CN112390861A

CN112390861A - Cell line for expressing porcine Saxifraga vallismortis VP1 protein, construction method and application

Info

Publication number: CN112390861A
Application number: CN202011060872.9A
Authority: CN
Inventors: 董建国; 饶丹; 何书海; 焦凤超; 胡静
Original assignee: Xinyang Agriculture and Forestry University
Current assignee: Xinyang Agriculture and Forestry University
Priority date: 2020-09-30
Filing date: 2020-09-30
Publication date: 2021-02-23

Abstract

The invention discloses a cell line for expressing VP1 protein of porcine Sambucus plus Valley virus, a construction method and application, wherein the cell line contains VP1 gene of porcine Sambucus plus Valley virus and can stably express VP1 protein of porcine Sambucus plus Valley virus, and the component method comprises the steps of designing primers, amplifying VP1 gene, purifying and recovering; constructing pLV/VP1 recombinant plasmid; amplifying S2 to obtain recombinant plasmid; carrying out virus packaging on the recombinant plasmid obtained in the step S3 to obtain a lentivirus containing the recombinant plasmid; transfecting a PK15 cell line with the lentivirus obtained from S4 to obtain a cell line expressing the porcine epididymis valley virus VP1 protein; the cell line can accurately generate a large amount of VP1 protein, is used for preparing the sui intrasai valley virus subunit vaccine, avoids generating a plurality of antibodies induced by irrelevant antigens, has small side reaction and is not easy to cause relevant diseases, and has wide application prospect.

Description

Cell line for expressing porcine Saxifraga vallismortis VP1 protein, construction method and application

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a cell line for expressing porcine Saxifraga virus VP1 protein, a construction method and application.

Background

The porcine inside-stuffing-plus-valley virus (SVV) belongs to a member of Senecavirus virus genus of picornaviridae, and can cause blister and ulceration of wound surface at the rhinoscope and hoof crown of a pig to cause lameness and even death. SVV is a membrane-free single-stranded positive-stranded RNA virus whose genome encodes 5 structural proteins L, VP1, VP2, VP3, and VP4, and 7 non-structural proteins 2A, 2B, 2C, VP1, 3B, 3C, and 3D. L, VP1, VP2, VP3, and VP4 play important roles in SVV structural assembly, and 2A, 2B, 2C, VP1, 3B, 3C, and 3D play important roles in SVV replication and transcription.

The Chinese patent application with the publication number of CN109679927A discloses a preparation method of a porcine Sambucus plus Valley virus inactivated vaccine, which is characterized by comprising the following steps: 1) culturing PK-15 cells by using a cell culture solution, removing the cell culture solution when the PK-15 cells grow into a single layer, replacing the cell culture solution with a DMEM nutrient solution, and culturing for 48-60 h to obtain a culture; the DMEM nutrient solution contains the porcine Sambucus plus Valley virus, and the volume concentration of the porcine Sambucus plus Valley virus is 0.1-0.2%; 2) filtering the culture obtained in the step 1), adjusting the pH value of the obtained filtrate to 7.6-7.8, mixing with diethylene imine, and inactivating the obtained mixture to obtain an inactivated virus solution; the concentration of the diethylene imine in the mixture is 1.5-2.5 mmol/L; 3) the inactivated virus liquid obtained in the step 2) is mixed with an adjuvant and emulsified to obtain the inactivated vaccine of the porcine epinastine valley virus, the inactivated virus obtained by the invention is not VP1 protein, and only can be used for preparing common vaccines, so that a plurality of antibodies induced by irrelevant antigens cannot be generated, the side effects of the vaccines are large, and related diseases are easily caused.

Disclosure of Invention

In view of the above, the present invention aims to provide a cell line expressing VP1 protein of sui sainei valley virus and a construction method thereof, wherein the constructed cell line accurately generates a large amount of VP1 protein, and can be used to manufacture a sui sainei valley virus subunit vaccine, so as to avoid the generation of many antibodies induced by unrelated antigens, and the vaccine has small side reactions, is not easy to cause related diseases, and has a broad application prospect.

In order to achieve the purpose, the invention adopts the following technical scheme:

a cell line expressing the protein of porcine Selaginella Valeriana VP1, which contains the gene of porcine Selaginella Valeriana VP1 and can stably express the protein of porcine Selaginella Valeriana VP 1.

Furthermore, the sequence of the VP1 gene is shown as SEQ ID NO.1, and the amino acid sequence of the VP1 protein is shown as SEQ ID NO. 2.

Further, the method comprises the following steps:

s1, designing a primer, amplifying a VP1 gene, purifying and recovering;

s2, constructing a pLV/VP1 recombinant plasmid;

s3, amplifying the pLV/VP1 recombinant plasmid obtained from S2;

s4, carrying out virus packaging on the pLV/VP1 recombinant plasmid obtained in S3 to obtain a lentivirus containing the pLV/VP1 recombinant plasmid;

s5, transfecting the slow virus obtained from S4 to a PK15 cell line to obtain a cell line expressing the VP1 protein of the porcine Seneca valley virus.

Further, the primers comprise an upstream primer and a downstream primer, wherein the upstream primer is VP1-F (shown in SEQ ID NO. 3), and the downstream primer is VP1-R (shown in SEQ ID NO. 4).

Further, the application of the porcine Sambucus valacicola subunit vaccine is to prepare the porcine Sambucus valacicola subunit vaccine.

Furthermore, the porcine Sambucus plus Valley virus subunit vaccine is prepared by mixing the VP1 protein expressed by the cell line after separation and purification with an adjuvant.

The invention has the beneficial effects that:

1. the lentivirus successfully packaged by the invention can efficiently and rapidly infect PK15 cells and purify the cells on a large scale, has lasting and efficient expression quantity, can generate high-purity VP1 protein, and is convenient for later-stage protein purification.

2. The VP1 protein expressed by the cell line can be mixed with an adjuvant to prepare a subunit vaccine, the vaccine can induce the production of antibodies in pigs, and because the vaccine does not contain nucleic acid in the vaccine, the production of many antibodies induced by irrelevant antigens is avoided, the side effect of the vaccine is small, related diseases are not easy to cause, and the vaccine has a wide application prospect.

Drawings

FIG. 1 is an electrophoresis diagram of the VP1 gene amplification of the present invention;

FIG. 2 is a PCR-verified electrophoresis of the recombinant plasmid pLV/VP 1;

FIG. 3 is an enzyme digestion verification electrophoresis diagram of recombinant plasmid pLV/VP 1;

FIG. 4 is a diagram showing the identification of foreign proteins in a cell line;

FIG. 5 is an identification diagram of VP1 protein.

Detailed Description

The technical solution in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention. It is to be understood that the described embodiments are merely exemplary of the invention, and not restrictive of the full scope of the invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

A cell line expressing VP1 protein of suis intragag, which is characterized in that: the cell line contains the VP1 gene of the sui intraplus valley virus and can stably express the VP1 protein of the sui intraplus valley virus.

The sequence of the VP1 gene is shown in SEQ ID NO. 1; the amino acid sequence of the VP1 protein is shown in SEQ ID NO. 2.

A building block method for expressing porcine Sendai Valley virus VP1 egg white cell line, comprising the following steps:

s1, designing a primer, amplifying a VP1 gene, purifying and recovering;

1) design of primers

The primers comprise an upstream primer and a downstream primer, wherein the upstream primer VP1-F has a sequence as follows:

AAGGAAAAAATGTACAAGGGAGGAGGCGGATCTGGAGGAGGCGG ATCAATGTCCACCGACAACGCCGAGAC, see SEQ ID No. 3; the sequence of a downstream primer VP1-R is as follows: CGCGGATCCGCCTATTGCATCAGCATCTTTT, see SEQ ID No. 4;

2) amplification of the VP1 Gene

The PCR amplification system is as follows: 2X Buffer: 25 mu L of the solution; dNTP: 1 mu L of the solution; an upstream primer: 2 mu L of the solution; a downstream primer: 2 mu L of the solution; high fidelity enzyme: 1 mu L of the solution; 5 mu L of cDNA template; ddH₂O：14μL；

Wherein, the cDNA template is cDNA which is obtained by reverse transcription of nucleic acid extracted from SVV separated from pig feed (morbid pig vesicular fluid), and the specific process is as follows:

a. collecting the diseased pig vesicular fluid, filtering and sterilizing by using a filter membrane, inoculating the cultured 293T cells, and collecting virus fluid after cytopathic effect appears;

b. adding 4 mul of Carrier RNA (1 ug/mul) into 1ml of Buffer VRL to prepare a Buffer VRL/Carrier RNA mixed solution, completely dissolving the precipitate in a water bath at 60 ℃ for 3 minutes before use, transferring 560 mul of Buffer VRL/Carrier RNA into a 1.5ml centrifuge tube, transferring 140 mul of virus solution into a centrifuge tube filled with the Buffer VRL/Carrier RNA, uniformly mixing the virus solution by vortex for 20 seconds, standing the virus solution for 10 minutes at the room temperature of 25 ℃, adding 560 mul of absolute ethyl alcohol into the lysate, and uniformly mixing the virus solution by vortex for 20 seconds;

c. the HiPure RNA Micro Column was placed in a 2ml collection tube, 700. mu.l of the mixed solution was transferred to the Column, centrifuged at 10,000Xg for 60 seconds, the filtrate was decanted, the Column was placed in a collection tube, the remaining mixed supernatant was transferred to the Column, centrifuged at 10,000Xg for 60 seconds, and this step was repeated until all the mixed solution was filtered from the Column; the column was loaded into a fresh collection tube, 600. mu.l Buffer VHB (diluted with ethanol) was added to the column, centrifuged at 10,000Xg for 60 seconds, the filtrate was decanted, the column was reloaded into the collection tube, 600. mu.l Buffer RW2 (diluted with ethanol) was added to the column, centrifuged at 10,000x g for 60 seconds, and the filtrate was decanted; the column was returned to the collection tube, 600. mu.l Buffer RW2 (diluted with ethanol) was added to the column, centrifuged at 10,000Xg for 60 seconds, the filtrate was decanted, the column was returned to the collection tube, centrifuged at 13,000Xg for 3 minutes empty column, the column was spun off, transferred to a new 1.5ml centrifuge tube, 30. mu.l RNase Free Water was added to the center of the membrane of the column, allowed to stand at room temperature for 2 minutes, centrifuged at 13,000x g for 1 minute, the column was discarded, and the viral RNA was stored at-80 ℃.

The reverse transcription system is as follows: 5X Buffer: 4 mu L of the solution; dNTP: 1 mu L of the solution; oligo (dT): 1 mu L of the solution; MLV (MLV): 1 mu L of the solution; ribonuclear Inhibitor: 1 mu L of the solution; 5 mu L of RNA template; ddH 2O: 7 mu L of the solution; the reaction steps are as follows: 60min at 42 ℃.

And (3) adding the PCR amplification system into a PCR instrument, firstly performing pre-denaturation at 94 ℃ for 10min, performing denaturation at 94 ℃ for 30s, performing annealing at 56 ℃ for 30s, performing extension at 72 ℃ for 1min, circulating for 35 times in total, and finally performing extension at 72 ℃ for 10min to complete the amplification of the VP1 gene.

3) Purification and recovery of the VP1 Gene

A: agar gels were prepared, the composition of which is shown in table 1, wherein the agarose gel concentration was 1%:

TABLE 1 agar gel formulation

Reaction system	Volume of
		Agarose (agarose)	0.3g
Nucleic acid dyes	3μL
		TAE	30mL

B: running gel the PCR amplified product obtained in step 2) is run on the agar gel prepared in step a, and the running gel electrophoresis picture is shown in figure 1;

c: the purification and recovery of target gene includes the following steps:

placing agarose gel subjected to PCR amplification under an ultraviolet lamp, cutting a target fragment, placing the cut target fragment in a centrifugal tube of 1.5ml, and weighing;

b, adding BufferB2 according to the weight and the concentration of the gel block and the proportion of adding 300-600 mu L of BufferB2 to 100mg of agarose;

placing the centrifuge tube in a water bath at 50 ℃ for 5-10min, and mixing the mixture at intervals until the gel blocks are completely dissolved;

d, transferring all the dissolved solution into an adsorption column, centrifuging at 8000Xg for 30s, pouring out the liquid in the collecting pipe, and putting the adsorption column into the same collecting pipe;

e, adding 300 mu L of BufferB2 into the adsorption column, centrifuging for 30s at 8000Xg, pouring out liquid in the collecting pipe, and placing the adsorption column into the same collecting pipe;

f, adding 500 mu L of Wash Solution into the adsorption column, centrifuging for 30s at 9000Xg, pouring out liquid in the collecting pipe, and putting the adsorption column into the same collecting pipe;

g, repeating the step f once;

h, putting the empty adsorption column and the collection pipe into a centrifuge, and centrifuging for 1min at 9000 Xg;

i, adding 15-40 mu L of Elution Buffer in the center of the adsorption membrane, standing at room temperature for 1-2min, centrifuging at 9000Xg for 1min to obtain DNA solution, and completing the purification and recovery of genes, wherein the ratio of A260/A280 of the DNA solution is more than 1.80, the nucleic acid concentration is 80.6 mu g/ml, and the DNA solution is stored at-20 ℃.

S2, constructing a pLV/VP1 recombinant plasmid:

a. the VP1 gene and pLV plasmid are cut by double enzyme and purified and recovered respectively

Carrying out double digestion on the VP1 gene and pLV plasmid (Harbin veterinary research institute) in the step S1 by using Nhel and BamHI respectively, wherein the digestion systems of the VP1 gene and the pLV plasmid are shown in Table 2, each system is subjected to water bath at 37 ℃ for 15min, then respectively recovering the VP1 gene and the pLV plasmid after double digestion, and the recovery and purification steps are the same as the step 3) in the step S1, so as to obtain a VP1 gene and a pLV plasmid;

TABLE 2 restriction system of VP1 Gene and pLV plasmid

	pLV	VP1
				10X	5μL	10μL
BamHI	5μL	3.36μL
			Nhel	5μL	5μL
DNA	25μL	50μL
			ddH₂O	10μL	33.28μL

The concentrations of the obtained VP1 gene and pLV plasmid are shown in Table 3 below;

TABLE 3 concentrations of VP1 Gene and pLV plasmid

	Concentration of	A260/A280
			pLV	15.9μg/μL	2.10
VP1 gene	47.8μg/μL	1.92

b. Connecting VP1 gene with pLV plasmid

A connection system: 10 × Buffer: 2 mu L of the solution; T4-DNA-Ligase: 1 mu L of the solution; 3A gene: 1.05 μ L; pLV: 3.14 μ L; ddH 2O: 12.81 μ L;

the reaction conditions are as follows: connecting for 6h at 16 ℃ by using a PCR instrument to obtain a connecting solution containing pLV/VP1 recombinant plasmid;

s3, amplifying the pLV/VP1 recombinant plasmid obtained from S2.

a transformation of competent cells

Melting DH5 alpha competent cells 100 μ L on ice for 5min, adding the ligation solution obtained in step S2 into the competent cells, standing on ice for 30min, wherein the cells cannot be shaken, then thermally shocking at 42 ℃ for 45S, then standing on ice for 1min, then adding 900 μ L LB liquid culture medium without ampicillin, shaking table culturing at 37 ℃ for 1h, finally centrifuging at 2500Xg for 3min, discarding the supernatant, resuspending the cells with 300 μ L LPBS, plating, and warming in an incubator overnight;

d. selecting bacteria: picking a white single colony by using an inoculating loop under a super clean bench, inoculating the white single colony into an LB culture solution containing ampicillin resistance, and carrying out shaking culture on a shaker at 37 ℃ for 12 hours;

e. extracting the recombinant plasmid pLV/VP1, comprising the following steps:

(1) dividing the bacterial liquid subjected to shaking culture for 12 hours by using a shaking table in the step of selecting bacteria in the step S3d into five 1.5mLEP tubes, centrifuging for 2min at 8000Xg, collecting bacteria, and discarding the culture medium;

(2) 250 μ LBuffer P1 was added to each EP tube and the pellet was suspended in its entirety;

(3) adding 250 μ L Buffer P2, immediately and gently inverting the centrifuge tube for 5-10 times, mixing, and standing at room temperature for 2-4 min;

(4) adding 350 mu LBufferP3, immediately and gently reversing the centrifuge tube for 5-10 times and uniformly mixing;

(5) centrifuging at 12000Xg for 5-10min, transferring the supernatant into an adsorption tube, centrifuging at 8000Xg for 30s, and pouring off the liquid in the collection tube;

(6) adding 500 mu LBuffer DW1, centrifuging at 9000Xg for 30 seconds, and pouring out the liquid in the collecting pipe;

(7) adding 500 mu of LWash Solution, centrifuging at 9000Xg for 30 seconds, and pouring out liquid in the collecting pipe;

(8) repeating the step (7) once;

(9) centrifuging the empty adsorption column at 9000Xg for 1 min;

(10) putting the adsorption column into a clean 1.5ml centrifuge tube, adding 50 μ L of ElutionBuffer in the center of the adsorption membrane, standing at room temperature for 1min, centrifuging for 1min, and storing the solution in the tube, wherein the solution contains pLV/VP1 recombinant plasmid;

f. identification of pLV/VP1 recombinant plasmid

(1) PCR validation

Taking the solution partially containing the pLV/VP1 recombinant plasmid obtained in the step S3e to perform PCR amplification, wherein the amplification system is as follows: 2X: 25 mu L of the solution; dNTP: 1 mu L of the solution; an upstream primer: 2 mu L of the solution; a downstream primer: 2 mu L of the solution; high fidelity enzyme: 1 mu L of the solution; recombinant plasmid solution: 1 mu L of the solution; ddH 2O: 18 mu L of the solution;

after amplification, agarose gel electrophoresis was performed, and the electrophoresis pattern is shown in FIG. 2, and it is understood from FIG. 2 that VP1 gene was correctly ligated to pLV plasmid.

(2) Enzyme digestion verification

And (3) carrying out enzyme digestion verification on the solution containing the pLV/VP1 recombinant plasmid extracted in the step S3e, wherein an enzyme digestion system is shown in Table 4:

TABLE 4 pLV/VP1 recombinant plasmid digestion System

	Total volume 10. mu.L
		10*Buffer	1μL
BsrGI	0.5μL
		BamHI	0.5μL
pLV/3A	7μL
		ddH₂O	1μL

Water bath at 37 deg.C for 15min, and performing agarose gel electrophoresis, with the result shown in FIG. 3;

as can be seen from FIG. 3, the VP1 gene was correctly ligated to the pLV plasmid.

S4, carrying out virus packaging on the pLV/VP1 recombinant plasmid obtained from S3e to obtain lentivirus containing the pLV/VP1 recombinant plasmid, and the steps are as follows:

a. culturing AD293 cells

(1) Preparing 50ml of DMEM culture solution containing 10% calf serum, and preparing water at 38 ℃;

(2) the frozen AD293 cell line was quickly thawed by quickly placing it in water at 38 ℃ with forceps.

(3) The frozen tube was placed in a centrifuge tube and centrifuged at 800rpm for 5min, taking care to balance the centrifugation.

(4) After the centrifugation is finished, removing the supernatant, sucking 1ml of 10% culture solution into a centrifuge tube, gently blowing, uniformly mixing, and transferring into a new cell bottle; then, 1ml of 10% culture medium was added to the vial, and the remaining cells were transferred to the same cell flask, followed by addition of 4ml of 10% culture medium. Culturing at 37 deg.C in 5% CO2 incubator for 24h, observing, indicating recovery success if cells adhere to the wall, changing liquid once, observing cell growth condition under microscope every day, and subculturing once every 2 days;

b, packaging the lentivirus to obtain the lentivirus containing the pLV/VP1 recombinant plasmid, comprising the following steps:

(1) spreading the AD293 cells cultured in step S4a on a culture dish, culturing with 10% DMEM culture solution until the cells grow to 80%, replacing the growth culture solution with 5% FBS, and culturing at 37 deg.C with CO₂Continuously culturing for 30min in the incubator;

(2) liposome-mediated transfection:

according to the weight ratio of plasmid pLV/3A: 1.77 ug; pmd2. g: 3.525 ug: psPAX 2: 0.705ug of three plasmids were mixed, then the DNA system was added to the transfection reagent system, inverted and mixed, left to stand at room temperature for 30min, added to the 293T cells cultured in step s4.b. (1), the cell dish was gently shaken to mix the transfection reagent and the culture medium, and two virus collections were required: collecting cell culture supernatant into a sterile centrifuge tube 24h after transfection, adding 10% DMEM culture solution, continuing to culture for 24h, collecting supernatant for the second time, combining the two supernatants, and performing ultracentrifugation and concentration on the collected supernatant to obtain the required lentivirus containing pLV/VP1 recombinant plasmid;

s5, transfecting the slow virus obtained from S4 to a PK15 cell line to obtain a cell line expressing the VP1 protein of the porcine Seneca valley virus, and the steps are as follows:

and (3) inoculating well-grown PK15 cells to a 24-well plate, transducing the lentivirus concentrated in the step S4 when the cells grow to 75%, changing the lentivirus into 10% DMEM culture solution after 24h transduction, continuously culturing in an incubator, setting an empty plasmid pLV group without carrying VP1 gene as a control, observing a fluorescence microscope and a western blot to identify the fluorescence intensity and the expression condition of the porcine Samsung virus VP1 in PK15 cells, and referring to a cell line result graph in FIG. 4, which shows that the exogenous protein is normally expressed. The group expressing foreign protein VP1 is shown in the right panel of FIG. 4, and the group transfected with empty plasmid pLV is shown in the left panel of FIG. 4.

Discarding the supernatant of the cultured cells, washing with PBS for 3 times, adding 1ml of lysis solution into the cultured cells to lyse the cells, collecting in an EP tube, centrifuging for 3min at 10000rpm, collecting the supernatant, adding a protein loading buffer solution, boiling in boiling water for 5min, and then performing electrophoresis on the treated solution, wherein the electrophoresis result is shown in FIG. 5, the empty plasmid group pLV (first lane) of the invention has no VP1 protein band, and the expression exogenous protein VP1 group (second lane) has a specific VP1 band, which indicates that the exogenous protein expressed by the cell line is VP1 protein, so that the cell line stably expressing the porcine Sago interior valley virus VP1 protein in large quantity is obtained, and as can be seen in FIG. 5, the exogenous protein is successfully expressed in large quantity.

Step S5 obtains a cell line expressing the VP1 protein of the porcine Seneca Valley virus, the VP1 protein expressed by the cell line can be used for preparing subunit vaccines, and the step of preparing the subunit vaccines is as follows:

1. culturing the PK15 cell line obtained in step S5 to express a large amount of VP1 protein;

2. ultrasonically crushing the PK15 cell line cultured in the step for 8min at 10000rpm/min, centrifuging the cell line for 8min, taking a cracking supernatant, and purifying and recovering the VP1 protein by using an affinity chromatography medium Ni-NTA to obtain purified VP1 protein;

3. preparation of an aqueous phase: uniformly mixing purified VP1 protein and tween-80 in a mass fraction ratio of 25:1 to prepare a water phase;

4. preparing an oil phase: mixing white oil, span-80 and aluminum stearate at a ratio of 47:3:1 to obtain oil phase;

5. emulsification: and (3) putting 4 parts by mass of oil phase into a stirrer, simultaneously dropwise adding 2 parts by mass of water phase, and emulsifying at 1000 revolutions per minute for 10 minutes after the addition is finished to obtain the subunit vaccine.

Testing of subunit vaccines

1. Appearance and dosage form: the prepared vaccine is milky white water-in-oil emulsion. The vaccine prepared in small amounts was added in cold water without diffusion.

2. Stability: 10ml of the prepared vaccine was added to a centrifuge tube and centrifuged at 3000 rpm for 15 minutes, and 0.1ml of aqueous phase was precipitated at the bottom of the tube, which was in accordance with the specifications.

3. Viscosity: the viscosity value of the prepared vaccine is 46cP, and the prepared vaccine conforms to the regulation of Chinese veterinary pharmacopoeia.

4. And (4) sterile inspection: the prepared vaccine is carried out according to the regulation of Chinese animal pharmacopoeia, and no bacteria grow.

Efficacy testing of subunit vaccines

30 SPF piglets with the age of 4 weeks are injected with 2ml of vaccine through neck muscles of 15 piglets, 2ml of inactivated virus vaccine is added into pig plug injected with 15 piglets, and in addition, 10 immune physiological saline is used as a control, each pig is respectively subjected to blood collection 21 days after inoculation, serum is separated, and the VP1 antibody level is detected through ELISA, wherein the data are as follows:

TABLE 5 comparison Table of in vivo antibody concentrations in Experimental group and control group

Finally, the above embodiments are only used for illustrating the technical solutions of the present invention and not for limiting, and other modifications or equivalent substitutions made by the technical solutions of the present invention by those of ordinary skill in the art should be covered within the scope of the claims of the present invention as long as they do not depart from the spirit and scope of the technical solutions of the present invention.

SEQUENCE LISTING

<110> Xinyang agriculture and forestry college

<120> cell line for expressing porcine epididymis valley virus VP1 protein, construction method and application

<130> /

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 792

<212> DNA

<213> Artificial Sequence

<220>

<223> /

<400> 1

tccaccgaca acgctgagac tggggttatt gaggcaggta acactgacac cgatttctct 60

ggcgaactgg cggctcctgg ctctaaccat accaatgtca aattcctgtt tgaccgatct 120

cgactactga atgtaattaa ggtactggag aaggacgccg tcttcccccg tcctttcccc 180

acagcaacag gtgcacagca ggacgatggt tacttttgtc ttctgacacc ccgcccaaca 240

gtcgcttccc ggcccgccac tcgtttcggc ctgtacgtca acccatctga cagtggcgtt 300

cttgctaaca cttcactgga tttcaatttt tacagtttag cctgtttcac ttacttcaga 360

tctgaccttg aagtcacggt ggtctcgctg gagccagatt tggaatttgc cgtggggtgg 420

ttcccctctg gcagtgagta ccaggcttct agcttcgtct acgaccaact gcatgtaccc 480

taccacttta ctgggcgcac tccccgcgct ttcaccagca agggtggaaa ggtatctttc 540

gtgctccctt ggaactctgt ctcttccgtg cttcccgtgc gctggggggg cgcttccaag 600

ctttcttctg ccacgcgggg tctgccggct catgctgact gggggaccat ttacgccttc 660

atcccccgtc ctaacgagaa gaaaagcacc gctgtaaagc acgtggcggt gtacgttcgg 720

tacaagaacg cgcgtgcttg gtgccccaac atgcttccct tccgcagcta caagcaaaag 780

atgctgatgc aa 792

<210> 2

<211> 264

<212> PRT

<213> Artificial Sequence

<220>

<223> /

<400> 2

Ser Thr Asp Asn Ala Glu Thr Gly Val Ile Glu Ala Gly Asn Thr Asp

1 5 10 15

Thr Asp Phe Ser Gly Glu Leu Ala Ala Pro Gly Ser Asn His Thr Asn

20 25 30

Val Lys Phe Leu Phe Asp Arg Ser Arg Leu Leu Asn Val Ile Lys Val

35 40 45

Leu Glu Lys Asp Ala Val Phe Pro Arg Pro Phe Pro Thr Ala Thr Gly

50 55 60

Ala Gln Gln Asp Asp Gly Tyr Phe Cys Leu Leu Thr Pro Arg Pro Thr

65 70 75 80

Val Ala Ser Arg Pro Ala Thr Arg Phe Gly Leu Tyr Val Asn Pro Ser

85 90 95

Asp Ser Gly Val Leu Ala Asn Thr Ser Leu Asp Phe Asn Phe Tyr Ser

100 105 110

Leu Ala Cys Phe Thr Tyr Phe Arg Ser Asp Leu Glu Val Thr Val Val

115 120 125

Ser Leu Glu Pro Asp Leu Glu Phe Ala Val Gly Trp Phe Pro Ser Gly

130 135 140

Ser Glu Tyr Gln Ala Ser Ser Phe Val Tyr Asp Gln Leu His Val Pro

145 150 155 160

Tyr His Phe Thr Gly Arg Thr Pro Arg Ala Phe Thr Ser Lys Gly Gly

165 170 175

Lys Val Ser Phe Val Leu Pro Trp Asn Ser Val Ser Ser Val Leu Pro

180 185 190

Val Arg Trp Gly Gly Ala Ser Lys Leu Ser Ser Ala Thr Arg Gly Leu

195 200 205

Pro Ala His Ala Asp Trp Gly Thr Ile Tyr Ala Phe Ile Pro Arg Pro

210 215 220

Asn Glu Lys Lys Ser Thr Ala Val Lys His Val Ala Val Tyr Val Arg

225 230 235 240

Tyr Lys Asn Ala Arg Ala Trp Cys Pro Asn Met Leu Pro Phe Arg Ser

245 250 255

Tyr Lys Gln Lys Met Leu Met Gln

260

<210> 3

<211> 71

<212> DNA

<213> Artificial Sequence

<220>

<223> /

<400> 3

aaggaaaaaa tgtacaaggg aggaggcgga tctggaggag gcggatcaat gtccaccgac 60

aacgccgaga c 71

<210> 4

<211> 31

<212> DNA

<213> Artificial Sequence

<220>

<223> /

<400> 4

cgcggatccg cctattgcat cagcatcttt t 31

Claims

1. A cell line expressing VP1 protein of suis intragag, which is characterized in that: the cell line contains the VP1 gene of the sui intraplus valley virus and can stably express the VP1 protein of the sui intraplus valley virus.

2. The cell line expressing the VP1 protein of porcine Selaginella Valeriana according to claim 1, wherein the sequence of the VP1 gene is shown as SEQ ID No.1, and the amino acid sequence of the VP1 protein is shown as SEQ ID No. 2.

3. The method of claim 1 or 2, comprising the steps of:

s1, designing a primer, amplifying a VP1 gene, purifying and recovering;

s2, constructing a pLV/VP1 recombinant plasmid;

s3, amplifying the pLV/VP1 recombinant plasmid obtained from S2;

4. The method for constructing the porcine Selaginella Valeriana VP 1-expressing leukocyte line of claim 3, wherein the primers comprise an upstream primer and a downstream primer, the upstream primer is VP1-F (shown in SEQ ID NO. 3), and the downstream primer is VP1-R (shown in SEQ ID NO. 4).

5. The use of a cell line expressing VP1 protein of suis intrastoppered valley virus according to claim 1 or 2, for the preparation of a subunit vaccine of suis intrastoppered valley virus.