CN104611299B - H9N2 avian flus strain, preparation method, vaccine combination and its application of a kind of artificial recombination - Google Patents
H9N2 avian flus strain, preparation method, vaccine combination and its application of a kind of artificial recombination Download PDFInfo
- Publication number
- CN104611299B CN104611299B CN201410497260.4A CN201410497260A CN104611299B CN 104611299 B CN104611299 B CN 104611299B CN 201410497260 A CN201410497260 A CN 201410497260A CN 104611299 B CN104611299 B CN 104611299B
- Authority
- CN
- China
- Prior art keywords
- strain
- albumen
- avian
- influenza virus
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The present invention provides a kind of H9N2 avian flus strain, and avian flu strain group of attaching most importance to has the HA albumen and SEQ ID NO of SEQ.NO.2 protein sequences:2/6 Strain of rH9N2 of the NA albumen of 4 protein sequences.2/6 Strain of H9N2 avian influenza virus rH9N2 of restructuring is saved out using reverse Genetics Technique, there is good immunogenicity.HI antibody reaches 11Log2 after 28d is immunized in the inactivated vaccine prepared using the Strain.The reverse Genetics Technique of the present invention can quickly obtain purpose virus, and filter out the vaccine that can prepare prevention broad-spectrum viral, and the attack after the vaccine immunity to H9N2 provides protection completely.
Description
Technical field
The present invention relates to reverse Genetics Technique and zoonosis technical field, and in particular to a kind of artificial recombination H9N2
Avian influenza vaccine and its application.
Background technology
Avian influenza virus (Avian influenza virus AIV) is birds and the respiratory system of some mammals
Important pathogen, belongs to orthomyxoviridae family's Influenza Virus on taxology.
Different according to the protein antigenicity on surface, avian influenza virus is divided into 17 kinds of hypotype hemagglutinin (HA) and 10 kinds of hypotypes
Neuraminidase (NA), wherein, H9N2 subtype avian influenza virus is worldwide widely current, and is not only caused to aviculture
Huge economic loss, and danger is caused to human health.China was separated in 1994 from one, Guangdong Province chicken house
One plant of H9N2 subtype avian influenza, hereafter, the subtype avian influenza virus are spread rapidly to neighbouring province.
After the existing inactivated vaccine in China is applied in some provinces, the prevalence of the subtype virus is not effectively controlled,
Avian influenza virus is determined that influenza virus can often morph, is caused immune due to immune pressure and the viral structure of itself
Failure and new prevalence, epidemiological analysis find H9N2 there occurs antigenic variation, and part late period separation strains have obtained infection and fed
The ability of newborn animal.
Influenza virus reverse genetics operating technology is to build direct, the simple side of artificial recombination influenza virus vaccine strain
Method, its basic principle are that mRNA and vRNA the transcription plasmid of 8 fragments of avian influenza virus genome cDNA are transfected into conjunction jointly
Suitable cell line, respectively under the action of the RNA polymerase of DNA dependences in the cell, synthesizes the mRNA and disease of PB1, PB2, PA, NP
All RNA fragments of virus gene group, the former instruct synthesis viral polymerase enzyme system and NP albumen and with virus genome RNA combination shape
Start the duplication of virus afterwards into nucleoprotein complex (RNPs), produce complete virion.
However, there is following problem for the prior art：
Strain differs greatly inside H9N2 hypotypes, it is difficult to filters out the H9N2 Strain with broad spectrum protection as epidemic disease
Seedling；
It is by the way that several different strain co-infection chicken embryos or cell, screening are recombinated that conventional method, which obtains recombinant strain,
Strain, this recombination form are time-consuming and laborious；And some comes from same poison using the HA and NA of the recombinant virus of the mode of reverse genetic
Strain, cross protection are poor.
The content of the invention
The defects of it is an object of the invention to overcome the prior art, obtain a kind of restructuring H9N2 avian influenza virus, the virus
The vaccine of the prevention more broad-spectrum viral of preparation, and the vaccine are applied in terms of the vaccine of prevention birds H9N2 subtype influenzas.
The first aspect of the present invention is a kind of H9N2 avian flus strain, and avian flu strain group of attaching most importance to has
The HA albumen and SEQ ID NO of SEQ.NO.2 protein sequences:The rH9N2-2/6 Strain of the NA albumen of 4 protein sequences.
The present invention is the H9N2 hypotype recombinant influenzas of one plant of artificial recombination, which is based on life
Thing informatics is artificial synthesized, and 6 internal genes are from H1N1PR8 viruses, the existing popular H9N2 hypotype streams of the virus and China
Influenza Virus antigenic determinant is consistent, and has good chicken embryo adaptability, the vaccine strain as prevention H9 hypotype animal influenzas
As a kind of preferred embodiment of the present invention, the gene order of the avian flu strain coding HA albumen is
SEQ.NO.1 nucleotide sequences, the gene order of the avian flu strain coding NA albumen is SEQ.NO.3 nucleotide sequences.
Another aspect of the present invention is a kind of method for preparing the H9N2 avian flus strain, wherein, the method bag
Include：By 6 genes PB2, PB1, PA, NP, M, NS and volume of embryo-culture viruses strain A/Puerto Rico/8/34 (H1N1) (PR8)
The HA genes and coding SEQ ID NO of code SEQ.NO.2 protein sequences:The NA genes of 4 protein sequences are recombinated, and are built into
H9N2 avian influenza genes recombinant strains rH9N2-2/6.
Another aspect of the present invention is a kind of H9N2 avian influenza virus vaccines, wherein, the avian influenza virus vaccine includes
The H9N2 avian influenza virus antigens of immune amount.
The H9N2 subtype influenza virus of above-mentioned artificial recombination, has Chinese popular H9N2 avian influenza virus extensive
Protectiveness, and there is high titre chicken embryo adaptability, to chicken and chicken embryo had no pathogenicity.
As a kind of preferred embodiment of the present invention, the H9N2 avian influenza virus antigens are described for inactivation
RH9N2-2/6 virus totivirus antigens；The H9N2 avian influenza virus vaccines further include adjuvant.
As a kind of preferred embodiment of the present invention, the H9N2 avian influenza virus antigens content is before inactivating
109.25EID50/0.1mL。
Invention further provides a kind of HA albumen, the HA albumen substantially encodes SEQ.NO.2 protein sequences.
Invention further provides a kind of NA albumen, the NA albumen substantially encodes SEQ.NO.4 protein sequences.
" substantially coding " means protein sequence by adding, deleting or replaces after one or more amino acid residues still
Have the function of with former albumen same or like.
Another aspect of the present invention provides a kind of subunit vaccine, and the subunit vaccine contains the claim of immune amount
HA proteantigens described in 1 and the NA proteantigens described in the claim 2 of immune amount.
Another aspect of the present invention provides a kind of method for preparing the vaccine combination, the described method includes：Respectively
The expression HA albumen and the NA albumen；And the HA albumen and NA albumen of the expression are mixed in proportion.
Another aspect of the present invention is that the H9N2 avian influenza virus vaccines are preparing prevention and treatment H9N2 bird flus
Application in medicine.
Compared with prior art, the beneficial effects of the invention are as follows：
1. antigen has antigen broad spectrum activity, a variety of avian flu H9N2 viruses can be prevented.
2. the artificial recombination virus of the present invention has good immunogenicity, HI antibody reaches 11Log2 after immune 28d, should
It is viral consistent with existing popular H9N2 subtype influenza virus antigenic determinants, and there is good chicken embryo adaptability, as prevention
The vaccine strain of H9 hypotype animal influenzas.
3. the attack after vaccine immunity to H9N2 provides protection completely, do not fall ill after immune chicken work(poison, it is not dead, do not arrange
Poison.
Brief description of the drawings
Fig. 1 is PR86 gene PCR agarose gel electrophoresis figure, and from left to right, each swimming lane is respectively：NS、M、NP、PB1、
PB2 and PA identified for genes swimming lanes, the swimming lane of rightmost is DL5000Marker；
Fig. 2 is artificial synthesized HA and NA gene agarose gel electrophoresis figures, and from left to right, each swimming lane is respectively NA, HA
Identified for genes swimming lane, the swimming lane of rightmost is DL5000Marker；
Fig. 3 is the plasmid map of the pBD used in the present invention；
Fig. 4 saves process schematic for influenza virus.
In sequence table：
Sequence 1 has the nucleotide sequence of the DNA operating levels of the HA genes of broad spectrum protection for the present invention；
Sequence 2 has the amino acid sequence of the HA genes of broad spectrum protection for the present invention；
Sequence 3 has the nucleotide sequence of the DNA operating levels of the NA genes of broad spectrum protection for the present invention；
Sequence 4 has the amino acid sequence of the NA genes of broad spectrum protection for the present invention.
Embodiment
The invention will now be further described with reference to specific embodiments, and the advantages and features of the present invention will be with description more
To be clear.But these embodiments are only exemplary, do not form any restrictions to the scope of the present invention.Those skilled in the art
It should be understood that the details and form of technical solution of the present invention can be carried out without departing from the spirit and scope of the invention
Modifications or substitutions, but these modifications and replacement are each fallen within protection scope of the present invention.
Embodiment one：The clone of related gene
1st, PR8 influenza viruses (the preservation mechanism for deriving from St.Jude Children ' s Research Hospital) RNA
Extracting
With reference to II kit (Taiwan Xu Ji companies (Geneaid of Viral Nucleic Acid Extraction Kit
Biotech) make) specification extraction avian influenza virus RNA, specific method is as follows：
1) 200 μ L (insufficient to mend enough 200 μ l with PBS) sample is taken into 1.5ml EP pipes, to add 400 μ L VB lysates,
10min is incubated at room temperature after being mixed with vortex instrument.
2) 450 μ L AD liquid (ensuring to have been added to absolute ethyl alcohol in AD liquid) are added, are firmly shaken up.
3) VB films are fitted into 2ml collecting pipes, add the 600 above-mentioned cleavage mixtures of μ L into VB films, 14000-16000g
Centrifuge 1min.
4) liquid in collecting pipe is discarded, VB films are put back in collecting pipe again, adds remaining cleavage mixture, 14000-
16000g centrifuges 1min.
5) collecting pipe is discarded, VB films are fitted into new 2ml collecting pipes.
6) add in 400 μ L W1Buffer to VB films, 14-16000g centrifugations 30s.
7) liquid in collecting pipe is discarded, VB films are reinstalled in collecting pipe.
8) 600 μ L wash buffer (ensuring that wash buffer had added absolute ethyl alcohol) are added into VB films,
14000-16000g centrifuges 30s.
9) liquid in collecting pipe is discarded, VB films are loaded into collecting pipe, 14000-16000g centrifugations 3min.
10) VB films are attached in a new 1.5ml EP pipe, add 50 water of the μ L without RNase to VB films center, it is static
3min, then 14000-16000g centrifuge 1min.
2nd, design of primers synthesizes
With reference to E.hoffman etc. (2001) Arch.Viraol.146:Described in 2275-2289, with section specific primer, expand
PR8cDNA obtained by exhibition.Primer synthesis is completed by Invitrogen companies, and primer pair nucleotide sequence used is as follows：
Reverse transcription primer uni12primer:5'AGCAAAAGCAGG3'
Expand the primer pair of PB2 genes：
P1：5'TATTGGTCTCAGGGAGCAAAAGCAGGTC3'
P2：5'ATATGGTCTCGTATTAGTAGAAACAAGGTCGTTT3'
Expand the primer pair of PB1 genes：
P1：5'TATTCGTCTCAGGGAGCAAAAGCAGGCA3'
P2：5'ATATCGTCTCGCGTATTAGTAGAAACAAGGCATTT3'
Expand the primer pair of PA genes：
P1：5'TATTCGTCTCAGGGAGCAAAAGCAGGTAC3'
P2：5'ATATCGTCTCGTATTAGTAGSSSCAAGGTACTT3'
Expand the primer pair of NP genes：
P1：5'TATTCGTCTCAGGGAGCAAAAGCAGGGTA3'
P2：5'TATACGTCTCGTATTAGTAGAAACAAGGGTATTTTT3'
Expand the primer pair of NS genes：
P1：5'TATTCGTCTCAGGGAGCAAAAGCAGGGTG3'
P2：5'ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT3'
Expand the primer pair of M genes：
P1：5'TATTCGTCTCAGGGAGCAAAAGCAGGTAG3'
P2：5'ATATCGTCTCGTATTAGTAGAAACAAGGTAGTTTTT3'
3rd, the reverse transcription of viral RNA
In 20 μ L l reverse transcription systems, following component is sequentially added：M-MLV Reverse Trascriptase (are purchased from
Beijing Quanshijin Biotechnology Co., Ltd) 1.0 μ L, RNase inhibitor (are purchased from the complete limited public affairs of formula gold biotechnology in Beijing
Department)) 0.5 μ L, 5X M-MLV buffer4.0 μ L, dNTP (2.5mM) 2.0 μ L, uni 12primers (10pmol) 1 μ L, fowl stream
11.5 μ L of Influenza Virus RNA, mix 42 DEG C of 1h in postposition PCR instrument and carry out reverse transcription, reverse transcription product is directly used in PCR or 4 DEG C
Save backup.
4th, the PCR amplification of influenza cDNA
2 μ L, primeSTAR archaeal dna polymerase of reverse transcription product is added in PCR reaction tubes, and (precious bioengineering (Dalian) has
Limit company) 0.5 5 μ L, dNTP mixture (2.5mM) of μ L, 10X primeSTAR buffer, 4 μ L, the upstream and downstream of each gene draws
Each 1 μ L (10pmol) of thing, RNase free water are adjusted to 50 μ L, mix after being expanded in PCR instrument.PCR amplification journey
Sequence is 95 DEG C, 5min of pre-degeneration, is denatured 98 DEG C, 30s, is annealed 55 DEG C, 30s, extends 72 DEG C, 2min, runs 30 circulations, finally
Extend 10min in 72 DEG C, while set the negative control of no template, cut after reaction on 1% Ago-Gel after electrophoresis
Purpose band, for recycling.
5th, PCR product recycles
Cut the Ago-Gel containing purpose fragment after electrophoresis from gel under ultraviolet light, quickly returned with DNA
Receive kit (Omega Bio-tek) recycling DNA.It is as follows with method：The gel containing target DNA is cut, it is sterile to be put into one
1.5ml EP pipes in, add 3 times of volumes binding buffer, 5min in 50-60 DEG C of water-bath, flick therebetween EP pipe, make
Gel dissolves completely.Then the liquid dissolved is added in recovery column, 10000rpm centrifugation 1min, outwell in collecting pipe and give up
Liquid, adds 300 μ L binding buffer, 10000rpm centrifugation 1min, waste liquid in collecting pipe is outwelled, with 500ml wash
Buffer 10000rpm centrifugations wash pillar twice, and sky adds 15-30 μ L ddH from 1min with pillar center after outwelling waste liquid2O,
2min is stored at room temperature, 12000rpm centrifuges 2min, is the DNA fragmentation of recycling in collecting pipe.
6th, coupled reaction
It is (limited purchased from the full formula gold biotechnology in Beijing that the PCR product of withdrawal is directly connected to pEASY-blunt vector
Company) in, linked system and condition are：4 μ L, pEASY-blunt vector of PCR product, 1 μ L, after gently mixing, room temperature
(20-37 DEG C) reaction 5min, after reaction, centrifuge tube is placed in and prepares to convert on ice.
7th, the conversion of connection product
Connection product is added (to add connection when competent cell just thaws in 50 μ L trans1-T1 competent cells
Product), after flicking mixing, ice bath 20-30min；42 DEG C of heat shock 30S, are immediately placed on 2min on ice；250 μ L are added to balance to room
SOB the or LB culture mediums of temperature, are incubated 1h under the conditions of 200 revs/min, 37 DEG C；Take 8 μ L, 500mM IPTG, 40 μ L μ L, 20mg/
After ml X-gal are mixed, equably it is applied on ready tablet, 30min is placed at 37 DEG C；After treating that IPTG, X-gal are absorbed,
The converted product that 200 μ L are incubated is taken to be coated on above-mentioned tablet, in 37 DEG C of CMC models.
8th, PCR method identification positive recombinant
The white colonies that selecting step 7 converts are vortexed and mix into 10 μ l sterile waters；In 25 μ l reaction systems, 1 μ l are taken to mix
The template that liquid is used as PCR reactions is closed, recon is identified with M13 forward primers and reverse primer；PCR reaction conditions：94 DEG C of pre- changes
Property 10min (cell lysis, inactivate nuclease), 94 DEG C of denaturation 30S, 55 DEG C of annealing 30S, 72 DEG C of extensions are (according to the size of fragment
Determine extension of time).30 circulate, and extend 10 minutes after 72 DEG C, determine the clone for including recon.
9th, the small of plasmid carries
The clone that the positive is accredited as in step 8 is inoculated in 3-5ml LB and is incubated overnight, then with Tiangeng biochemical technology
Plasmid extraction kit (the article No. of Co., Ltd：DP 103-03) extracting plasmid, comprise the following steps that：
1) column equilibration step：Into adsorption column CP4, (adsorption column is put into collecting pipe) adds the equilibrium liquid BL of 500 μ L,
12000rpm (~13400g) centrifuges 1min, outwells the waste liquid in collecting pipe, adsorption column is placed back in collecting pipe.
2) bacterium solution that 3-5ml is incubated overnight is taken to add in centrifuge tube, 12000rpm (~13400g) centrifugation 1min, inhale as far as possible
Except supernatant.
3) 500 μ L solution Pl (resuspension thalline) are added into the centrifuge tube for leave bacterial sediment (please first to check whether and add
Enter RNaseA), use pipettor or the thorough suspended bacterial cell precipitation of turbula shaker.
4) 500 μ L solution P2 (lysate, cracks thalline) are added into centrifuge tube, leniently spinning upside down 6-8 times makes bacterium
Body fully cracks.Bacterium solution should become limpid sticky at this time, and 5min is not to be exceeded in the time used, in case plasmid is destroyed.If
Do not become limpid, may be excessive due to thalline, cracking is not thorough, and should reduce biomass.
5) 700 μ L solution P3 (neutralizer, neutralizes lysate) are added into centrifuge tube, leniently spin upside down 6-8 immediately
It is secondary, fully mix, white flock precipitate occurs at this time.12000rpm (~13400g) centrifuges 10min, at this time at centrifuge tube bottom
Portion forms precipitation.If there is minute white precipitation in supernatant, supernatant is taken after can centrifuging again.
6) supernatant for collecting previous step adds Filter column Cs (Filter column is put into collecting pipe), 12000rpm by several times
(~13400g) centrifugation 2min, the solution obtained in collected after centrifugation pipe is carefully added into (adsorption column in adsorption column CP4 by several times
It is put into collecting pipe), (if the liquid for having remnants in Filter column illustrates that impurity is excessive in the supernatant that step 5 is drawn, and can extend
The time of centrifugation；If collected after centrifugation bottom of the tube has a small amount of precipitation to draw supernatant as best one can).
7) 12000rpm (~13400g) centrifuges l min, outwells the waste liquid in collecting pipe, adsorption column CP4 is put into collection
Guan Zhong.
8) 500 μ L protein liquid removals PD, 12000rpm (~13400g) centrifugation l min are added into adsorption column CP4, outwell receipts
Waste liquid in collector, adsorption column CP4 is put into collecting pipe.
9) 600 μ L rinsing liquids PW (please first check whether and added absolute ethyl alcohol), 12000rpm are added into adsorption column CP4
(~13400g) centrifugation 1min, outwells the waste liquid in collecting pipe, adsorption column CP4 is put into collecting pipe.Pay attention to：Add rinsing liquid
After PW, if being stored at room temperature 2-5min, help preferably to remove impurity.
10) 600 μ L rinsing liquids PW, 12000rpm (13400g) centrifugation l min are added into adsorption column CP4, outwell collection
Waste liquid in pipe.
11) adsorption column CP4 is placed back in collecting pipe and is placed in 12000rpm (~13400g) centrifugations 2min, it is therefore an objective to will
Remaining rinsing liquid removes in adsorption column.
12) adsorption column is placed in a clean centrifuge tube, 100-300 μ L is vacantly added dropwise to the middle part of adsorbed film
Elution buffer TB, room temperature place 2min, and plasmid solution is collected into centrifuge tube by 12000rpm (~13400g) centrifugations l min
In.
10th, Sequencing and Characterization
Send Invitrogen to be sequenced by each three clones of gene selects the positive colony extracted in step 9, use
Common biosoftware DNAStar 4.0 analyzes the sequence of sequencing.
11st, the structure of pBD series recombinant plasmid
It is same with warp with 6 genetic fragments of the PR8 in BsmB I digestion pEASY-blunt vector, recycling purpose fragment
(plasmid map refers to as shown in Fig. 2, derive from Harbin Veterinary Medicine Inst., China Academy of Agriculture the carrier pBD of sample digestion：Rope
Soldier forever, ageing orchid etc., A/duck/FuJian/01/02 plants of Reverse genetics of H5N1 subtype highly pathogenic avian influenza virus
Foundation) be attached and convert DH5 α, the restructuring that screening obtains series is carried out to the transformant of each fragment with the method for PCR
Plasmid, i.e. pBD-PB2, pBD-PB1, pBD-PA, pBD-NP, pBD-M, pBD-NS, by precious bioengineering (Dalian) Co., Ltd
HA, NA gene are synthesized according to the sequence SEQ.NO.1 and SEQ.NO.3 of offer, is cloned on transcription/expression vector pBD and obtains weight
Group plasmid pBD-HA and pBD-NA.
Embodiment two：Recombinate rescue and the biological characteristics of H9N2 avian influenza virus
1st, the extraction of endotoxin plasmid is gone
According to OMEGA companies provide kit Endo-free plasmid mini kit II the step of extraction (according to
The specification operation of kit), comprise the following steps that：
(1) Escherichia coli with purposeful plasmid are inoculated in the 10-20ml culture tubes equipped with 5ml ampicillins LB,
37 DEG C of shaking table culture 12-16h, to expand plasmid.With a 10-20ml culture tube or blake bottle, its volume at least culture medium
4 times.
(2) bacterium solution of 5.0ml is taken, 10000g centrifuges 1min to precipitate strain at room temperature.
(3) above-mentioned LB culture mediums are poured out or suctioned out, are discarded.250 μ L solution I/RNase A are added in toward precipitation
Bacterium is resuspended in mixed liquor, and vortex oscillation makes cell is entirely complete to suspend again.
(4) toward 250 μ L solution II (lysate) are added in the resuspension mixed liquor of step 3, gently overturn and mix 7-
10 times, 2min is stored at room temperature if it is necessary, lysate can be placed in, avoids being vigorously mixed lysate, otherwise can make chromosomal DNA
The plasmid purity for being broken and making reduces.Cracking reaction does not exceed 5min.
(5) 125 μ L ice bath Buffer N3 (neutralizer) are added into the mixed liquor of step 4, and leniently turn upside down from
Heart pipe mixes for several times, until forming white flock precipitate.
(6) at room temperature, 12000g centrifuges 10min.
(7) carefully supernatant is poured into a clean centrifuge tube, adds the ETR solution (blueness) of 0.1 times of volume to supernatant
In, overturn test tube 7-10 times, 10min is then stood in ice bath to remove endotoxin.
(8) above-mentioned lysate is stood into 5min at 42 DEG C.Lysate will occur muddiness again again.At this time, immediately in 25
DEG C, 12000g centrifugation 3min, ETR solution will form blue layering in test tube bottom.
(9) supernatant is transferred in another new 1.5ml centrifuge tubes, adds the absolute ethyl alcohol of 1/2 times of volume room temperature, gently
Overturn test tube 6-7 times, room temperature places 1-2min.
(10) a clean Hibind mini columns (I) are taken to collect careful on test tube suction out mounted in a 2ml
Clearly, 700 μ L sample solution are taken to be gone in pillar, 10000g centrifuges 1min at room temperature, lysate is flowed completely through pillar.
(11) 500 μ L HB buffer, 10000g centrifugation 1min are added, discard waste liquid.
(12) 700 μ L wash solution buffer, 10000g centrifugation 1min are added, discard waste liquid.
(13) repeat step 12 is once.
(14) 12000g centrifuges 2min.
(15) 50 μ L elution buffer are added, 37 DEG C of incubators place 5min, 10000g centrifugations 1min.
2nd, liposome-mediated transfection
According to (the Eight-plasmid system for rapid generation of such as Hoffman
influenzavirus vaccines,(2002)vaccine 20:It is 3165-3170) described, transfected by DNA and produce restructuring disease
Poison.
Specifically, can co-culturing 293T and mdck cell, (each cell line contains 0.2-1x106Cell) and for transfecting
Experiment.By design combination 8 plasmids (pBD-PB2, pBD-PB1, pBD-PA, pBD-NP, pBD-M, pBD-NS, pBD-HA and
PBD-NA), respectively take 1 μ g uniformly to mix, be diluted to 250 μ L serum free medium OPTI-MEM, take 20 μ L Lipofectamine
2000Transfection Reagent (Invitrogen) are diluted to 250 μ L serum free mediums OPTI-MEM to specifications
In, room temperature places 5min, then diluted Lipofectamine is slowly added dropwise into plasmid mixed liquor, gently pressure-vaccum 3-5
It is secondary, after fully mixing, room temperature effect 20min, while set up the negative control of one pBD-PB2 plasmid of missing.6 holes are organized to train
Support in plate and cultivated about 18-24h, 80-90% abundance, be evenly distributed, the 293T that growth conditions are good and mdck cell nothing
After serum, the DMEM of antibiotic-free wash 2 times, plasmid and the mixed liquor of Lipofectamine 2000 are added, makes its uniform fold
In on cell, at 37 DEG C, 5%CO26-8h is adsorbed in incubator, is changed into containing 2%BSA, the DMEM2mL of 1%TPCK- pancreatin,
Supernatant cell is collected after cultivating 30-48h.
The cell of transfection and supernatant inoculation 9-11 age in days SPF chicken embryos (are led into real experimental animal technology purchased from Beijing Cimmeria
Co., Ltd), each 5 embryos of sample inoculation, per embryonic breeding kind 0.2mL, put 33-35 DEG C and continue to cultivate, observe chicken embryo death daily
Situation, collect chick embryo allantoic liquid in due course, be named as rH9N2-2/6.
3rd, the Biological characteristics of artificial recombination H9N2
After rH9N2-2/6 viruses are serially diluted by 3.1 viral levels again with sterile saline 10,10 are taken-6-10-94
Dilution factor, each chick embryo allantoic cavity 10 5 pieces of age in days SPF chicken embryos of interior inoculation, per embryo 0.1mL, is placed in 33-35 DEG C and continues to be incubated, in 24h
Dead chicken embryo, which discards, to be disregarded, and dead chicken embryo is taken out at any time in 24h-96h, harvests chick embryo allantoic liquid, same dilution factor
Chick embryo allantoic liquid mixed in equal amounts, erythrocyte agglutination valency is measured by dilution factor respectively, to 96h, is taken out all embryos living, is harvested chicken one by one
Embryo allantoic liquid, measures erythrocyte agglutination valency, agglutination titer >=1 respectively:64 be judged to infect, as a result rH9N2-2/6 viral levels are
109.30EID50/0.1mL。
3.2 erythrocyte agglutination valencys are by existing《Chinese veterinary pharmacopoeia》Annex carries out, and rH9N2-2/6 is to 1% chicken red blood cell aggegation
Valency 211。
The virulence of 3.3 pairs of chicken embryos with sterile saline by the allantoic fluid rH9N2-2/6 viruses harvested in step 2 according to
10-6-10-10After dilution, 10 pieces, every piece of 0.1ml of inoculation 9-11 age in days SPF chicken embryos, interior when 24-96 is small after inoculation in allantoic cavity, and 9
A chicken embryo death.Dissect is observed, and the lesions such as systemic bleeding, obvious oedema, hepatic necrosis occurs in dead chicken embryo.
The virulence of 3.4 pairs of chick with sterile saline by the allantoic fluid virus rH9N2-2/6 harvested in step 2 according to 1:
After 10 dilutions, wing venous inoculation 4-8 week old SPF chickens 10, every chicken 0.1ml, observe 10, chicken is without dead or bright after inoculation
Aobvious abnormal response only has indivedual chickens and slight respiratory symptom occurs.The 5th day after inoculation, throat swab and cloacal swab are gathered,
9-11 age in days SPF chicken embryo isolated virals, the swab virus point of 10 chicken collections are inoculated with after two kinds of swabs of same chicken are mixed
From for the positive.
RH9N2-2/6 is diluted to the antigen liquids of 4HA units with sterile saline by 3.5 specificity, respectively with ND, EDS,
H5 subtype avian influenzas, H7 subtype avian influenza positive serums, SPF chicken serums and H9 subtype avian influenza positive serums do HI experiments,
RH9N2-2/6 viruses are only capable of showing as the blood clotting suppression positive by H9 subtype avian influenza positive serums, to other positive serums such as ND
And SPF chicken serums should be negative.
3.6 immunogenicity
3.6.1 the preparation of seedling venom
Inoculation：The allantoic fluid rH9N2-2/6 seeds culture of viruses harvested in step 2 are taken, are made with sterile saline or PBS appropriate dilute
Release (such as 10-4Or 10-5), the susceptible chicken embryo of 9-11 ages in days is inoculated with, per embryo 0.1-0.2ml, pin hole is sealed after inoculation, is placed in 36-37
DEG C continue to hatch, it is not necessary to turn over embryo.
It is incubated and observes：The growing state of chicken embryo is checked daily, dead chicken embryo in 24h, it is believed that it is nonspecific death, should
This is discarded.If chicken embryo has death, 4 DEG C are first placed, collects allantoic fluid and amniotic fluid together within the 5th day after inoculation.
Harvest：Each chicken embryo surveys HA after being inoculated with 5 days, can be urinated for HA is positive with 10ml sterile pipettes absorption chicken embryo
For cyst fluid as in clean centrifuge tube, 3000rpm centrifugation 5min, after removing blood and cell, can carry out follow-up test immediately
Or -80 DEG C save backup.
For virus titer measure with 3.1, the virus liquid titre of harvest is 109.25EID50/0.1mL
3.6.2 inactivation：The amount harvested according to chick embryo allantoic liquid, draws paraformaldehyde with pipettor, is added in virus liquid,
Side edged mixes, and makes final concentration of the 0.1% of paraformaldehyde；After adding paraformaldehyde, fully mix at once, be placed in 4 DEG C and put
Put 48h；
3.6.3 examined after inactivation：After inactivating 48h, paraformaldehyde is made into used poison disease vaccination 9-11 ages in days SPF chicken embryos
Blind passage three generations is carried out, per pickup 3-4 pieces of chicken embryo of kind, chick embryo allantoic liquid is collected after blind passage, all surveys HA, as a result all feminine genders,
Illustrate that inactivation of virus is complete.
3.6.4 the preparation of oil adjuvant inactivated vaccine：Using import white oil as emulsifying agent, will pacify after the inactivation of 0.1% formalin
Qualified virus is examined, according to 2:1 oil-water ratio, which is slowly added into oily adjuvant, is made Water-In-Oil inactivated vaccine.
3.6.5 immunogenicity
The oil adjuvant inactivated vaccine of above-mentioned preparation is subjected to immunogenicity inspection by the following method：
3.6.5.1 serological method subcutaneously or intramuscularly vaccinates 0.2ml with 21 age in days SPF chickens 45,30 each necks,
Another 15 compare, and 28 days after inoculation, every chicken blood sampling, separates serum, with avian influenza virus H9 hypotype commercialization antigen measurings
HI antibody.
HI antibody determination results after table 1 is 28 days immune
3.6.5.2 Immunization method subcutaneously or intramuscularly vaccinates 0.2ml with 21 age in days SPF chickens 45,30 each necks,
Another 15 compare, and 28 days after inoculation, take the representative strain (A of popular strain：ck/shangdong/lc 1124/07；B:ck/
Shandong/lx316/07；C:Ck/beijing/3/01, reference：Yi Zhang et al., Molecular and
antigenic characterization of H9N2avian influenza virus isolates from chicken
Flocks between 998and 2007in china, veterinary Microbiology156 (2012) 285-293) into
Row wing venous is injected, and each Strain attacks 10 rH9N2-2/6 and chicken, and 5 control group chickens are immunized.Attack continuously observation 14 after poison
My god, the incidence of chicken is observed, and the 5th day after poison is attacked, gather the cloacal swab of every chicken, each cloacal swab sample
Product are incubated observation 5 days, are imitated by the HA of embryo measure chicken embryo liquid through 5 pieces, every piece of 0.2ml of allantoic cavity inoculation 9-11 age in days SPF chicken embryos
Valency, as long as there is 1 piece of chicken embryo liquid HA potency >=1 in 5 pieces of each sample inoculation:16 (micromethods), that is, be determined as virus purification sun
Property.To the sample of virus purification feminine gender, judge again after answering blind passage once.3 immune groups are not separated to virus, and control group has one
Group is positive for 4/5, remaining two groups of control group is the positive.
2 immune group of table and control group attack observation and cloaca swab virus purification result after poison
The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all essences in the present invention
With within principle, any modification, equivalent replacement, improvement and so on, should all be included in the protection scope of the present invention god.
Claims (12)
1. a kind of H9N2 avian flus strain, the avian flu strain attach most importance to group have SEQ.NO.2 protein sequences HA albumen and
SEQ ID NO:The rH9N2-2/6 Strain of the NA albumen of 4 protein sequences.
2. H9N2 avian flus strain according to claim 1, wherein, the base of the avian flu strain coding HA albumen
Because sequence is SEQ.NO.1 nucleotide sequences, the gene order of the avian flu strain coding NA albumen is SEQ.NO.3 nucleosides
Acid sequence.
3. a kind of method for preparing H9N2 avian flus strain described in claim 1, wherein, the described method includes：Chicken embryo is fitted
Answer 6 genes PB2, PB1, PA, NP, M, NS and coding SEQ.NO.2 of strain A/Puerto Rico/8/34 (H1N1) (PR8)
The HA genes and coding SEQ ID NO of protein sequence:The NA genes of 4 protein sequences are recombinated, and are built into H9N2 bird flu bases
Because of recombinant strain rH9N2-2/6.
4. according to the method described in claim 3, wherein, the described method includes：Structure expresses embryo-culture viruses strain A/ respectively
6 plasmids and structure of 6 genes PB2, PB1, PA, NP, M, NS of Puerto Rico/8/34 (H1N1) (PR8) are expressed respectively
The HA genes and expression SEQ ID NO of SEQ.NO.2 protein sequences:2 plasmids of the NA genes of 4 protein sequences, by described 8 kinds
Plasmid mixes, and is added to transfection reagent in 293T cells, and H9N2 bird flu rH9N2-2/6 Strain is obtained after culture.
5. a kind of H9N2 avian influenza virus vaccines, wherein, the avian influenza virus vaccine is included described in the claim 1 of immune amount
H9N2 avian influenza virus antigens.
6. H9N2 avian influenza virus vaccines according to claim 5, wherein, the H9N2 avian influenza virus antigens are to go out
The rH9N2-2/6 viruses totivirus antigen living；The H9N2 avian influenza virus vaccines further include adjuvant.
7. H9N2 avian influenza virus vaccines according to claim 5, wherein, the H9N2 avian influenza virus antigen contents
For before inactivation 109.25EID50/0.1mL。
8. a kind of HA albumen, the HA albumen is shown in sequence SEQ.NO.2.
9. a kind of NA albumen, the NA albumen is shown in sequence SEQ.NO.4.
10. a kind of subunit vaccine, the subunit vaccine contains the HA proteantigens described in the immune claim 8 measured and exempts from
NA proteantigens described in the claim 9 of epidemic disease amount.
11. a kind of method for preparing the subunit vaccine described in claim 10, the described method includes：
(1) the HA albumen and the NA albumen are expressed respectively；And
(2) the HA albumen and NA albumen of the expression are mixed in proportion.
12. the subunit vaccine described in any one of claim 5, the 6 H9N2 avian influenza virus vaccines and claim 10 exists
Prepare the application in the medicine of prevention and treatment H9N2 bird flus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410497260.4A CN104611299B (en) | 2014-09-25 | 2014-09-25 | H9N2 avian flus strain, preparation method, vaccine combination and its application of a kind of artificial recombination |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410497260.4A CN104611299B (en) | 2014-09-25 | 2014-09-25 | H9N2 avian flus strain, preparation method, vaccine combination and its application of a kind of artificial recombination |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104611299A CN104611299A (en) | 2015-05-13 |
| CN104611299B true CN104611299B (en) | 2018-05-04 |
Family
ID=53145951
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410497260.4A Active CN104611299B (en) | 2014-09-25 | 2014-09-25 | H9N2 avian flus strain, preparation method, vaccine combination and its application of a kind of artificial recombination |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104611299B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110305898A (en) * | 2019-06-18 | 2019-10-08 | 扬州大学 | The rescue of the non-susceptible H9N2 hypotype acclimatization to cold avian influenza virus of mammalian cell |
| CN110628819A (en) * | 2019-10-25 | 2019-12-31 | 山东省农业科学院家禽研究所 | Method for constructing reverse genetic operation system of H13N2 subtype influenza virus and application thereof |
| KR102556305B1 (en) * | 2021-04-05 | 2023-07-19 | 대한민국 | H9N2 Strain Genetic Recombinant Low Pathogenic Avian Influenza A Virus, Manufacturing Method and Vaccine Composition Thereof Using H9N2 Avian Influenza Virus Belonging to Y280 Lineage |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1546658A (en) * | 2003-12-02 | 2004-11-17 | 中国农业科学院哈尔滨兽医研究所 | Artificially recombinant H9N2 hypotype influenza virus and its uses |
| CN103614345A (en) * | 2013-11-19 | 2014-03-05 | 中国农业大学 | Influenza virus vaccine strain |
-
2014
- 2014-09-25 CN CN201410497260.4A patent/CN104611299B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1546658A (en) * | 2003-12-02 | 2004-11-17 | 中国农业科学院哈尔滨兽医研究所 | Artificially recombinant H9N2 hypotype influenza virus and its uses |
| CN103614345A (en) * | 2013-11-19 | 2014-03-05 | 中国农业大学 | Influenza virus vaccine strain |
Non-Patent Citations (3)
| Title |
|---|
| hemagglutinin precursor;Perez,D.R.;《GenBank：AAO46083.1》;20030303;origin * |
| neuraminidase;Baranovich, T.;《GenBank：AGO17873.1》;20140522;origin * |
| 利用反向遗传技术构建高细胞适应性的H9N2流感病毒;任超超;《中国动物传染病学报》;20140430;第22卷(第2期);1-5,10 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104611299A (en) | 2015-05-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101715487A (en) | influenza b viruses having alterations in the hemaglutinin polypeptide | |
| CN104232594B (en) | Recombination classes fowl type H1N1 inactivated influenza virus vaccines strain (JS40/PR8) and its preparation method and application | |
| CN108567974A (en) | A kind of inactivated vaccine and preparation method thereof of the novel goose astrovirus of prevention | |
| CN101508978B (en) | Separation identification and purification process for chicken source H9N2 avian influenza virus strain and uses thereof | |
| CN106390112A (en) | Preparation method for triple inactivated vaccine of recombinant Newcastle disease, bird flu and infectious bronchitis | |
| CN108728419A (en) | Express aviadenovirus penton Protein reconstitutions newcastle disease vaccine Candidate Strain rAI4-penton and construction method | |
| CN105886529A (en) | Preparation method and application of recombinant cold-adaptation attenuated influenza vaccine strain | |
| US11607448B2 (en) | Whole avian-origin reverse genetic system and its use in producing H7N9 subtype avian influenza vaccine | |
| Qian et al. | The immune response of a recombinant fowlpox virus coexpressing the HA gene of the H5N1 highly pathogenic avian influenza virus and chicken interleukin 6 gene in ducks | |
| US20140286979A1 (en) | Canine influenza recombinant virus, preparation method therefor and application thereof | |
| CN103328629A (en) | Novel vaccines against the a/H1N1 pandemic flu virus | |
| CN104611299B (en) | H9N2 avian flus strain, preparation method, vaccine combination and its application of a kind of artificial recombination | |
| CN105695491A (en) | Preparing method for Newcastle disease glycoprotein viral antigen and product of preparing method | |
| CN104353070B (en) | Genetic engineering subunit vaccine of chicken infectious bronchitis virus and preparation method thereof | |
| CN108888761B (en) | Recombinant baculovirus inactivated vaccine for expressing H7N9 subtype avian influenza virus hemagglutinin protein and preparation method and application thereof | |
| CN105671002B (en) | The building of H9N2 subtype avian influenza virus cell high yield vaccine strain and application | |
| RU2736786C1 (en) | Strain "a/chicken/primorsk/419/2018 h9n2" of avian influenza virus of genus alphainfluenzavirus type influenza a virus subtype h9 for controlling antigenic and immunogenic activity of vaccines for avian influenza and for making biopreparations for diagnosis and specific prevention of avian influenza type a subtype h9 | |
| WO2011134163A1 (en) | Preparation method for inactivated vaccine of h9n2 subtype avian influenza and the product thereof | |
| CN102796708A (en) | Method for proliferating influenza A viruses | |
| CN104073470A (en) | Spinner-flask culture method for H9N2 subtype of avian influenza virus | |
| CN102526718B (en) | Recombinant H5N1 (Hemagglutinin 5 Neuraminidase 1) avian influenza virus cell vaccine and application thereof | |
| US11512117B1 (en) | Whole avian-origin reverse genetic system and recombinant H5N2 subtype avian influenza virus, vaccine and uses thereof | |
| CN104274829B (en) | A kind of vaccine combination and its preparation method and application | |
| CN103614345A (en) | Influenza virus vaccine strain | |
| CN103333916A (en) | Construction method and application of BHK cell line suitable for newcastle disease virus proliferation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |