CN105671002B - The building of H9N2 subtype avian influenza virus cell high yield vaccine strain and application - Google Patents
The building of H9N2 subtype avian influenza virus cell high yield vaccine strain and application Download PDFInfo
- Publication number
- CN105671002B CN105671002B CN201510648976.4A CN201510648976A CN105671002B CN 105671002 B CN105671002 B CN 105671002B CN 201510648976 A CN201510648976 A CN 201510648976A CN 105671002 B CN105671002 B CN 105671002B
- Authority
- CN
- China
- Prior art keywords
- avian influenza
- influenza virus
- strain
- vaccine
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to animal vaccine preparation technical fields.It constructs and applies more particularly to H9N2 subtype avian influenza virus cell high yield vaccine strain.The vaccine strain is to screen to obtain by induced mutations by bird flu separation strains.The vaccine strain is named as H9N2 subtype avian influenza virus W1-HA358 strain, and original separation strains are A/duck/Hubei/W1/2004 (H9N2)) strain.To the 3 of the end HA gene noncoding region 3' of the separation strains, 5,8 sites have carried out artificial rite-directed mutagenesis, save out mutant strain using reverse genetic manipulation, mutant strain obtains the strain of high proliferation titre after being passaged to stabilization on mdck cell, obtains H9N2 subtype avian influenza virus cell vaccine.The present invention solves H9N2 avian influenza virus and is proliferated instability problem on mdck cell, overcomes the shortage problem of a large amount of chicken embryos when Avian Influenza, improves the preparation efficiency of vaccine.
Description
Technical field
The invention belongs to animal vaccine preparation technical fields.More particularly to one plant of H9N2 subtype avian influenza virus cell high yield
Vaccine strain building and application.
Background technique
H9N2 subtype avian influenza (Avian influenza, AI) is to cause a kind of biography after infecting poultry by influenza A
Metachromia syndrome, worldwide wide-scale distribution, seriously threatens the development of animal husbandry.It is detected from turkey for the first time within 1966
H9N2 hypotype AIV, hereafter, AIV wide-scale distribution in birds are popular.1994, China reports for the first time to be divided from the chicken house of Guangdong
From H9N2 hypotype AIV is arrived, and hereafter H9N2 hypotype AIV is always in the feeding fowl area wide-scale distribution in China.Although H9N2 hypotype AIV
Belong to low pathogenicity AIV, but now research shows that it can be with infecting mouse, ferret and the mankind.In addition to this, can cause
The decline of fowl laying rate, the mixing or secondary infection for causing immunosupress and exciting other viruses or bacterium, to the feeding fowl in China
Industry causes serious economic loss.And the internal gene of H5N1 influenza virus is likely to constitute the internal gene of H9N2, this
Cause great attention of the people to H9N2 avian influenza virus.1999, people has occurred in Hong-Kong and infects H9N2 hypotype AIV
Event.Again in December, 2009, Hong Kong detects H9N2AIV the 7th time on the person.This show H9N2AIV can from birds to
Mammal is propagated across species barrier, to expand host range.2013, H7N9 avian flu had occurred in China
Poison infection occurrences in human life part, causes 134 people infection and 45 people dead.Until on 2 23rd, 2014, a total of 213 people infects 66 people
It is dead.It is shown according to avian influenza virus genome alignment and parentage analysis, 6 genetic fragments of H7N9 virus derive from
H9N2AIV.This shows that H9N2 is likely to become a kind of virus popular in the future, it should cause the attention of height.Therefore, in order to
The sound development of human health and livestock economy, it is necessary to reinforce the prevention and control to H9N2 hypotype AIV.
Vaccine inoculation is that pre- avian influenza-prevention occurs and propagates most effective means.Till now from flu outbreak in 1878, chicken
Embryo inactivated vaccine is always one of the important vaccine that pre- avian influenza-prevention occurs.Currently, the H9N2 hypotype AIV vaccine that China uses
It is chick embryo allantoic liquid inactivated vaccine.Chicken embryo is the main material of avian influenza vaccine production and research.Although chicken embryo inactivated vaccine has
There is the advantages that convenient transportation, preparation process is simple, safety and stability, but there is also following many disadvantages for chick embryo culture influenza virus
End: (one) when influenza large-scale outbreak, it is very difficult for collecting 9-10 days instar chicken embryos in a short time.(2) chick embryo culture is used
Influenza virus is easy to produce the residual of largely discarded chicken embryo and its virus, is discharged into very big to environmental hazard in nature.(3)
It is influenced by maternal antibody；(4) high production cost, periodically it is long the disadvantages of.A large amount of chicken embryos when in order to overcome Avian Influenza
Shortage problem and production cycle long disadvantage viral internal gene is transformed, improves by utilizing reverse genetics manipulation technology
Viral titer of the H9N2 avian influenza virus in mdck cell.AIV vaccine is produced with chicken embryo with the method substitution of cell culture AIV
Method, change traditional method, improve H9N2 subtype avian influenza vaccine inactivation immunogenic production process.
Summary of the invention
It is an object of the invention to overcome the conventional method for using chick embryo culture avian influenza virus now, one kind is obtained thin
Stablize proliferation and the cell vaccine with high virus titer on born of the same parents.
Technical scheme is as follows:
The original separation strains H9N2 avian flu strain A/duck/ of the vaccine strain of H9N2 bird flu cell vaccine of the invention
It is isolated [referring to Xiao-Juan Xu, Gao- in Hubei chicken house that Hubei/W1/2004 (H9N2) is applicant 2004
Yuan Xu,Hong‐Bo Zhou,Zheng‐Jun Yu.Evolutionary characterization of influenza
virus A/duck/Hubei/W1/2004(H9N2)isolated from central ChinaVirus
Genes.2008Feb；36(1):79‐83.Epub 2007Nov 20]；It will be in A/chicken/Hubei/W1/2004 (H9N2)
8 internal gene fragments (its nucleic acid sequence has been incorporated in NCBI), be cloned into transcription/expression vector pWH2000 respectively
Upper (St.Jude child study hospital, U.S. doctor Webster give), building obtain 8 plasmids.Construct the inside base of W1 strain
The carrier of cause be respectively designated as PWH2000-PB2, PWH2000-PB1, PWH2000-PA, PWH2000-NP, PWH2000-NA,
PWH2000-HA, PWH2000-M, PWH2000-NS, the base that will be wherein named as 3,5,8 site of PWH2000-HA plasmid carry out
Artificial mutation (mutation direction are as follows: G3 → A3, U5 → C5 and C8 → U8), building obtains a mutant plasmid, then using reversed
Genetic Manipulative Technology, by the internal influenza genetic fragments of the mutant plasmid and remaining 7, by remaining 7 plasmid built of W1 and
Mutant plasmid cotransfection 293T+MDCK cell mixing, rescue obtain H9N2 avian influenza virus mutant strain W1-HA358, will be described
H9N2 avian flu mutant strain W1-HA358 is passed on mdck cell, is obtained high value-added titre and is stablized cell adapted poison
Strain detects its immunogenicity as oil emulsion inactivated vaccine after being inactivated, it was demonstrated that constructing resulting vaccine strain has good be immunized
Originality.
The cell adapted strain was named as H9N2 subtype avian influenza virus W1-HA358 strain by applicant, in 2015 6
The moon delivers the China typical culture collection center preservation of the Chinese Wuhan Wuhan University on the 11st, deposit number are as follows: CCTCC NO:
V201522。
Compared with prior art, it is an advantage of the invention that；
(1) present invention is using avian influenza virus H9N2 as background, by the base in 3,5,8 sites at the end 3' of HA gene into
Row artificial mutation, then saves and obtains mutant strain.The mutant strain has better adaptability on mdck cell, improves
Virus titer.
(2) mutant strain prepared by the present invention passes on the cell adapted strain for obtaining high proliferation titre on mdck cell,
Be conducive to need a large amount of chicken embryos and chicken embryo shortage problem when alleviating Avian Influenza.
More detailed technical solution reference is shown in shown in " specific embodiment ".
Detailed description of the invention
Sequence table SEQ ID NO:1 is H9N2 bird flu separation strains A/chicken/Hubei/W1/2004 (H9N2) internal
The DNA sequence dna of gene HA, sequence length 1472bp.
Sequence table SEQ ID NO:2 is H9N2 bird flu separation strains A/chicken/Hubei/W1/2004 (H9N2) internal
The DNA sequence dna of gene NA, sequence length 1457bp.
Sequence table SEQ ID NO:3 is H9N2 bird flu separation strains A/chicken/Hubei/W1/2004 (H9N2) internal
The DNA sequence dna of gene M gene, sequence length 1027bp.
Sequence table SEQ ID NO:4 is H9N2 bird flu separation strains A/chicken/Hubei/W1/2004 (H9N2) internal
The DNA sequence dna of gene NP, sequence length 1565bp.
Sequence table SEQ ID NO:5 is H9N2 bird flu separation strains A/chicken/Hubei/W1/2004 (H9N2) internal
The DNA sequence dna of gene NS gene, sequence length 890bp.
Sequence table SEQ ID NO:6 is H9N2 bird flu separation strains A/chicken/Hubei/W1/2004 (H9N2) internal
The DNA sequence dna of gene PA, sequence length 2233bp.
Sequence table SEQ ID NO:7 is H9N2 bird flu separation strains A/chicken/Hubei/W1/2004 (H9N2) internal
The DNA sequence dna of gene PB1, sequence length 2341bp.
Sequence table SEQ ID NO:8 is H9N2 bird flu separation strains A/chicken/Hubei/W1/2004 (H9N2) internal
The DNA sequence dna of gene PB2, sequence length 2341bp.
Sequence table SEQ ID NO:9 is the DNA sequence dna for expanding the universal primer Uni12 of related gene.
Sequence table SEQ ID NO:10 is the upstream primer for expanding the primer pair of HA gene (accession number: DQ465400.1).
Sequence table SEQ ID NO:11 is the downstream primer of the primer pair of HA gene (accession number: DQ465400.1).
Sequence table SEQ ID NO:12 is the upstream primer for expanding the primer pair of NA gene (accession number: DQ465402.1).
Sequence table SEQ ID NO:13 is the downstream primer for expanding the primer pair of NA gene (accession number: DQ465402.1).
Sequence table SEQ ID NO:14 is the upstream primer for expanding the primer pair of M gene (accession number: DQ465403.1).
Sequence table SEQ ID NO:15 is the downstream primer for expanding the primer pair of M gene (accession number: DQ465403.1).
Sequence table SEQ ID NO:16 is the upstream primer for expanding the primer pair of NP gene (accession number: DQ465401.1).
Sequence table SEQ ID NO:17 is the downstream primer for expanding the primer pair of NP gene (accession number: DQ465401.1).
Sequence table SEQ ID NO:18 is the upstream primer for expanding the primer pair of NS gene (accession number: DQ465404.1).
Sequence table SEQ ID NO:19 is the downstream primer for expanding the primer pair of NS gene (accession number: DQ465404.1).
Sequence table SEQ ID NO:20 is the upstream primer for expanding the primer pair of PA gene (accession number: DQ465399.1).
Sequence table SEQ ID NO:21 is that the downstream for the primer pair pair for expanding PA gene (accession number: DQ465399.1) is drawn
Object.
Sequence table SEQ ID NO:22 is the upstream primer for expanding the primer pair of PB1 gene (accession number: DQ465398.1).
Sequence table SEQ ID NO:23 is the downstream primer for expanding the primer pair of PB1 gene (accession number: DQ465398.1).
Sequence table SEQ ID NO:24 is the upstream primer for expanding the primer pair of PB2 gene (accession number: DQ465397.1).
Sequence table SEQ ID NO:25 is the downstream primer for expanding the primer pair of PB2 gene (accession number: DQ465397.1).
Fig. 1: being PHW2000 original plasmid map involved in the present invention.The plasmid is for constructing reverse genetic manipulation
8 plasmids original plasmid.
Fig. 2: each segment cDNA clone of influenza virus to pHW2000 vector construction schematic diagram.
Fig. 3: influenza virus HA3-5-8 mutation construction schematic diagram.
Fig. 4: being the PCR figure the present invention relates to W1 strain complete genome sequence clone.Description of symbols: swimming lane is from left to right
Successively are as follows: DL15000marker；PB2,PBI,PA；DL2000marker；HA,NP,NA；DL2000marker；M, NS.
The PCR of Fig. 5: HA gene (number of logging in: DQ465400) 3-5-8 site mutation schemes.Description of symbols: swimming lane is successively
Are as follows: Plus 2000marker；The plasmid amplification electrophoresis result of PHW2000-HA3-5-8.
Fig. 6: being the result that mutant strain prepared by the present invention is proliferated passage on mdck cell.
Specific embodiment
Embodiment 1: the complete genome infectious clone of avian influenza virus separation strains A/chicken/Hubei/W1/2004 strain
1, the extraction of avian influenza virus separation strains A/chicken/Hubei/W1/2004RNA
Spare chick embryo allantoic liquid avian influenza virus separation strains A/chicken/Hubei/W1/ is taken out from -80 DEG C of refrigerators
2004 (referred to as viruses), [referring to: Xiao-Juan Xu, Gao-Yuan Xu, Hong-Bo Zhou, Zheng-Jun
Yu.Evolutionary characterization of influenza virus A/duck/Hubei/W1/2004
(H9N2)isolated from central ChinaVirus Genes.2008 Feb；36(1):79-83.Epub
2007Nov 20] it is placed in and dissolves at room temperature, take 300 μ L virus liquids to be added to equipped in 1mL Trizol 1.5mL EP pipe, gently
Turn upside down, be placed on ice bath 15min on ice；Then 200 μ L chloroforms are added, is vortexed with oscillator and mixes 15s, place quiet on ice
10min is set, with 4 DEG C, 12000r/min is centrifuged 10min, and supernatant (avoiding being drawn onto white precipitate) is taken to move into a new 1.5mLEP
Pipe, adds isometric isopropanol, and mixings of turning upside down is placed at room temperature for 10min, room temperature 12000r/min centrifugation 10min, in abandoning
Clearly, add 75% ethyl alcohol of 1mL, room temperature 12000r/min is centrifuged 10min, inhales and abandons ethyl alcohol, and EP pipe is placed in super-clean bench and is air-dried, most
RNA precipitate is dissolved in the DEPC water of 10 μ l afterwards, set -80 DEG C save backup (it is general preferable using inversion effect immediately, avoid RNA
By the RNA enzyme degradation in air).
2, design of primers synthesizes
It is as follows for the universal primer that expands all 8 full-length gene segments of influenza A.Primer is given birth to by Shanghai
The synthesis of object Engineering Co., Ltd, the nucleotide sequence of specific primer are as follows:
Reverse transcription universal primer Uni12primer:5 ' AGCAAAAGCAGG 3 ' (SEQ ID NO:9)
(1) primer pair of HA gene (accession number: DQ465400.1) is expanded:
5 ' TATTCGTCTCAGGGAGCAAAAGCAGGGG 3 ' (SEQ ID NO:10) of P1
5 ' ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT 3 ' (SEQ ID NO:11) of P2
(2) primer pair of NA gene (accession number: DQ465402.1) is expanded:
5 ' TATTCGTCTCAGGGAGCAAAAGCAGGAGT 3 ' (SEQ ID NO:12) of P1
5 ' ATATCGTCTCGTATTAGTAGAAACAAGGAGTTTTTT 3 ' (SEQ ID NO:13) of P2
(3) primer pair of M gene (accession number: DQ465403.1) is expanded:
5 ' TATTCGTCTCAGGGAGCAAAAGCAGGTAG 3 ' (SEQ ID NO:14) of P1
5 ' ATATCGTCTCGTATTAGTAGAAACAAGGTAGTTTTT 3 ' (SEQ ID NO:15) of P2
(4) primer pair of NP gene (accession number: DQ465401.1) is expanded:
5 ' TATTCGTCTCAGGGAGCAAAAGCAGGGTA 3 ' (SEQ ID NO:16) of P1
5 ' ATATCGTCTCGTATTAGTAGAAACAAGGGTATTTTT 3 ' (SEQ ID NO:17) of P2
(5) primer pair of NS gene (accession number: DQ465404.1) is expanded:
5 ' TATTCGTCTCAGGGAGCAAAAGCAGGGTG 3 ' (SEQ ID NO:18) of P1
5 ' ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT 3 ' (SEQ ID NO:19) of P2
(6) primer pair of PA gene (accession number: DQ465399.1) is expanded:
5 ' TATTCGTCTCAGGGAGCAAAAGCAGGTAC 3 ' (SEQ ID NO:20) of P1
5 ' ATATCGTCTCGTATTAGTAGAAACAAGGTACTT 3 ' (SEQ ID NO:21) of P2
(7) primer pair of PB1 gene (accession number: DQ465398.1) is expanded:
5 ' TATTCGTCTCAGGGAGCAAAAGCAGGCA 3 ' (SEQ ID NO:22) of P1
5 ' ATATCGTCTCGTATTAGTAGAAACAAGGCATTT 3 ' (SEQ ID NO:23) of P2
(8) primer pair of PB2 gene (accession number: DQ465397.1) is expanded:
5 ' TATTCGTCTCAGGGAGCAAAAGCAGGTC 3 ' (SEQ ID NO:24) of P1
5 ' ATATCGTCTCGTATTAGTAGAAACAAGGTCGTTT 3 ' (SEQ ID NO:5) of P2
3, avian influenza A/chicken/Hubei/W1/2004 viral RNA reverse transcription
It is carried out in 20 μ l reverse transcription systems, sequentially adds component as described in Table 1, mixed in postposition PCR instrument in 42 DEG C
Reverse transcription reaction 60min is carried out, reaction product is directly used in PCR or is placed in 4 DEG C and saves backup.
Table 1: the reverse transcription system of avian influenza virus A/chicken/Hubei/W1/2004 viral RNA
4, the PCR amplification of avian influenza virus A/chicken/Hubei/W1/2004cDNA
Amplification system described in table 2 is added in PCR reaction tube.In being carried out in PCR instrument after configured system is mixed
Amplification.PCR amplification program is 94 DEG C of 5min of initial denaturation, is denaturalized 94 DEG C of 20sec, and anneal 58 DEG C of 30sec, extends 72 DEG C of 5min, is transported
Row 30 circulations, finally extend 10min after 72 DEG C.The negative control of no template is set simultaneously.After reaction, PCR product is each
5 μ l are taken, electrophoretic analysis is carried out on 1.0% Ago-Gel, residue is set 4 DEG C and saved backup.
Table 2: the PCR amplification system of avian influenza virus A/chicken/Hubei/W1/2004cDNA
| Trans-T DNA | 1.0μl |
| dNTP Mixture | 2.0μl |
| PCR Buffer | 5.0μl |
| P1(10μm) | 2.0μl |
| P2(10μm) | 2.0μl |
| CDNA template | 2.0μl |
| RNase freed H2O | 36.0μl |
| React total volume | 50 μ l/ samples (Sample) |
5, the recycling and purifying of PCR product
The Ago-Gel for cutting target DNA fragment after electrophoresis from gel under ultraviolet light is quickly recycled with DNA
Kit (being purchased from Shanghai Sheng Gong bioengineering Co., Ltd) recycling DNA.The specific method is as follows: target DNA recycling segment is cut,
It is put into the EP pipe of a sterile 1.5mL, 500-750 μ l Binding Buffer is added, in 50-60 DEG C of water-bath 5min, therebetween
EP pipe is flicked, dissolves gel completely.Then the liquid dissolved is gone into a recovery column, in being stored at room temperature 2min, 8000r/
Min is centrifuged 1min, outwells the waste liquid in collecting pipe, with 500 μ lWashing solution 8000r/min, is centrifuged 1min, washes
Twice；Last 12000r/min is centrifuged 15s, and recovery column is gone in a clean 1.5mL EP pipe, 10-20 μ l ddH is added2O is washed
De-, in being placed at room temperature for 5min, 12000r/min is centrifuged 1min, is the DNA fragmentation of recycling in collecting pipe, can be directly used for DNA
Connection, can also save backup in -20 DEG C.
6, connection reaction
The PCR product of recycling is attached directly to pMD18-T carrier (purchased from precious bioengineering Dalian Co., Ltd), connector
System such as table 3.After system configurations are good, linked system is put in 16 DEG C of water-baths and is connected overnight.
3 linked system of table
| pMD18-T vector DNA | 1.0μl |
| Ligation Solution I | 9.0μl |
| PCR recovery product | 10.0μl |
| React total volume | 20 μ l/ samples (Sample) |
7, the conversion of connection product
The freshly prepared competent cell DH5 α of 100 μ l is taken to be placed on ice.10 μ l connection products, after mixing, ice bath are added
30min.42 DEG C of heat shock 90s, ice bath 2min are allowed to cooling.400 μ l LB mixing, 220r/min, 37 DEG C of shaking table cultures are added
It is centrifuged 5 minutes after 45min in 5000r/min, inhales and abandon 300 μ l supernatants, drawn 200 μ l culture solutions after thallus is resuspended, be coated with resistance
On plate.37 DEG C of culture 10h-12h may occur in which single colonie.
8, PCR identifies positive recombinant plasmid
The program of PCR screening positive clone is as follows: taking EP pipe 8-12 of the 0.5ml of sterilizing, is successively added in every pipe
The sterilizing distilled water of 30 μ l.With the single colonie on sterilizing pipette tips scraping plate, pressure-vaccum is several times suspended in thallus double in EP pipe
It steams in water.Each sample is sterile to take 10 μ l thallus suspensions in case further expansion culture use, remaining 20 μ l boiling water water-bath
10min, 12000r/min are centrifuged 5min, and 5 μ l of supernatant is taken to make pcr template.PCR amplification goes out the sample of expected purpose segment, takes it
Corresponding thallus suspension expands culture, and preparation plasmid order-checking is used.Program phase for the PCR program with amplification of the identification gene
Together, specific PCR system such as table 4.
4 PCR identification system of table
| Trans-Taq DNA | 0.5μl |
| dNTP Mixture | 1.0μl |
| Trans-Taq PCR Buffer | 2.0μl |
| P1(10μm) | 1.0μl |
| P2(10μm) | 1.0μl |
| Template | 5.0μl |
| RNase freed H2O | 9.5μl |
| React total volume | 20 μ l/ samples (Sample) |
8 genes of the positive colony that above-mentioned screening is obtained, 4 samples of each gene selects serve the raw work biology work in sea
Journey Co., Ltd is sequenced, and is then compared using sequence of the software DNAStar4.0 to sequencing.
9, plasmid is small mentions
Using plasmid extraction kit (being purchased from Beijing Quanshijin Biotechnology Co., Ltd)
(1) single bacterium colony converted on random picking plate, be seeded to 5mL containing antibiotic (Amp, it is final concentration of 0.1%)
LB culture solution in, 37 DEG C of 300r/min shaken cultivations are stayed overnight；
(2) it takes 2mL bacterium solution to be added in a new EP pipe, 2min is centrifuged with 12000r/min, collects thallus, until culture
Liquid has been collected, and is discarded supernatant, and precipitating is collected；
(3) 250 μ L P1 solution (kit is included) (use preceding addition RnaseA, be put in 4 DEG C of refrigerators and save) weight is added
Outstanding bacterial sediment, until thallus is thoroughly resuspended uniformly；
(4) 250 μ L P2 solution (kit is included) is added, then leniently spins upside down 4-7 uniformly mixing, makes bacterium
Body cracks completely, is placed at room temperature for；
(4) 350 μ L P3 solution (kit is included) is added, leniently spins upside down 4-7 times immediately and is uniformly mixed, until
Occur white flock precipitate, to liquid color by yellow be it is transparent；Then it is centrifuged at room temperature with 12000r/min
10min carefully draws supernatant, sucking precipitating of trying not；
(5) supernatant obtained by previous step is added in adsorption column (adsorption column has been put into collecting pipe), is stood at room temperature
Then 2min is centrifuged 60s with 12000r/mim, outwells the waste liquid in collecting pipe.If gained supernatant volume is greater than 750 μ L, can
It to be added in adsorption column several times, is centrifuged again, outwells waste liquid；
(6) the Washing Buffer of 600 μ L is added into adsorption column, 1min is centrifuged with 12000r/mim, outwells collection
Waste liquid in pipe；
(7) step (6) are repeated；
(8) adsorption column is placed again into collecting pipe, 12000r/min is centrifuged 2min, completely removes Washing as far as possible
Buffer, in case residual ethanol therein influences；
(9) adsorption column is taken out, is put into a clean new EP pipe, is vacantly added in the middle section of adsorbed film and adds 20-
50 μ L elution buffer (Elution buffer；The source of elution buffer provides its formula and configuration method, uses elution
It is more preferable that effect is eluted before buffer after 65-75 DEG C of heating water bath), it is placed at room temperature for 2min, 3min is centrifuged with 12000r/min,
Collect Plasmid DNA；
(10) it is saved backup after taking 0.1 μ L DNA plasmid UV spectrophotometer measuring concentration in -20 DEG C.
10, the building of PHW2000 recombinant plasmid
The plasmid of said extracted is subjected to digestion, while with BsmBI linearized vector pHW2000 (U.S. St.Jude children
Research hospital doctor Webster give, and plasmid map is as shown in Figure 1).Wherein PB1, PA, HA, NA, M and NS genetic fragment (piece
Duan Xulie is with sequence shown in " Detailed description of the invention ") BsmBI digestion is used, the carrier pHW2000 of collinearity is connected after recycling.With
After BsmBI digestion PB2 genetic fragment, 1.9kb and two band of 0.4kb are generated；With BsaI digestion NP genetic fragment generate 1.1kb and
Two band of 0.4kb.Carrier pHW2000 after two bands are recycled together respectively with linearisation is connected, and connects to three segments
It connects.5 α competent cell of Escherichia coli DH is converted with connection product, picking single bacterium colony after conversion shakes bacterium, small upgrading grain.With
Digestion and PCR method (using conventional method) are come screening positive clone.Resulting positive clone molecule is served into the raw work biology in sea
Prove that sequence connection is correct after Engineering Co., Ltd's identification.
11, result
(1) W1 strain genome cloning
Using 8 pairs of primer amplification whole genome sequences disclosed in step 2 (design of primers synthesis) (PB1, PB2, PA, HA,
NP, NA, M, NS) target gene, obtain 8 segments of W1 influenza virus pnca gene, clip size be successively be about 2.3kb,
2.3kb, 2.2kb, 1.7kb, 1.5kb, 1.4kb, 1.0kb and 0.9kb (as shown in Figure 2).
Construct PHW2000-HA358 mutant plasmid
The primer of HA3-5-8 site mutation, such as 5 institute of the nucleotide sequence of primer are synthesized by Shanghai bioengineering Co., Ltd
Show:
The primer of 5 HA3-5-8 site mutation of table
Design a pair has the primer of 10 base reverse complementals containing catastrophe point, as described in Table 5.It is polymerize with the DNA of high-fidelity
The full Plasmid DNA of primerStar PCR amplification (HA-PHW2000) runs glue identification (result is shown in Fig. 3), with DpnI enzymatic treatment 3.5h
The template plasmid that do not methylate is removed, several bacterium colonies sequencing identification mutational sites are chosen after conversion.PCR system such as table 6:
6 PCR system of table
| primerstar Taq DNA | 1.0μl |
| dNTP Mixture | 2.0μl |
| primerstar PCR Buffer | 5.0μl |
| P1(10μm) | 2.0μl |
| P2(10μm) | 2.0μl |
| Template | 1.0μl |
| RNase freed H2O | 37.0μl |
| React total volume | 50 μ l/ samples (Sample) |
Embodiment 2: the rescue of mutant strain W1-HA358 avian influenza virus and its Observation of biological characteristics
1, the extraction of endotoxin plasmid is gone
The small extraction reagent kit of the ultrapure plasmid of endotoxin-free (the Endo-free Plasmid Mini produced using Omega company
Kit II) extract plasmid.Specific step is as follows:
(1) by pHW2000-PB1, pHW2000-PB2, pHW2000-PA, pHW2000-HA358, pHW2000-NA,
The Escherichia coli bacteria liquid that pHW2000-NP, pHW200-M, pHW2000-NS eight plasmids built save is inoculated in 100mL
LB liquid medium in, be then incubated overnight Escherichia coli 12-16h in 37 DEG C of shaking tables.
(2) all 100mL bacterium solutions are added in 50mL centrifuge tube, trim, at 4 DEG C, 12000r/min centrifugation 8min is discarded
Culture medium supernatant collects thallus.
(3) supernatant is abandoned, appropriate physiological saline is added into precipitating or thallus is resuspended in PBS, is dispensed into the EP pipe of 2mL,
At 4 DEG C, 12000r/min centrifugation 2min discards culture medium supernatant, collects thallus.
(4) supernatant is abandoned, thallus is resuspended in the SolutionI solution (RNaseA is added) that 500 μ L are added.
(5) the SolutionII solution of 500 μ L is added, is gently mixed by inversion 7-10 times, (in advance will until supernatant is limpid
Buffer N3 is placed on ice, and centrifuge is cooled to 4 DEG C.
(6) the Buffer N3 (kit included) of 250 μ L ice baths is added, and leniently turns upside down centrifuge tube for several times extremely
Until white flock precipitate is formed (being uncracked thallus if there is yellow block on upper layer), then at 4 DEG C, 12000r/
Min is centrifuged 10min.
(7) supernatant is transferred in the EP pipe of new 1.5mL, again with 4 DEG C, 12000r/min is centrifuged 2min.
(8) supernatant is transferred in the EP pipe of new 1.5mL, the ETR of 0.1 times of volume is added, be placed on ice after mixing gently
Upper 10min, every 2min it is reverse several times (ETR is blue solution, loaded in white bottle, being stored in 4 DEG C of refrigerators, this liquid compared with
It is sticky, absorption slowly, for removing endotoxin).
(9) after placing on ice, liquid is limpid, then is put into 5min in 42 DEG C of water-baths, and liquid becomes cloudy again at this time,
10min is centrifuged with 12000r/min at room temperature, ETR is sunken to tube bottom at this time.
(10) supernatant is transferred in new 2mL EP pipe, the dehydrated alcohol of 0.5 times of volume is added, mixed, stand 2min；
(11) 200-300 μ L buffer GPS infiltration is added in HiBind DNA Min column in advance, 5min is stood,
30-60s is centrifuged with 12000r/min at room temperature, outwells the liquid in collecting pipe；
(12) solution in step (10) is transferred to the new HiBind DNA Min column infiltrated, every time 700 μ L, stood
2min is centrifuged 30-60s with 12000r/min；
(13) discard the liquid in collecting pipe, 500 μ L buffer HB be added and wash pillar, at room temperature with 12000r/min from
Heart 30-60s；
(14) liquid in collecting pipe is discarded, 700 μ L elution buffers (washing buffer) (adding ethyl alcohol) are added and wash
Pillar is centrifuged 30-60s at room temperature with 12000r/min；
(15) step (14) are repeated；
(16) pillar is placed back in collecting pipe, 2min is centrifuged with 12000r/min at room temperature；
(17) pillar is put into new 1.5mL EP pipe, is put in 5min in 42 DEG C of incubators, while endotoxin-free being eluted
Buffer (Endo-free Elution buffer) is put into baking oven；
(18) take 70-100 μ L EB eluent, be added to pillar center, stand 2min, at room temperature with 12000r/min from
Heart 2min；
(19) it after taking 0.1 μ L DNA plasmid UV spectrophotometer measuring concentration, is protected in -20 DEG C or -80 DEG C of refrigerators
It deposits spare.
2, the transfection preparation of cell
(1) MDCK is cultivated respectively with the DMEM culture medium (buying from Thermo company) containing 10% fetal calf serum (FBS)
Cell and 293T cell are digested with 0.25% pancreatin after cell covers with single layer, after cell is dispelled, access appropriate cell
Into 6 hole tissue culturing plates.
(2) wherein 293T+MDCK cell co-cultivation group by cells ratio 1:1 meets 6 hole tissue culturing plates, to cell density
It is long to 80%-90% when transfected.Wherein, as the cell of transfection, state is had to excellent, could only in this way be provided
Sufficient enzyme is for needed for genetic transcription.
3, the cotransfection of eight plasmids
The method of 10 μ L liposome (lipofectin) transfection reagent by specification introductions is diluted to the training of 90 μ L serum-frees
Support in base OPTI-MEM (be purchased from GIBCO company), be placed at room temperature for 5min, separately by 2-3 μ g mixing plasmid (containing PB2:PB1:PA:HA:
NP:NA:M:NS (concentration ratio is 1:1:0.5:1:1:1:1:1) is diluted to 100 μ l serum free medium OPTI-MEM and (is purchased from
GIBCO company) in.Then diluted liposome (lipofectin) (being purchased from Invitrogen company) is slowly added dropwise to mixing
In plasmid, gently pressure-vaccum more than 10 times, are mixed well, room temperature combination 20min, at the same set lipofectin control, missing one or
The control of several plasmids.About 18-24h will be cultivated in 6 hole tissue culturing plates, 80%-90% abundance is evenly distributed, grows shape
The good 293T+MDCK cell of condition.After being washed twice with the DMEM culture medium of serum-free, antibiotic-free, then with OPTI-MEM culture medium
It washes once, is eventually adding 500 μ L OPTI-MEM culture mediums (purchased from GIBCO company) and is covered on cell；Be added plasmid with
The conjugate (totally 200 μ l) of lipofectin (be purchased from Invitrogen company), makes its uniform fold on cell, at 37 DEG C,
5%CO2Adsorb 8h in incubator, (PBS is with phosphate buffer after DMEM culture medium 1mL, 30h of the change containing 10% serum
Common buffer) it washes twice, it is eventually adding (limited purchased from the raw work bioengineering in Shanghai containing final concentration of 2.5 μ g/mLTPCK pancreatin
Company) plasma-free DMEM medium 1mL, 72h after carefully blow off cell, collected together with supernatant.
4, the proliferation and identification of W1-HA358 avian influenza virus
Suitable dual anti-(ammonia benzyl mycin 50mg/ml and kanamycins will be added in the cell and supernatant collected after transfection
50mg/ml), (logical dynamic purchased from Beijing Cimmeria dimension with the SPF chicken embryo of the amount inoculation 9-11 age in days of 0.2ml/ embryo after mixing well
Object experimental technique Co., Ltd), 37 DEG C of cultures are set, the daily death condition for observing chicken embryo collects chick embryo allantoic liquid, then in due course
Its HA-HI test is surveyed with red blood cell, is stored in -80 DEG C of refrigerators.The blind passage three generations in chicken embryo makes W1-HA358 avian influenza virus exist
Stable proliferation thereon.
5, the cell infection experiment and its passage on mdck cell of W1-HA358 avian influenza virus
It will pass on, the cell dispelled uniformly accessed in 6 hole tissue culturing plates, 37 after mdck cell culture to single layer
DEG C, 5%CO2Culture is to Cell abundance up to 90% or more in incubator.After culture medium in cell is discarded, washed twice with PBS,
After again being washed cell once with the DMEM of serum-free, it is added and is diluted to 10 with DMEM-1Allantoic fluid, in 37 DEG C, 5%CO2Culture
After adsorbing 1h in case, the DMEM maintaining liquid of the serum-free containing 1.0 μ g/ml pancreatin is added, sets 37 DEG C, 5%CO2It is trained in incubator
It supports.Every taking 25 hole μ L supernatants for 24 hours, HA-HI test is measured.With same method, take the W1-HA358 avian influenza virus of previous generation after
Generation is resumed, until W1-HA358 avian influenza virus can stablize proliferation on cell (proliferation results are as shown in Figure 4).
6, avian flu strain W1-358 and bird flu street strain W1 organizes half to cause infective dose (TCID50) measurement
It will be passed on after mdck cell culture to single layer, the cell dispelled uniformly accessed into every hole in tissue culturing plates with 96 hole
100 μ L, at 37 DEG C, 5%CO2Culture is to Cell abundance up to 90% or more in incubator.After culture medium in cell is discarded, use
PBS is washed twice.It is added with taking jelly in -80 DEG C of refrigerator virus allantoic fluids, with plasma-free DMEM medium by avian influenza virus from 10-1
It is diluted to 10-6, each 8 hole of dilution virus inoculation (hole 0.1mL/).Two repetitions are done, 37 DEG C of incubation 72h are put in, are detected
Cell culture medium supernatant HA-HI test calculates median infective dose (result such as table 7 and table 8) by Reed-Muench method formula.
It calculates and is calculated by Reed and Muench method:
Distance proportion=(higher than the percentage -50% of 50% lesion rate)/((percentage-higher than 50% lesion rate is lower than
The percentage of 50% lesion rate)
TCID50Logarithm=be higher than 50% viral dilution logarithm+distance proportion × coefficient of dilution logarithm.
The TCID of 7 bird flu street strain W1 of table50
The TCID of 8 avian influenza virus mutant strain W1-HA358 of table50
7, avian influenza virus chicken embryo median lethal dose (ELD50) measurement
Take jelly in -80 DEG C of refrigerator avian influenza virus allantoic fluids, with sterile PBS by avian influenza virus from 10-2It is diluted to 10-7,
5 pieces of chicken embryos (0.2mL/ pieces) of each dilution virus inoculation, are put in 37 DEG C of incubation 72h, give up in interior dead for 24 hours, so
Chicken embryo is placed on 4 DEG C of refrigerator overnights afterwards, detection allantoic fluid is coagulation, calculates median lethal dose (knot by Reed-Muench method formula
Fruit is shown in Table 9 and table 10).
The ELD of 9 avian influenza virus mutant strain W1-HA358 of table50
The ELD of 10 bird flu street strain W1-358 of table50
Table 9 and table 10 the result shows that, viral dilution 10-5When, the virulence of mutant strain W1-HA358 compares street strain W1-
358 virulence are decreased obviously.
Leading reference
1.Xiao‐Juan Xu,Gao‐Yuan Xu,Hong‐Bo Zhou,Zheng‐Jun Yu.Evolutionary
characterization of influenza virus A/duck/Hubei/W1/2004(H9N2)isolated from
central ChinaVirus Genes.2008Feb；36(1):79‐83.Epub 2007Nov 20
2. extra extra is passed using the H9N2 influenza virus China animal of Reverse Genetics building cell high-adaptability
It catches an illness journal, 2014,22 (2): 7-12
3.Azzeh M etc., Functional analysis of the influenza A virus cRNA
promoter and construction of an ambisense transcription
system.Virology.2001.289,400–410.
4.Baron M D&Barrett T.Rescue of rinderpest virus from cloned
cDNA.Journal of Virology,1997,71,1265-1271
5.Bernadette Crescenzo-Chaigne,Differential Effect of Nucleotide
Substitutions in the 3’Arm of the Influenza A Virus vRNA Promoter on
Transcription/Replication byAvian and Human Polymerase Complexes Is Related
to the Nature of PB2Amino Acid 627.Virology.2002.303,240–252
6.Finch C,Li W,Design of Alternative Live Attenuated Influenza Virus
Vaccines.Influenza Pathogenesis and Control-Volume II.Springer International
Publishing,2015:205-235.
7.John Steel etc. .Live Attenuated Influenza Viruses Containing
NS1Truncations as Vaccine Candidates against H5N1Highly Pathogenic Avian
Influenza..J.Virol.2009,83(4):1742–1753
8.Jad Maamary,Attenuated Influenza Virus Construct with Enhanced
Hemagglutinin Protein Expression.J.Virol.2012,86(10):5782。
Claims (2)
1. the H9N2 subtype avian influenza virus mutant strain W1- using artificial mutation that deposit number is CCTCC NO:V201522
HA358, which is characterized in that 3,5,8 held in the genome of the mutant strain containing Avian Influenza Virus HA Gene noncoding region 3 '
The mutant nucleotide sequence of point, it is specific to be mutated are as follows: the 3rd G sports A (G3 → A3), and the 5th U sports C (U5 → C5) and the 8th
The C of position sports U (C8 → U8), then obtains the non-volume of HA gene by the rescue of 8 plasmid reverse genetic manipulation method of influenza virus
The H9N2 subtype avian influenza virus for 3,5,8 site mutations that code area 3 ' is held.
2. H9N2 subtype avian influenza virus mutant strain W1-HA358 described in claim 1 is preparing answering in avian influenza vaccine
With.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510648976.4A CN105671002B (en) | 2015-10-09 | 2015-10-09 | The building of H9N2 subtype avian influenza virus cell high yield vaccine strain and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510648976.4A CN105671002B (en) | 2015-10-09 | 2015-10-09 | The building of H9N2 subtype avian influenza virus cell high yield vaccine strain and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105671002A CN105671002A (en) | 2016-06-15 |
| CN105671002B true CN105671002B (en) | 2019-08-30 |
Family
ID=56946948
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510648976.4A Active CN105671002B (en) | 2015-10-09 | 2015-10-09 | The building of H9N2 subtype avian influenza virus cell high yield vaccine strain and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105671002B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108913701B (en) * | 2018-08-13 | 2020-08-28 | 中国动物卫生与流行病学中心 | Method for improving multiplication titer of H7N9 subtype avian influenza vaccine strain |
| CN109295011B (en) * | 2018-10-25 | 2020-06-19 | 扬州大学 | Vaccine strain rSN-R92G-E93K and construction method and application thereof |
| CN109880835B (en) * | 2019-03-28 | 2022-03-25 | 扬州大学 | Recombinant H9N2 avian influenza virus strain, preparation method thereof, avian influenza vaccine and application thereof |
| CN110305898A (en) * | 2019-06-18 | 2019-10-08 | 扬州大学 | The rescue of the non-susceptible H9N2 hypotype acclimatization to cold avian influenza virus of mammalian cell |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102526718A (en) * | 2010-12-30 | 2012-07-04 | 华中农业大学 | Recombinant H5N1 (Hemagglutinin 5 Neuraminidase 1) avian influenza virus cell vaccine and application thereof |
| CN104560888A (en) * | 2013-10-21 | 2015-04-29 | 华中农业大学 | Large-scale culture method of H9N2 subtype avian influenza virus |
-
2015
- 2015-10-09 CN CN201510648976.4A patent/CN105671002B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102526718A (en) * | 2010-12-30 | 2012-07-04 | 华中农业大学 | Recombinant H5N1 (Hemagglutinin 5 Neuraminidase 1) avian influenza virus cell vaccine and application thereof |
| CN104560888A (en) * | 2013-10-21 | 2015-04-29 | 华中农业大学 | Large-scale culture method of H9N2 subtype avian influenza virus |
Non-Patent Citations (3)
| Title |
|---|
| Evolutionary characterization of influenza virus A/duck/Hubei/W1/2004 (H9N2) isolated from central China;Xiao-Juan Xu等;《Virus Genes》;20071120;第36卷;第79-83页 * |
| GenBank登录号：DQ465400.1;NCBI;《NCBI GENBANK》;20080226;第1-1742位 * |
| 禽流感病毒A/duck/Hubei/W1/2004(H9N2)的基因组序列分析及其分子进化;徐晓娟等;《第15届世界禽病大会、中国畜牧兽医学会2007年学术年会论文集》;20070930;第193页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105671002A (en) | 2016-06-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111560354B (en) | Recombinant novel coronavirus, preparation method and application thereof | |
| CN105420261B (en) | A kind of heat-resisting remodeling method of newcastle disease virus and application | |
| CN105671002B (en) | The building of H9N2 subtype avian influenza virus cell high yield vaccine strain and application | |
| Choi et al. | Genetic relationship of H3 subtype avian influenza viruses isolated from domestic ducks and wild birds in Korea and their pathogenic potential in chickens and ducks | |
| WO2021051906A1 (en) | Infectious recombinant cloning method for class ii type vii epidemic ndv strain dhn3 | |
| CN109321535A (en) | A kind of heat-staple newcastle disease virus attenuated vaccine Candidate Strain | |
| CN109321534A (en) | A kind of recombination VIII type newcastle disease virus low virulent strain | |
| CN108728419A (en) | Express aviadenovirus penton Protein reconstitutions newcastle disease vaccine Candidate Strain rAI4-penton and construction method | |
| CN110305898A (en) | The rescue of the non-susceptible H9N2 hypotype acclimatization to cold avian influenza virus of mammalian cell | |
| WO2016134678A1 (en) | New influenza a virus mammalian cell adapted strain and preparation and use thereof | |
| US11607448B2 (en) | Whole avian-origin reverse genetic system and its use in producing H7N9 subtype avian influenza vaccine | |
| CN104073513A (en) | Acquisition method and adaptive sites of influenza A virus vaccine mammalian cell adaptive strain | |
| CN104611299B (en) | H9N2 avian flus strain, preparation method, vaccine combination and its application of a kind of artificial recombination | |
| US11512117B1 (en) | Whole avian-origin reverse genetic system and recombinant H5N2 subtype avian influenza virus, vaccine and uses thereof | |
| CN104561092B (en) | Express construction method and the application of CSFV E 2 protein recombination PRRS viral genetic engineering vaccine | |
| CN102776156A (en) | Gene VIb subtype Rubulavirus Newcastle disease virus attenuated strain VIbI4 and construction method thereof | |
| CN112111503B (en) | Adenovirus vector bivalent vaccine for simultaneously preventing H5 and H9 subtypes of avian influenza and preparation method thereof | |
| WO2021051907A1 (en) | Method for preparing whole-genome expression vector pbr322-dhn3 | |
| CN107254450A (en) | The chimeric Newcastle Disease Virus Vaccine carrier Candidate Strain and construction method for overcoming newcastle disease maternal antibody to influence | |
| CN102526718B (en) | Recombinant H5N1 (Hemagglutinin 5 Neuraminidase 1) avian influenza virus cell vaccine and application thereof | |
| CN103333916A (en) | Construction method and application of BHK cell line suitable for newcastle disease virus proliferation | |
| CN109943576A (en) | A kind of recombinant rabies virus of chimeric canine distemper virus principal immune gene and its application | |
| CN105602989B (en) | A kind of recombinant vector and its application in preparation or screening Tamiflu | |
| CN109295095A (en) | A kind of Newcastle disease attenuated strain exogenous gene expression carrier of heat-staple gene VIII type | |
| CN112126629B (en) | Heat-resistant Newcastle disease virus mutant strain and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |