of VP4

TABLE 19 Dual-VP3-VP0-VP2-VP1 plasmid digestion reaction System

5.3 ligation double digested Dual-VP3-VP0-VP2-VP1 plasmid and VP4 gene expression cassette cleavage products were ligated using T4DNA ligase in 16 ℃ water bath overnight. The specific ligation reaction system is shown in Table 20.

TABLE 20 plasmid ligation System of the expression cassette of the VP4 Gene with Dual-VP3-VP0-VP2-VP1

5.4 transformation 10. mu.l of the ligation product was added to 100. mu.l of DH5 α competent cells and mixed well, ice-cooled for 30 minutes, heat shocked in a water bath at 42 ℃ for 90 seconds, ice-cooled for 2 minutes again, 900. mu.l of LB liquid medium without Amp was added, and cultured at 37 ℃ for 1 hour, 1.0ml of the bacterial solution was concentrated to 100. mu.l and spread on LB solid medium with Amp, and cultured at 37 ℃ for 16 hours.

5.5 colony PCR and sequencing identification Single colonies on the picked plates were inoculated respectively to LB liquid medium, cultured at 37 ℃ for 2 hours, colony PCR identification was performed using the bacterial solution as template, VP4-F and VP4-R as primers, the PCR product was subjected to gel electrophoresis to verify the size of the target gene, as shown in FIG. 10, the sample with 0.9kbp band appeared was a positive sample. And (4) sending the bacteria liquid with positive identification to a sequencing company for sequencing, and selecting the bacteria liquid with correct sequencing for storage. The constructed transfer vector containing the target gene is Dual-VP3-VP0-VP2-VP1-VP4, and a schematic diagram thereof is shown in FIG. 11.

Example 2 construction of recombinant baculovirus genome Bac-VP3-VP0-VP2-VP1-VP4

Mu.l of Dual-VP3-VP0-VP2-VP1-VP4 plasmid in example 1 was added to 100. mu.l of DH10Bac competent cells and mixed well, ice-cooled for 30 minutes, heat-shocked in 42 ℃ water bath for 90 seconds, ice-cooled for 2 minutes, 900. mu.l each of LB liquid medium without Amp was added, and cultured at 37 ℃ for 5 hours. After 100. mu.l of the diluted bacterial solution was diluted 81 times, 100. mu.l of the diluted bacterial solution was applied to LB solid medium containing gentamicin, kanamycin, tetracycline, X-gal and IPTG, and cultured at 37 ℃ for 48 hours.

2. Selecting single colony, streaking on LB solid culture medium containing gentamicin, kanamycin, tetracycline, X-gal and IPTG, culturing at 37 deg.c for 48 hr, selecting single colony, inoculating LB liquid culture medium containing gentamicin, kanamycin and tetracycline, culturing, preserving strain and extracting plasmid. Obtaining the recombinant plasmid Bacmid-VP3-VP0-VP2-VP1-VP 4.

Example 3 recombinant baculovirus transfection

Six well plates were seeded 0.8X 10 per well⁶The confluency of Sf9 cells is 50-70%. The following complexes were prepared for each well: diluting 4. mu.l of Cellffectin transfection reagent with 100. mu.l of transfection medium T1, and shaking briefly with vortex; mu.g of the recombinant Bacmid-VP3-VP0-VP2-VP1-VP4 plasmid from example 2 was diluted with 100. mu.l of transfection culture T1 medium, and the diluted transfection reagent and plasmid were mixed and gently blown down to prepare a transfection mixture. And adding the transfection compound after the cells adhere to the wall, incubating for 5 hours at 27 ℃, removing the supernatant, adding 2ml of SF-SFM fresh culture medium, and culturing for 4-5 days at 27 ℃ to obtain the supernatant. Obtaining recombinant baculovirus rBac-VP3-VP0-VP2-VP1-VP4, detecting virus titer of the harvested P1 generation recombinant baculovirus by using an MTT relative efficacy method, wherein the titer of the rBac-VP3-VP0-VP2-VP1-VP4P1 virus is 5.4 multiplied by 10⁷pfu/mL. The amplified recombinant baculovirus rBac-VP3-VP0-VP2-VP1-VP4 is used as seed virus for standby.

Example 4 SDS-PAGE detection

The cell cultures harvested in example 3 were subjected to SDS-PAGE detection while using Sf9 cells infected with empty baculovirus as negative controls, respectively. The specific operation is as follows: mu.l of the harvested cell culture was taken, 10. mu.l of 5 × loading buffer was added, the mixture was centrifuged in a boiling water bath for 5 minutes at 12000r/min for 1 minute, the supernatant was subjected to SDS-PAGE gel (12% strength gel) electrophoresis, and the gel was stained and decolored after electrophoresis to observe the band. As shown in FIG. 12, bands appeared around molecular weights of about 37kDa, 35kDa, 31kDa, 26kDa and 9kDa, and the negative control had no band at the corresponding positions.

Example 5 Western Blot identification

The product after SDS-PAGE electrophoresis in example 4 was transferred to an NC (nitrocellulose) membrane, blocked with 5% skim milk for 2 hours, incubated with swine anti-porcine epinakavirus positive serum for 2 hours, rinsed, incubated with secondary goat anti-porcine polyclonal antibody labeled with HRP for 2 hours, rinsed, and then added dropwise with an enhanced chemiluminescent fluorogenic substrate and photographed using a chemiluminescent imager. As shown in FIG. 13, the recombinant baculovirus expression sample had a band of interest, and the negative control had no band of interest, indicating that the antigen protein of interest was correctly expressed in Sf9 cells.

Example 6 Indirect immunofluorescence assay

Sf9 cell suspension transfected by rBac-VP3-VP0-VP2-VP1-VP4 is added into a 96-well cell culture plate respectively, and 100 mu l/well (cell concentration is 2.5 multiplied by 10)⁵～4.0×10⁵One/ml), 4 wells were inoculated, left at 27 ℃ for 15 minutes, Sf9 cells were attached to the bottom wall of the plate, and 10. mu.l of a 10-fold diluted seed was added to each well. Meanwhile, a blank cell control is set. After inoculation, the cells are placed in a constant temperature incubator at 27 ℃ for culture for 72-96 hours, the culture solution is discarded, and cold methanol/acetone (1:1) is used for fixation. Firstly reacting with porcine-derived anti-SVV polyclonal antiserum, then reacting with FITC-labeled goat anti-porcine IgG, and observing the result by an inverted fluorescence microscope. The results show that the cells inoculated with the empty baculovirus Sf9 can not observe fluorescence, while the cells inoculated with the recombinant baculovirus Sf9 can observe fluorescence, which indicates that the target antigen protein is correctly expressed in Sf9 cells and the recombinant baculovirus is correctly constructed.

Example 7 Electron microscopy

Carrying out ultrasonic disruption on the recombinant baculovirus cell culture, centrifuging for 30 minutes at 12000r/min, taking the supernatant, filtering by using a 0.22-micron filter membrane, removing impurities, and concentrating by 10 times by using an ultrafiltration tube with the molecular weight cutoff of 3 kDa. 10ml of a 40% sucrose solution was added to each centrifuge tube, then 2.0ml of the ultrafiltration concentrated sample was added, ultracentrifugation was performed at 29000r/min for 2 hours, the supernatant was discarded, and the pellet was resuspended in 2.0ml PBS. Then the suspension is centrifuged by sucrose with gradient concentration of 50 percent, 60 percent, 70 percent and 80 percent respectively, ultracentrifuged at 29000r/min for 2 hours, and then strips positioned at the junction of 60 percent to 70 percent concentration are collected. The collected product is observed by using phosphotungstic acid negative staining, virus-like particles with the same size and the similar morphology with porcine epinakal virus particles are observed under an electron microscope, and the result of the electron microscope is shown in figure 14.

EXAMPLE 8 bioreactor serum-free suspension culture of insect cells and quantification of VP3-VP0-VP2-VP1-VP4 expression

In 1000ml shake flaskCulturing Sf9 insect cells for 3-4 days until the concentration reaches 3-5 × 10⁶cell/mL, when the activity is more than 95%, inoculating the cells into a 5L bioreactor, wherein the inoculation concentration is 3-8 × 10⁵cell/mL. When the cell concentration reaches 3-55X 10⁶At cell/mL, cells were seeded into a 50L bioreactor until the cells grew to a concentration of 3-55X 10⁶cell/mL, inoculating into 500L bioreactor until cell concentration reaches 2-85 × 10⁶When the cell is in the volume of one mL, the recombinant baculovirus rBac-VP3-VP0-VP2-VP1-VP4 is inoculated, and the culture conditions of the reactor are that the pH value is 6.0-6.5, the temperature is 25-27 ℃, the dissolved oxygen is 30-80%, and the stirring speed is 100-. In view of the optimum conditions for cell culture, it is preferable to set pH6.2, the temperature at the stage of cell culture at 27 ℃, the dissolved oxygen at 50%, and the stirring speed at 100-180 rpm. Culturing for 5-9 days after infection, adding one-thousandth final concentration BEI, acting at 37 deg.C for 48 hr, adding two-thousandth final concentration Na₂S₂O₃The inactivation is terminated. Cell culture supernatant is obtained by centrifugation or hollow fiber filtration, and the vaccine stock solution is stored at 2-8 ℃.

Example 9 protein purification

Purifying the harvested stock solution by cation exchange chromatography

The strong cation particle chromatography packing POROS 50HS is used for carrying out particle exchange chromatography, and the packing is disinfected by 0.5M NaOH before use. The vaccine stock was then equilibrated with microfiltration buffer at room temperature, and then loaded onto the column at a rate of 125mL/min, followed by 8 column volumes of elution with rinse buffer a (0.05M MOPS (sodium salt), pH 7.0, 0.5M NaCl). Elution was then performed with a linear gradient from 0% buffer a to 100% buffer B (0.05M MOPS (sodium salt), pH 7.0, 1.5M nacl), where a total of 10 column volumes eluted with linear elution, and then the 10 column volumes of eluate were harvested on average. After linear elution was complete, 2 column volumes were eluted with buffer B and collected separately. The collected sample was placed in a 2L sterile plastic bottle at 4 ℃. The fractions collected under the last elution peak (A280) were then stored sterile filtered at 4 ℃.

Using a pre-packed hydroxyapatite Column (CHT)^TMCeramic Hydroxyautomatic Type II Media) first using 50mM MOPS (sodium)Salt), pH 7.0, 1.25M NaCl, then the sample initially purified above was loaded at 90cm/hour and eluted with 8 volumes of equilibration solution until the UV value was zero. Then a gradient elution was performed using an eluent (0.2M phosphate, pH 7.0, 1.25M NaCl) at a concentration from 0% to 100% and at a rate still of 90cm/h and an elution volume of 4 column volumes. Purifying to obtain the target protein.

The purified target protein was quantified using BCA total protein and then the purity of the target protein was determined by combining gray-scale scanning, and the purified protein was shown in FIG. 15 at a target protein concentration of 342ug/mL and a purity of 94%.

EXAMPLE 10 preparation of vaccine

Adding appropriate amount of purified porcine Seneca virus VP3-VP0-VP2-VP1-VP4 protein into MONTANIDE ISA206VG adjuvant (volume ratio is 1:1) to make protein final concentration 100ug/mL, emulsifying, and storing at 4 deg.C after quality inspection is qualified.

Example 11 immunization experiment

14 newborn piglets of 7 days old are taken and randomly divided into two groups, wherein each group comprises 7 piglets, namely an experimental group and a control group, the experimental group is injected with 3ml of the vaccine in the embodiment 10 through pig muscle, and the control group is injected with adjuvant with the same volume through pig muscle. After 28 days, each group of piglets is subjected to intramuscular injection challenge by using SVV/GZ/003 strain which is virulent to porcine Seneca virus, and are separately fed. The observation was continued for 15 days, and the condition of each group of animals was observed.

Test results show that the immunized piglets do not show any symptoms of the Seneca virus, and the immune protection rate is 100 percent; the control group showed significant blister lesions of nasoscles and coronal zones of hoofs. Experimental results show that the inactivated vaccine prepared by the invention is qualified in immune efficacy.

It is to be understood that the above-described embodiments are part of the present invention, and not all embodiments. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention as claimed, but is merely representative of selected embodiments of the invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Sequence listing

<110> Suzhou Shino Biotechnology Ltd

<120> novel genetic engineering vaccine of porcine Seneca virus, preparation method and application thereof

<160>23

<170>SIPOSequenceListing 1.0

<210>1

<211>723

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>1

atgggtccta tccctacagc tcctcgcgag aactccctga tgttcctgtc caccatcccc 60

gacgacaccg tgcctgctta cggaaacgtg cgcacccctc cagtgaacta cctgccagga 120

gagatcaccg acctgctgca actggctcgc atccctaccc tgatggcttt cggtcgcgtg 180

tcagagccag aaccagcttc cgacgcttac gtgccttacg tggcagtgcc agctcagttc 240

gacgacaagc ccctgatctc cttccccatc accctgtccg acccagtgta ccagaacacc 300

ctcgtgggag ccatctcctc caacttcgcc aactaccgcg gttgcatcca gatcaccctg 360

accttctgcg gtcccatgat ggctcgcgga aagttcctgc tgtcctactc cccccctaac 420

ggagctcagc ctcaaaccct gtccgaggct atgcagtgca cctactccat ttgggacatc 480

ggcctgaact cctcttggac cttcgtgatc ccctacatct ccccctccga ctacagggag 540

accagggcta tcaccaactc cgtgtactcc gccgacggct ggttctctct gcacaagctg 600

accaagatca ccctgccccc agattgccct cagtcccctt gcatcctgtt cttcgcttcc 660

gccggagagg actacaccct gagactgcca gtggactgca acccttccta cgtgttccac 720

taa 723

<210>2

<211>1071

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>2

atgggcaacg tgcagaccac ctccaagaac gacttcgact cccgcggcaa caacggcaac 60

atgaccttca actactacgc caacacctac cagaactccg tggacttctc cacctcctcc 120

tccgcttccg gagcaggtcc aggaaactct aggggaggac tggccggtct gctgactaac 180

ttctccggta tcctgaaccc tctgggctac ctgaaggacc acaacaccga ggagatggag 240

aactccgctg acagggtcat cacccaaacc gctggcaaca ccgccatcaa cacccagtct 300

tccctgggag tcctctgcgc ttacgtggaa gaccctacca agtccgaccc tccttcttcc 360

tccaccgacc aacctaccac caccttcacc gctatcgacc gttggtacac cggtcgtctg 420

aactcctgga ccaaggccgt gaagaccttc tccttccaag ctgtgcctct gccaggagct 480

ttcctgtctc gtcaaggagg actgaacggc ggtgctttca cagctaccct gcaccgccac 540

ttcctgatga agtgcggttg gcaggtgcag gtccagtgca acctgaccca gttccaccag 600

ggagctttgc tggtcgctat ggtgccagag accactctgg acgtgaagcc agacggcaag 660

gctaagtccc tgcaggagct gaacgaggag cagtgggtgg agatgtccga cgactaccgt 720

accggcaaga acatgccctt ccaatccctg ggaacctact accgcccccc caattggact 780

tggggcccca acttcatcaa cccctaccag gtcaccgtgt tccctcacca gatcctgaac 840

gcccgtacct ctacctccgt ggacatctcc gtgccttaca tcggcgagac tcctacccag 900

tccagcgaga cccagaactc ttggaccctg ctggtgatgg tcctggtgcc cctggactac 960

aaggagggag ctaccaccga cccagagatc actttctccg tgcgccctac ctccccttac 1020

ttcaacggtc tgcgcaaccg cttcaccaca ggcaccgacg aggaacagta a 1071

<210>3

<211>858

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>3

atggaccaca acaccgagga gatggagaac tccgctgaca gggtcatcac ccaaaccgct 60

ggcaacaccg ccatcaacac ccagtcttcc ctgggagtcc tctgcgctta cgtggaagac 120

cctaccaagt ccgaccctcc ttcttcctcc accgaccaac ctaccaccac cttcaccgct 180

atcgaccgtt ggtacaccgg tcgtctgaac tcctggacca aggccgtgaa gaccttctcc 240

ttccaagctg tgcctctgcc aggagctttc ctgtctcgtc aaggaggact gaacggcggt 300

gctttcacag ctaccctgca ccgccacttc ctgatgaagt gcggttggca ggtgcaggtc 360

cagtgcaacc tgacccagtt ccaccaggga gctttgctgg tcgctatggt gccagagacc 420

actctggacg tgaagccaga cggcaaggct aagtccctgc aggagctgaa cgaggagcag 480

tgggtggaga tgtccgacga ctaccgtacc ggcaagaaca tgcccttcca atccctggga 540

acctactacc gcccccccaa ttggacttgg ggccccaact tcatcaaccc ctaccaggtc 600

accgtgttcc ctcaccagat cctgaacgcc cgtacctcta cctccgtgga catctccgtg 660

ccttacatcg gcgagactcc tacccagtcc agcgagaccc agaactcttg gaccctgctg 720

gtgatggtcc tggtgcccct ggactacaag gagggagcta ccaccgaccc agagatcact 780

ttctccgtgc gccctacctc cccttacttc aacggtctgc gcaaccgctt caccacaggc 840

accgacgagg aacagtaa 858

<210>4

<211>798

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>4

atgtccaccg acaacgcaga gaccggagtg atcgaggcag gaaacaccga caccgacttc 60

tccggagaac tggcagctcc aggttccaac cacaccaacg tgaagttcct gttcgaccgt 120

tcccgcctgc tgaacgtgat caaggtgctg gagaaggacg ccgtgttccc tagacctttc 180

cccacagcta caggagctca gcaggacgac ggttacttct gcctgctgac ccctcgtcct 240

accgttgctt cccgtccagc tacccgtttc ggtctctacg tgaacccctc cgacaacgga 300

gtgctggcca acacctccct ggacttcaac ttctactccc tggcttgctt cacctacttc 360

cgctccgacc tggaagtcac cgtggtgtct ctggaaccag acctggagtt cgccgttggt 420

tggttccctt ccggttccga gtaccaggct tcctccttcg tgtacgacca gctgcacgtg 480

ccataccact tcaccggtcg tacccctagg gctttcacct ccaagggagg caaggtgtcc 540

ttcgtgctgc cttggaactc cgtgtcctcc gttctgccag ttcgttgggg aggagcttcc 600

aagctgtcct ccgctactag gggtttgcca gctcacgccg attggggcac catctacgcc 660

ttcatccccc gtcccaacga gaagaagggc accgctgtga agcacgtggc tgtctacgtc 720

cgttacaaga acgcccgcgc ttggtgtcct agcatgctgc ctttccgctc ctacaagcag 780

aagatgctga tgcagtaa 798

<210>5

<211>219

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>5

atgggcaacg tgcagaccac ctccaagaac gacttcgact cccgcggcaa caacggcaac 60

atgaccttca actactacgc caacacctac cagaactccg tggacttctc cacctcctcc 120

tccgcttccg gagcaggtcc aggaaactct aggggaggac tggccggtct gctgactaac 180

ttctccggta tcctgaaccc tctgggctac ctgaagtaa 219

<210>6

<211>35

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>6

ataggatcca tgggtcctat ccctacagct cctcg 35

<210>7

<211>40

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>7

ataaagcttt tagtggaaca cgtaggaagg gttgcagtcc 40

<210>8

<211>39

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>8

atactcgaga tgggcaacgt gcagaccacc tccaagaac 39

<210>9

<211>42

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>9

ataggtacct tactgttcct cgtcggtgcc tgtggtgaag cg 42

<210>10

<211>36

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>10

atatacgtaa aaatgaggcg gcggcaatga tttacg 36

<210>11

<211>32

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>11

atatacgtag atccagacat gataagatac at 32

<210>12

<211>34

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>12

atacctaggt catgatgata aacaatgtat ggtg 34

<210>13

<211>33

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>13

atacctaggc acgcgcttga aaggagtgtg taa 33

<210>14

<211>36

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>14

atatgtacaa aaatgaggcg gcggcaatga tttacg 36

<210>15

<211>39

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>15

atatgtacag atccagacat gataagatac attgatgag 39

<210>16

<211>356

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>16

Met Gly Asn Val Gln Thr Thr Ser Lys Asn Asp Phe Asp Ser Arg Gly

1 5 10 15

Asn Asn Gly Asn Met Thr Phe Asn Tyr Tyr Ala Asn Thr Tyr Gln Asn

20 25 30

Ser Val Asp Phe Ser Thr Ser Ser Ser Ala Ser Gly Ala Gly Pro Gly

35 40 45

Asn Ser Arg Gly Gly Leu Ala Gly Leu Leu Thr Asn Phe Ser Gly Ile

50 55 60

Leu Asn Pro Leu Gly Tyr Leu Lys Asp His Asn Thr Glu Glu Met Glu

65 70 75 80

Asn Ser Ala Asp Arg Val Ile Thr Gln Thr Ala Gly Asn Thr Ala Ile

85 90 95

Asn Thr Gln Ser Ser Leu Gly Val Leu Cys Ala Tyr Val Glu Asp Pro

100 105 110

Thr Lys Ser Asp Pro Pro Ser Ser Ser Thr Asp Gln Pro Thr Thr Thr

115 120 125

Phe Thr Ala Ile Asp Arg Trp Tyr Thr Gly Arg Leu Asn Ser Trp Thr

130 135 140

Lys Ala Val Lys Thr Phe Ser Phe Gln Ala Val Pro Leu Pro Gly Ala

145 150 155 160

Phe LeuSer Arg Gln Gly Gly Leu Asn Gly Gly Ala Phe Thr Ala Thr

165 170 175

Leu His Arg His Phe Leu Met Lys Cys Gly Trp Gln Val Gln Val Gln

180 185 190

Cys Asn Leu Thr Gln Phe His Gln Gly Ala Leu Leu Val Ala Met Val

195 200 205

Pro Glu Thr Thr Leu Asp Val Lys Pro Asp Gly Lys Ala Lys Ser Leu

210 215 220

Gln Glu Leu Asn Glu Glu Gln Trp Val Glu Met Ser Asp Asp Tyr Arg

225 230 235 240

Thr Gly Lys Asn Met Pro Phe Gln Ser Leu Gly Thr Tyr Tyr Arg Pro

245 250 255

Pro Asn Trp Thr Trp Gly Pro Asn Phe Ile Asn Pro Tyr Gln Val Thr

260 265 270

Val Phe Pro His Gln Ile Leu Asn Ala Arg Thr Ser Thr Ser Val Asp

275 280 285

Ile Ser Val Pro Tyr Ile Gly Glu Thr Pro Thr Gln Ser Ser Glu Thr

290 295 300

Gln Asn Ser Trp Thr Leu Leu Val Met Val Leu Val Pro Leu Asp Tyr

305 310 315 320

Lys Glu Gly AlaThr Thr Asp Pro Glu Ile Thr Phe Ser Val Arg Pro

325 330 335

Thr Ser Pro Tyr Phe Asn Gly Leu Arg Asn Arg Phe Thr Thr Gly Thr

340 345 350

Asp Glu Glu Gln

355

<210>17

<211>284

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>17

Asp His Asn Thr Glu Glu Met Glu Asn Ser Ala Asp Arg Val Ile Thr

1 5 10 15

Gln Thr Ala Gly Asn Thr Ala Ile Asn Thr Gln Ser Ser Leu Gly Val

20 25 30

Leu Cys Ala Tyr Val Glu Asp Pro Thr Lys Ser Asp Pro Pro Ser Ser

35 40 45

Ser Thr Asp Gln Pro Thr Thr Thr Phe Thr Ala Ile Asp Arg Trp Tyr

50 55 60

Thr Gly Arg Leu Asn Ser Trp Thr Lys Ala Val Lys Thr Phe Ser Phe

65 70 75 80

Gln Ala Val Pro Leu Pro Gly Ala Phe Leu Ser Arg Gln Gly Gly Leu

85 90 95

Asn Gly Gly Ala Phe Thr Ala Thr Leu His Arg His Phe Leu Met Lys

100 105 110

Cys Gly Trp Gln Val Gln Val Gln Cys Asn Leu Thr Gln Phe His Gln

115 120 125

Gly Ala Leu Leu Val Ala Met Val Pro Glu Thr Thr Leu Asp Val Lys

130 135 140

Pro Asp Gly Lys Ala Lys Ser Leu Gln Glu Leu Asn Glu Glu Gln Trp

145 150 155 160

Val Glu Met Ser Asp Asp Tyr Arg Thr Gly Lys Asn Met Pro Phe Gln

165 170 175

Ser Leu Gly Thr Tyr Tyr Arg Pro Pro Asn Trp Thr Trp Gly Pro Asn

180 185 190

Phe Ile Asn Pro Tyr Gln Val Thr Val Phe Pro His Gln Ile Leu Asn

195 200 205

Ala Arg Thr Ser Thr Ser Val Asp Ile Ser Val Pro Tyr Ile Gly Glu

210 215 220

Thr Pro Thr Gln Ser Ser Glu Thr Gln Asn Ser Trp Thr Leu Leu Val

225 230 235 240

Met Val Leu Val Pro Leu Asp Tyr Lys Glu Gly Ala Thr Thr Asp Pro

245 250 255

Glu Ile Thr Phe Ser Val Arg Pro Thr Ser Pro Tyr Phe Asn Gly Leu

260 265 270

Arg Asn Arg Phe Thr Thr Gly Thr Asp Glu Glu Gln

275 280

<210>18

<211>265

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>18

Met Ser Thr Asp Asn Ala Glu Thr Gly Val Ile Glu Ala Gly Asn Thr

1 5 10 15

Asp Thr Asp Phe Ser Gly Glu Leu Ala Ala Pro Gly Ser Asn His Thr

20 25 30

Asn Val Lys Phe Leu Phe Asp Arg Ser Arg Leu Leu Asn Val Ile Lys

35 40 45

Val Leu Glu Lys Asp Ala Val Phe Pro Arg Pro Phe Pro Thr Ala Thr

50 55 60

Gly Ala Gln Gln Asp Asp Gly Tyr Phe Cys Leu Leu Thr Pro Arg Pro

65 70 75 80

Thr Val Ala Ser Arg Pro Ala Thr Arg Phe Gly Leu Tyr Val Asn Pro

85 90 95

Ser Asp Asn Gly Val Leu Ala Asn Thr Ser Leu Asp Phe Asn Phe Tyr

100 105 110

Ser Leu Ala Cys Phe Thr Tyr Phe Arg Ser Asp Leu Glu Val Thr Val

115 120 125

Val Ser Leu Glu Pro Asp Leu Glu Phe Ala Val Gly Trp Phe Pro Ser

130 135 140

Gly Ser Glu Tyr Gln Ala Ser Ser Phe Val Tyr Asp Gln Leu His Val

145 150 155 160

Pro Tyr His Phe Thr Gly Arg Thr Pro Arg Ala Phe Thr Ser Lys Gly

165 170 175

Gly Lys Val Ser Phe Val Leu Pro Trp Asn Ser Val Ser Ser Val Leu

180 185 190

Pro Val Arg Trp Gly Gly Ala Ser Lys Leu Ser Ser Ala Thr Arg Gly

195 200 205

Leu Pro Ala His Ala Asp Trp Gly Thr Ile Tyr Ala Phe Ile Pro Arg

210 215 220

Pro Asn Glu Lys Lys Gly Thr Ala Val Lys His Val Ala Val Tyr Val

225 230 235 240

Arg Tyr Lys Asn Ala Arg Ala Trp Cys Pro Ser Met Leu Pro Phe Arg

245 250 255

Ser Tyr Lys Gln Lys Met Leu Met Gln

260 265

<210>19

<211>72

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>19

Met Gly Asn Val Gln Thr Thr Ser Lys Asn Asp Phe Asp Ser Arg Gly

1 5 10 15

Asn Asn Gly Asn Met Thr Phe Asn Tyr Tyr Ala Asn Thr Tyr Gln Asn

20 25 30

Ser Val Asp Phe Ser Thr Ser Ser Ser Ala Ser Gly Ala Gly Pro Gly

35 40 45

Asn Ser Arg Gly Gly Leu Ala Gly Leu Leu Thr Asn Phe Ser Gly Ile

50 55 60

Leu Asn Pro Leu Gly Tyr Leu Lys

65 70

<210>20

<211>1569

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>20

aaaatgaggc ggcggcaatg atttacgggc atatattcgg tcgaggagga cgaaatattc 60

tgaaatggga cgaaagggga tgacgcggcg cggctctcgt cttcccgcct cgcattcaac 120

gctcggctcg accaatcagc ggccgagttt tgcgctatga ccatataagg cgatacgttt 180

gtccgggtgg ggtgggacga gccattgcgg cttatcgcgc gggggagtac cctctcaaaa 240

tgcactatgc actgccgtaa cactctttcg gaaagaatat aatacatcag tagatacctc 300

ttgaaaatta ggatccgatg cataccataa atccccaaat tagagagaat aaaaggggtt 360

aattcgatcg agagtaatga cacttggaac gacctcccct ctggagaaag tcgacgatcc 420

gagaggtgga gtaagcgccc tactcactct ctcatggacc acaacaccga ggagatggag 480

aactccgctg acagggtcat cacccaaacc gctggcaaca ccgccatcaa cacccagtct 540

tccctgggag tcctctgcgc ttacgtggaa gaccctacca agtccgaccc tccttcttcc 600

tccaccgacc aacctaccac caccttcacc gctatcgacc gttggtacac cggtcgtctg 660

aactcctgga ccaaggccgt gaagaccttc tccttccaag ctgtgcctct gccaggagct 720

ttcctgtctc gtcaaggagg actgaacggc ggtgctttca cagctaccct gcaccgccac 780

ttcctgatga agtgcggttg gcaggtgcag gtccagtgca acctgaccca gttccaccag 840

ggagctttgc tggtcgctat ggtgccagag accactctgg acgtgaagcc agacggcaag 900

gctaagtccc tgcaggagct gaacgaggag cagtgggtgg agatgtccga cgactaccgt 960

accggcaaga acatgccctt ccaatccctg ggaacctact accgcccccc caattggact 1020

tggggcccca acttcatcaa cccctaccag gtcaccgtgt tccctcacca gatcctgaac 1080

gcccgtacct ctacctccgt ggacatctcc gtgccttaca tcggcgagac tcctacccag 1140

tccagcgaga cccagaactc ttggaccctg ctggtgatgg tcctggtgcc cctggactac 1200

aaggagggag ctaccaccga cccagagatc actttctccg tgcgccctac ctccccttac 1260

ttcaacggtc tgcgcaaccg cttcaccaca ggcaccgacg aggaacagta agtcgagaag 1320

tactagagga tcataatcag ccataccaca tttgtagagg ttttacttgc tttaaaaaac 1380

ctcccacacc tccccctgaa cctgaaacat aaaatgaatg caattgttgt tgttaacttg 1440

tttattgcag cttataatgg ttacaaataa agcaatagca tcacaaattt cacaaataaa 1500

gcattttttt cactgcattc tagttgtggt ttgtccaaac tcatcaatgt atcttatcat 1560

gtctggatc 1569

<210>21

<211>1477

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>21

tcatgatgat aaacaatgta tggtgctaat gttgcttcaa caacaattct gttgaactgt 60

gttttcatgt ttgccaacaa gcacctttat actcggtggc ctccccacca ccaacttttt 120

tgcactgcaa aaaaacacgc ttttgcacgc gggcccatac atagtacaaa ctctacgttt 180

cgtagactat tttacataaa tagtctacac cgttgtatac gctccaaata cactaccaca 240

cattgaacct ttttgcagtg caaaaaagta cgtgtcggca gtcacgtagg ccggccttat 300

cgggtcgcgt cctgtcacgt acgaatcaca ttatcggacc ggacgagtgt tgtcttatcg 360

tgacaggacg ccagcttcct gtgttgctaa ccgcagccgg acgcaactcc ttatcggaac 420

aggacgcgcc tccatatcag ccgcgcgtta tctcatgcgc gtgaccggac acgaggcgcc 480

cgtcccgctt atcgcgccta taaatacagc ccgcaacgat ctggtaaaca cagttgaaca 540

gcatctgtta tgtccaccga caacgcagag accggagtga tcgaggcagg aaacaccgac 600

accgacttct ccggagaact ggcagctcca ggttccaacc acaccaacgt gaagttcctg 660

ttcgaccgtt cccgcctgct gaacgtgatc aaggtgctgg agaaggacgc cgtgttccct 720

agacctttcc ccacagctac aggagctcag caggacgacg gttacttctg cctgctgacc 780

cctcgtccta ccgttgcttc ccgtccagct acccgtttcg gtctctacgt gaacccctcc 840

gacaacggag tgctggccaa cacctccctg gacttcaact tctactccct ggcttgcttc 900

acctacttcc gctccgacct ggaagtcacc gtggtgtctc tggaaccaga cctggagttc 960

gccgttggtt ggttcccttc cggttccgag taccaggctt cctccttcgt gtacgaccag 1020

ctgcacgtgc cataccactt caccggtcgt acccctaggg ctttcacctc caagggaggc 1080

aaggtgtcct tcgtgctgcc ttggaactcc gtgtcctccg ttctgccagt tcgttgggga 1140

ggagcttcca agctgtcctc cgctactagg ggtttgccag ctcacgccga ttggggcacc 1200

atctacgcct tcatcccccg tcccaacgag aagaagggca ccgctgtgaa gcacgtggct 1260

gtctacgtcc gttacaagaa cgcccgcgct tggtgtccta gcatgctgcc tttccgctcc 1320

tacaagcaga agatgctgat gcagtaaatc ttagtttgta ttgtcatgtt ttaatacaat 1380

atgttatgtt taaatatgtt tttaataaat tttataaaat aatttcaact tttattgtaa 1440

caacattgtc catttacaca ctcctttcaa gcgcgtg 1477

<210>22

<211>930

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>22

aaaatgaggc ggcggcaatg atttacgggc atatattcgg tcgaggagga cgaaatattc 60

tgaaatggga cgaaagggga tgacgcggcg cggctctcgt cttcccgcct cgcattcaac 120

gctcggctcg accaatcagc ggccgagttttgcgctatga ccatataagg cgatacgttt 180

gtccgggtgg ggtgggacga gccattgcgg cttatcgcgc gggggagtac cctctcaaaa 240

tgcactatgc actgccgtaa cactctttcg gaaagaatat aatacatcag tagatacctc 300

ttgaaaatta ggatccgatg cataccataa atccccaaat tagagagaat aaaaggggtt 360

aattcgatcg agagtaatga cacttggaac gacctcccct ctggagaaag tcgacgatcc 420

gagaggtgga gtaagcgccc tactcactct ctcatgggca acgtgcagac cacctccaag 480

aacgacttcg actcccgcgg caacaacggc aacatgacct tcaactacta cgccaacacc 540

taccagaact ccgtggactt ctccacctcc tcctccgctt ccggagcagg tccaggaaac 600

tctaggggag gactggccgg tctgctgact aacttctccg gtatcctgaa ccctctgggc 660

tacctgaagt aagtcgagaa gtactagagg atcataatca gccataccac atttgtagag 720

gttttacttg ctttaaaaaa cctcccacac ctccccctga acctgaaaca taaaatgaat 780

gcaattgttg ttgttaactt gtttattgca gcttataatg gttacaaata aagcaatagc 840

atcacaaatt tcacaaataa agcatttttt tcactgcatt ctagttgtgg tttgtccaaa 900

ctcatcaatg tatcttatca tgtctggatc 930

<210>23

<211>240

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>23

Met Gly Pro Ile Pro Thr Ala Pro Arg Glu Asn Ser Leu Met Phe Leu

1 5 10 15

Ser Thr Ile Pro Asp Asp ThrVal Pro Ala Tyr Gly Asn Val Arg Thr

20 25 30

Pro Pro Val Asn Tyr Leu Pro Gly Glu Ile Thr Asp Leu Leu Gln Leu

35 40 45

Ala Arg Ile Pro Thr Leu Met Ala Phe Gly Arg Val Ser Glu Pro Glu

50 55 60

Pro Ala Ser Asp Ala Tyr Val Pro Tyr Val Ala Val Pro Ala Gln Phe

65 70 75 80

Asp Asp Lys Pro Leu Ile Ser Phe Pro Ile Thr Leu Ser Asp Pro Val

85 90 95

Tyr Gln Asn Thr Leu Val Gly Ala Ile Ser Ser Asn Phe Ala Asn Tyr

100 105 110

Arg Gly Cys Ile Gln Ile Thr Leu Thr Phe Cys Gly Pro Met Met Ala

115 120 125

Arg Gly Lys Phe Leu Leu Ser Tyr Ser Pro Pro Asn Gly Ala Gln Pro

130 135 140

Gln Thr Leu Ser Glu Ala Met Gln Cys Thr Tyr Ser Ile Trp Asp Ile

145 150 155 160

Gly Leu Asn Ser Ser Trp Thr Phe Val Ile Pro Tyr Ile Ser Pro Ser

165 170 175

Asp Tyr Arg Glu Thr Arg Ala Ile Thr AsnSer Val Tyr Ser Ala Asp

180 185 190

Gly Trp Phe Ser Leu His Lys Leu Thr Lys Ile Thr Leu Pro Pro Asp

195 200 205

Cys Pro Gln Ser Pro Cys Ile Leu Phe Phe Ala Ser Ala Gly Glu Asp

210 215 220

Tyr Thr Leu Arg Leu Pro Val Asp Cys Asn Pro Ser Tyr Val Phe His

225 230 235 240

Claims

1. A method of preparing an immunogenic composition, comprising the steps of:

s1, cloning coding genes of porcine Seneca virus structural proteins VP3 and VP0 and expression frames of porcine Seneca virus structural proteins VP1, VP2 and VP4 to the same pFastBac Dual shuttle vector to obtain a recombinant shuttle vector;

s5, adding the recombinant porcine Seneca virus structural protein obtained in the step S4 into an adjuvant to obtain the immune composition;

the encoding gene of the VP3 protein is shown as SEQ ID NO. 1;

the sequence of the expression frame of the VP1 protein is shown as SEQ ID NO. 21, and the coding gene is shown as SEQ ID NO. 4;

the sequence of the expression frame of the VP2 protein is shown as SEQ ID NO. 20, wherein the coding gene is shown as SEQ ID NO. 3;

the sequence of the expression frame of the VP4 protein is shown as SEQ ID NO. 22, wherein the coding gene is shown as SEQ ID NO. 5;

the coding gene of the VP0 protein is shown as SEQ ID NO. 2.

2. The method of claim 1, wherein: the VP3 protein, the VP1 protein, the VP2 protein, the VP4 protein and the VP0 protein are respectively shown as SEQ ID NO. 23, SEQ ID NO. 18, SEQ ID NO. 17, SEQ ID NO. 19 and SEQ ID NO. 16.

3. Use of an immunogenic composition prepared by the method of any one of claims 1-2 in the preparation of a reagent for detecting porcine Seneca virus, in the manufacture of a medicament for inducing an immune response against porcine Seneca virus antigen in a subject animal, or in the manufacture of a medicament for preventing infection of an animal by porcine Seneca virus.

4. Use of the immunogenic composition prepared by the method of any one of claims 1-2 in the preparation of a novel genetically engineered vaccine against porcine Seneca virus.