WO2016134678A1 - New influenza a virus mammalian cell adapted strain and preparation and use thereof - Google Patents

Abstract

Disclosed is a new influenza A virus mammalian cell adapted strain and a preparation and use thereof. In particular, the adapted strain mutates position 86 of an NS2 protein of a PR8 virus strain from K to R. The growth ability of the obtained virus strain to be grown on the Vero cells is enhanced, and the virulence of the adapted strain in vivo is not enhanced.

Description

Novel influenza A virus mammalian cell adaptation strain and preparation and application thereof Technical field

The present invention belongs to the field of biotechnology and immunology; more specifically, the present invention relates to a method and an adaptation site for obtaining a mammalian cell adaptation strain of influenza A virus vaccine.

Background technique

The flu is one of the most serious infectious diseases in human history, and its main pathogen is the influenza virus. It has a wide range of hosts, including wild birds, poultry, various mammals, and humans. It mutates rapidly, can alter antigenicity to evade attacks by the host immune system, or alter its own drug target characteristics to gain resistance. These characteristics determine that the flu virus can spread widely between humans and animals and is difficult to control. In addition to causing epidemicity every year, it also causes pandemic from time to time, causing huge losses to human society. In the past 100 years, the flu virus has had four major pandemics. Among them, the "Spanish" influenza pandemic in 1918 killed 20 million people worldwide. The subsequent 1957 Asian influenza pandemic and the 1968 Hong Kong influenza pandemic caused millions of deaths and huge economic losses. The outbreak of the highly pathogenic avian influenza virus in Southeast Asia in 1997 not only caused great harm to the aquaculture industry, but also had a very high mortality rate (up to 60%), which has the potential to form a major epidemic. The 2009 pandemic influenza A pandemic also caused worldwide panic and significant losses in the livestock industry. According to the World Health Organization (WHO), an average of one-third of children and one in ten adults worldwide are infected with the flu each year.

The influenza virus belongs to the family orthomyxoviridae. According to the antigenicity of its internal nuclear protein (NP) and matrix protein (M), it is divided into three types: A\B\C. Among them, type A is human and various animals. The main type of flu. Influenza A virus is an enveloped single-stranded minus-strand RNA (-ssRNA) virus. The genome consists of 8 single-stranded minus-strand RNAs encoding more than 11 proteins, including HA, NA, PA, PB1, PB2. , NP, M1, M2, NS1, NS2 and PB1-F2, and the like. Among them, hemagglutinin (HA) and neuraminidase (NA) are the main envelope antigen proteins. HA is mainly responsible for effectively invading cells. NA is mainly responsible for cutting off the connection between budding nascent virus particles and cell surface. freed. PA, PB1, and PB2 constitute a polymerase (RdRp) responsible for genome replication and transcription. Nucleoprotein (NP) binds to viral genomic RNA and is a major component of the viral ribonucleoprotein complex (vRNP). The matrix protein (M1) is located between the envelope and vRNP and is responsible for the formation of the viral protein capsid. Matrix protein M2 forms protons The channel, when the virus invades the cell, regulates the PH value of the endosomes, so that the HA is smoothly cut. NS1 is a multifunctional non-structural protein that plays an important role in resisting host immune responses (interferon-resistant) and regulating host cell cycle. NS2, also known as nuclear transporter (NEP), directs vRNP out of the nucleus. PB1-F2 is a small molecular weight multifunctional non-structural protein that induces apoptosis in host cells and affects viral pathogenicity.

The most effective way to fight the flu is to get a flu shot. The traditional influenza vaccine is produced by chicken embryos, the technology is quite mature, and the vaccine obtained is safe and effective. However, chicken embryo production vaccines have some insurmountable shortcomings, such as: the process is cumbersome; a large number of SPF chicken embryos are needed, which is difficult to guarantee supply during the influenza pandemic; mutations are likely to occur on surface antigens, which may cause antigenic changes in vaccines. ; contains ovalbumin reaction and the like. The development of mammalian diploid cell culture virus to produce influenza vaccine technology can solve the above problems well, and is also an important development direction to improve the status of influenza vaccine production.

The cell lines used for influenza virus vaccine production research mainly include MDCK, Vero, PER.C6, etc., and have been marketed. However, there are still many problems to be studied and solved, such as: (1) the production of vaccines for cell production needs to be improved, including the development of influenza virus strains more suitable for replication in cells, more suitable cell culture conditions and virus harvesting conditions. Explore and wait. (2) Evaluation of antigen stability in which cells are passaged in cells. (3) Safety evaluation of cell production vaccines. (4) Other cell lines that can be used for influenza vaccine production. and many more.

At present, the universal skeleton strain of influenza vaccine is PR8, which is a chicken embryo-adapted strain, which has high replication efficiency in chicken embryos, and enables the vaccine strain obtained by reassortment to obtain high-yield characteristics in chicken embryos. However, PR8 is not suitable for amplification in mammalian cells, so it is necessary to develop new skeleton strains for mammalian cell production platforms. Among the cells recommended by WHO for the cultivation of influenza virus vaccine strains, Vero cells have been used in the production of various human viral vaccines including rabies virus vaccine and poliovirus vaccine, and the culture conditions and production processes are mature. It has been demonstrated that Vero-cultured influenza virus vaccine strains can activate humoral immune responses and even higher cellular immune responses equivalent to those of chicken embryo cultured vaccine strains.

Therefore, there is an urgent need in the art to develop an influenza virus vaccine strain adapted to Vero cell culture.

Summary of the invention

According to a first aspect of the present invention, a mutant protein of influenza A virus nucleus transporter NS2 is provided, wherein the 86th amino acid of the mutant protein is mutated from K to R.

In another preferred embodiment, the 1-55th position of the mutein is the same as the 1-85 position of the protein of SEQ ID NO.: 3.

In another preferred embodiment, the mutein is at positions 87-111 identical to the 87-111 position of the protein of SEQ ID NO.: 3.

In another preferred embodiment, the amino acid sequence of the mutein is set forth in SEQ ID NO.: 2.

In another preferred embodiment, the influenza A virus strain PR8 containing the mutein is at least 20-fold, preferably at least 50-fold more preferred than the wild-type PR8 virus strain on mammalian cells, more preferably At least 80-100 times.

In another preferred embodiment, the mutein further comprises a derivative protein obtained by engineering based on the mutein, wherein the derivatized protein comprises one or more on the basis of the mutein ( Usually after 1-10, preferably 1-8, more preferably 1-6, 1-5, 1-3 or 1-2) amino acid deletions, insertions and/or substitutions A derivative protein containing the 86th amino acid of NS2 from K to the R mutation.

In another preferred embodiment, the derived protein further comprises one or more additions (usually 1-10, preferably 1-8) at the C-terminus and/or N-terminus of the mutein. More preferably, it is 1-6, 1-5, 1-3 or 1-2) amino acids.

In another preferred embodiment, the influenza virus strain containing the derivative protein and the influenza virus strain containing the mutant protein NS2 have comparable growth ability on mammalian cells (ie, the influenza virus strain containing the derivative protein is contained The influenza virus strain of the mutant protein NS2 is 90-100% of the growth ability on mammalian cells).

In another preferred embodiment, the mammalian cells include Vero cells, MDCK cells, PER.C6.

In a second aspect of the invention, an isolated polynucleotide encoding the mutein of any of claims 1-2 is provided.

In another preferred embodiment, the polynucleotide is set forth in SEQ ID NO.: 1, wherein the cDNA encoding NS2 _K86R is linked to positions 500-838 at positions 1-27.

In a third aspect of the invention, an expression vector comprising the polynucleotide of the second aspect of the invention is provided.

In another preferred embodiment, the expression vector is a plasmid or a viral vector.

In another preferred embodiment, the expression vector is a pHW2000 plasmid.

According to a fourth aspect of the present invention, a host cell comprising the expression vector of the third aspect of the present invention, or the chromosomal of the host cell is integrated with the polynucleoside of the second aspect of the present invention acid.

In another preferred embodiment, the host cell further comprises a wild type PR8 influenza A virus Multiple expression vectors for strains (other than NS2 protein).

According to a fifth aspect of the present invention, a recombinant PR8 influenza A virus strain is provided, wherein the 86th amino acid mutation of the NS2 protein of the PR8 influenza A virus strain is mutated from K to R.

In another preferred embodiment, the recombinant PR8 influenza A virus strain has the same or substantially the same amino acid sequence as the wild-type PR8 influenza A virus strain except for the 86th amino acid of the NS2 protein.

In another preferred embodiment, the recombinant PR8 influenza A virus strain further comprises a derivative strain thereof, and the growth ability of the derived strain on mammalian cells is the recombinant PR8 influenza A virus. The strain has a growth capacity of 95-100% on mammalian cells.

In another preferred embodiment, the recombinant PR8 influenza A virus strain has a growth ability on mammalian cells that is at least 20 times, preferably at least 50 times, more preferably at least 50 times that of the wild type PR8 influenza A virus strain. At least 80-100 times.

In a sixth aspect of the invention, there is provided a virus rescue system comprising an expression vector expressing an influenza A virus out nuclear transporter NS2 mutein.

In another preferred embodiment, the viral rescue system further comprises one or more additional expression vectors that express the protein required for the wild type PR8 influenza A strain.

In another preferred embodiment, the one or more additional expression vectors expressing a protein required for a wild-type PR8 influenza A virus strain comprise expressing a vector selected from the group consisting of RNA polymerase PB2 (SEQ ID NO.: 41) RNA polymerase PB1 (SEQ ID NO.: 42), RNA polymerase PA (SEQ ID NO.: 43), hemagglutinin HA (SEQ ID NO.: 44), nuclear coat nucleoprotein NP (SEQ ID NO.: 45) , Ceramidease NA (SEQ ID NO.: 46), Matrix Protein M1 (SEQ ID NO.: 47), Nonstructural Protein NS1 (SEQ ID NO.: 48), and Matrix Protein M2 (SEQ ID NO.: 49).

In another preferred embodiment, the sequence of the wild type PR8 influenza A virus strain is set forth in SEQ ID NO.: 50-57.

In another preferred embodiment, the expression vector is a plasmid.

In another preferred embodiment, the viral rescue system comprises an expression vector expressing the proteins of SEQ ID NO.: 2, and SEQ ID NOs.: 41-49.

The use of the mutein or the coding gene thereof, the expression vector of the fourth aspect of the present invention or the host cell of the fifth aspect of the present invention, and the host cell of the sixth aspect of the present invention, for use in the preparation of the present invention The recombinant PR8 virus strain of the sixth aspect of the invention.

According to a seventh aspect of the invention, the invention provides a kit for preparing a recombinant PR8 influenza A virus strain according to the fifth aspect of the invention, wherein the kit comprises the virus rescue system of the sixth aspect of the invention.

In another preferred embodiment, the viral rescue system comprises an expression vector required for expression of the recombinant PR8 influenza A virus strain, wherein the NS2 protein encoded by the polynucleotide in the expression vector is a mutant protein.

In another preferred embodiment, the polynucleotide in the expression vector also encodes other proteins of the PR8 influenza A virus strain.

According to an eighth aspect of the present invention, a method for the preparation of the recombinant PR8 influenza A virus strain of the fifth aspect of the present invention, comprising the steps of:

(a) Providing the virus rescue system of the sixth aspect of the present invention, comprising an expression vector expressing an influenza A virus out nuclear transporter NS2 mutein, and other expression of a protein required to express a wild type PR8 influenza A virus strain The vector; the other expression vector of the protein required for the wild-type PR8 influenza A virus strain comprises expressing a vector selected from the group consisting of RNA polymerase PB2, RNA polymerase PB1, RNA polymerase PA, hemagglutinin HA, nuclear coat protein NP, ceramidase NA, matrix proteins M1 and M2, and non-structural protein NS1;

(b) transfecting the virus rescue system in the step (a) with a host cell, culturing the host cell, thereby obtaining the recombinant PR8 influenza A virus strain of the fifth aspect of the invention.

It is to be understood that within the scope of the present invention, the various technical features of the present invention and the various technical features specifically described hereinafter (as in the embodiments) may be combined with each other to constitute a new or preferred technical solution. Due to space limitations, we will not repeat them here.

DRAWINGS

Figure 1 shows that the NS gene from the WSN virus is capable of promoting the growth of the PR8 virus on Vero cells. (A) A plaque map of the recombinant virus of PR8 and WSN virus on Vero cells. (B) Growth curve of recombinant virus of PR8 and WSN virus on Vero cells.

Figure 2 shows the growth of PR8 virus carrying a single point mutation on Vero cells. (A) Different mutation sites of the WSN NS gene compared to the PR8NS gene. (B) Growth curve of PR8 virus carrying different NS mutation sites on Vero cells.

Figure 3 shows that the NS2K86R mutation promotes the growth of the PR8 virus on Vero cells. (A) Virus titers generated by PR8, WSN, PR8-WSN NS and PR8-NS2 _K86R viruses replicated on Vero cells for 48 hours. (B) Plaque map of PR8, WSN, PR8-WSN NS and PR8-NS2 _K86R viruses on Vero cells.

Detailed ways

After extensive and intensive research, the present inventors obtained for the first time a mutant protein of PR8 virus strain capable of greatly increasing the growth ability of the influenza A virus strain PR8 on mammalian cells (especially Vero cells), wherein the NS2 of the PR8 virus strain was obtained. After the 86th mutation of the protein from K to R, the obtained virus strain has a 20-100-fold increase in growth ability on Vero cells compared with the wild-type PR8 virus strain, and the pathogenicity of the adapted strain in vivo is not enhanced. Therefore, the influenza A strain containing the mutein of the present invention can be used as a vaccine seed strain which is highly produced on mammalian cells. On the basis of this, the present invention has been completed.

NS2 protein and its mutant protein

As used herein, the terms "nuclear transporter NS2", "NS2 protein" are used interchangeably and are both nuclear exporters of the nail-type influenza virus wild-type PR8 strain, which are defined as commonly understood by one of ordinary skill in the art. . NS2 protein mainly mediates the process of influenza virus vRNP exporting from nucleus to cytoplasm; in addition, NS2 protein can participate in the regulation of influenza polymerase activity and affect the cross-species ability of virus transmission. Recent studies have found that NS2 interacts with the protein F1Fo-ATPase on the host cell membrane to promote the packaging and release process of the influenza virus life cycle. Preferably, the sequence of the NS2 protein is as shown in SEQ ID NO.: 3.

The present invention provides a mutant protein of the influenza A virus strain PR8NS2 protein (or "protein of the present invention", "mutant nuclear exporter"), wherein the mutant protein sequence is compared with the amino acid sequence of the NS2 protein. The amino acid at position 86 is mutated from K to R. Preferably, the mutein of the invention is represented by SEQ ID NO.: 2.

The PR8 strain containing the mutein of the present invention has an activity characteristic of high-speed growth on mammalian cells. Preferably, the protein of the invention further comprises a derivative protein having the same or similar functional properties. It will be apparent to those skilled in the art that alteration of a minority amino acid residue in certain regions of a polypeptide (protein), such as a non-significant region, does not substantially alter biological activity, for example, the sequence obtained by appropriately replacing certain amino acids does not affect its activity ( See Watson et al, Molecular Biology of The Gene, Fourth Edition, 1987, The Benjamin/Cummings Pub. Co. P224). Thus, one of ordinary skill in the art would be able to implement such substitutions and ensure that the resulting molecules still possess the desired biological activity.

Preferably, the derivative protein comprises one or more of the mutant proteins (usually 1-10, preferably 1-8, more preferably 1-6, 1-5, 1-3 or 1-2) a derivative protein after deletion, addition and/or substitution of an amino acid; and/or said derived protein further comprises addition or deletion at the C-terminus and/or N-terminus of said mutant protein One or several (usually 1-10, preferably 1-8, better) 1-6, 1-5, 1-3 or 1-2) amino acids; in general, the sequence identity or homology of these derived proteins with the muteins of the invention may be 90% or more, preferably 95%-98%, more preferably 99%. Among them, the recombinant PR8 virus strain containing the derivative protein of the present invention also has a high-speed growth activity on mammalian cells, for example, 90-100% of the virus strain containing the mutant protein of the present invention is not as high-speed as that of the cell animal. Activity (ability).

In the present invention, the substitution of the amino acid residues in the derived protein is a conservative substitution. Preferably, these conservative substitutions can be produced according to the amino acid substitutions shown in Table 1:

Table 1

Initial residue	Representative substituted residues	Preferred substituted residue
Ala(A)	Val; Leu; Ile	Val
Arg(R)	Lys; Gln; Asn	Lys
Asn(N)	Gln;His;Lys;Arg	Gln
Asp(D)	Glu	Glu
Cys(C)	Ser	Ser
Gln(Q)	Asn	Asn
Glu(E)	Asp	Asp
Gly(G)	Pro; Ala	Ala
His(H)	Asn; Gln; Lys; Arg	Arg
Ile(I)	Leu;Val;Met;Ala;Phe	Leu
Leu(L)	Ile;Val;Met;Ala;Phe	Ile
Lys(K)	Arg; Gln; Asn	Arg
Met(M)	Leu;Phe;Ile	Leu
Phe(F)	Leu;Val;Ile;Ala;Tyr	Leu
Pro(P)	Ala	Ala
Ser(S)	Thr	Thr
Thr(T)	Ser	Ser
Trp(W)	Tyr;Phe	Tyr
Tyr(Y)	Trp;Phe;Thr;Ser	Phe
Val(V)	Ile; Leu; Met; Phe; Ala	Leu

The invention also provides polynucleotides encoding the polypeptides of the invention. The term "polynucleotide encoding a polypeptide" can be in the form of DNA or RNA. The DNA can be a coding strand or a non-coding strand. The coding region sequence encoding the mature polypeptide may be identical to the coding region sequence shown in SEQ ID NO: 2 or may be a degenerate variant. As used herein, with SEQ ID NO: 1 as an example, a "degenerate variant" in the present invention refers to a polypeptide having the sequence of SEQ ID NO: 2, but with the corresponding coding region sequence of SEQ ID NO: 1. Differential nucleic acid sequences.

The full length sequence of the mutant protein of the present invention or a fragment thereof can generally be subjected to PCR amplification, recombination Obtained by method or synthetic method. At present, it has been possible to obtain a DNA sequence encoding a polypeptide of the present invention (or a fragment thereof, or a derivative thereof) completely by chemical synthesis. The DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art.

Recombinant PR8 influenza A strain

The present invention also provides a recombinant PR8 influenza A virus strain of influenza A (abbreviated as a recombinant PR8 virus strain). The recombinant virus strain of the present invention is different from the wild type PR8 virus strain in that the NS2 protein in the virus is a mutant protein of the present invention, that is, the 86th amino acid is mutated from K to R, and the recombinant PR8 virus strain is The growth ability on mammalian cells (such as Vero cells) is at least 20-fold, preferably 50-80-fold, and more preferably 100-fold higher than that of the wild-type strain; and the recombinant PR8 virus strain except for the mutation site The other structure is the same or substantially the same as the wild type PR8 virus strain, that is, the other proteins of the recombinant PR8 virus strain are the same as the wild type, wherein the other proteins include RNA polymerase PB2, RNA polymerase PB1, RNA polymerase PA, hemagglutinin HA, nuclear coat nucleoprotein NP, ceramidase NA, matrix proteins M1 and M2, and non-structural protein NS1.

It should be understood that when the mutation site of position 86 of the NS2 protein is retained, other proteins of the recombinant PR8 virus strain can also be replaced according to the conserved sites in the prior art (as according to Table 1), adding and/or deleting amino acids. Derived strains that also have Vero cell adaptability (high growth rate characteristics) (eg, 95%-100% adaptability) are obtained.

In addition, after obtaining the recombinant PR8 virus strain of the present invention, the derived strain obtained after the reasonable passage number in the process of producing the vaccine (for example, a derivative strain in which the amino acid sequence does not change enough to change the properties of the strain) is also It should be within the scope of the invention.

As used herein, the term "wild-type PR8 influenza A virus strain" or "wild-type PR8 virus strain" refers to a currently commercially available PR8 strain, or preferably reverse genetics according to the known PR8 gene sequence. Method of constructing a virus strain. The PR8 virus strain used in the present invention is constructed by the reverse genetics method of the PR8 virus gene, wherein the gene of the PR8 virus strain is given by the author of Vaccine 20 (2002) 3165-3170, the specific sequence information is attached, and the wild type PR8 virus is full. The gene sequence is set forth in SEQ ID NO.: 50-57, wherein the genes set forth in SEQ ID NO.: 50-55 encode the protein set forth in SEQ ID NO.: 41-46, and the SEQ ID NO.: 56 encodes the SEQ. ID NO.: The protein represented by 47, 49, and SEQ ID NO.: 57 encodes the protein of SEQ ID NO.: 48. The mutant protein of the present invention was identified to have the same nucleotide sequence as that of the wild type virus strain except that the nucleotide of the 86th position of the wild type PR8 virus NS2 protein was different.

Virus rescue system

The present invention also relates to a recombinant virus rescue system comprising an influenza virus rescue plasmid required for rescue of an influenza A virus (such as a PR8 virus strain) to achieve influenza virus rescue. For influenza virus rescue systems, those skilled in the art are aware of a series of viral rescue expression vectors (e.g., plasmids) that contain all of the elements (including viral protein coding sequences) that can be rescued by influenza virus. And a non-coding sequence), after transfecting the cells, the corresponding mRNA of the viral protein and viral RNA (vRNA) are obtained, thereby obtaining a recombinant virus.

Currently, there are a number of commercially available influenza virus rescue plasmids, such as the pHW2000 plasmid, which contains a polI and polII dual promoter that simultaneously enables vRNA transcription and mRNA expression. A complete viral rescue system, typically comprising a plurality of viral rescue plasmids, each plasmid containing at least one Segment, said Segment comprising at least one protein-coding gene, and for simultaneous transcription of viral mRNA and viral RNA (vRNA) Components. Viral rescue techniques are now well established, for example, see Erich Hoffmann et al, Vaccine 20 (2002) 3165-3170 or Hoffmann, E. et al, Proc Natl Acad Sci U S A (2000) 97: 6108-6113.

As a preferred mode of the invention, the virus rescue plasmid is a polI-polII transcription/expression vector, preferably a pHW2000 plasmid. Virus Rescue is a technique well known in the art and those skilled in the art are familiar with which virus rescue plasmids are available. Therefore, although a pHW2000 plasmid is preferred, other viral rescue plasmids having similar elements and the like can be applied to the present invention, such as pHH21.

As a preferred mode of the present invention, the virus rescue system comprises eight virus rescue plasmids, respectively, which are loaded with the Segment1 to Segment8, wherein the nucleotides contained in the plasmid expressing the NS2 can be encoded in the eight virus rescue plasmids. The mutein of the invention. Of course, the viral rescue system may also contain only plasmids expressing the muteins of the invention for use with other commercially available plasmids or vectors expressing other PR8 proteins.

A recombinant influenza virus strain can be obtained by transfecting each virus rescue plasmid into a virus packaging cell and culturing the transfected virus packaging cell.

Kit

The invention also includes a kit for preparing a recombinant influenza virus strain, the kit comprising: a virus rescue system comprising an influenza virus rescue plasmid required for influenza virus rescue, capable of implementing influenza virus Rescue; in the influenza virus rescue plasmid, the gene encoding the nuclear transporter NS2 is a mutant gene encoding a mutant nuclear transporter NS2, and the 86th amino acid sequence is mutated from K to R; as a preferred embodiment of the present invention In the kit, the virus rescue plasmid is a pHW series plasmid; more preferably, the pHW series plasmid is a pHW2000 plasmid, including 8 pHW2000 plasmids, and the Segment1 to Segment8 are respectively loaded.

Those skilled in the art, after obtaining the kit, can conveniently prepare a recombinant influenza virus strain which is mammalian cell-adapted by virus rescue technology.

As a preferred mode of the present invention, the kit further comprises: a virus packaging cell as a recipient cell of the virus rescue plasmid. Preferably, the viral packaging cell is a mammalian cell such as, but not limited to, Vero cells, 293T cells, MDCK cells, COS-1 cells, PER.C6 cells, and the like. Most preferably, the cell is a Vero cell.

As a preferred mode of the present invention, the kit further includes other reagents for virus rescue and peripheral reagents such as, but not limited to, gene transfection reagents, PCR amplification reagents, plasmid extraction reagents, and culture of virus packaging cells. Base. More preferably, the kit may also include instructions for use indicating the method of use and points of attention.

The main advantages of the invention are:

The present invention determines, through a series of viral recombination and proliferation experiments, that an amino acid site on the viral protein encoded by the internal viral gene: NS2 _K86R contributes to the growth adaptability of the influenza virus-adapted strain in mammalian cells. It has been demonstrated by mouse and chicken embryo virulence experiments that the site mutations involved in the present invention do not increase the lethal ability of the virus on mouse or chicken embryos. The invention provides a high-yield and safe Vero cell-adapted modified influenza vaccine strain, which is of great value for influenza vaccine research and production.

The present invention relates to a method for recombining an influenza virus (Influenza virus) vaccine strain with other influenza virus strains, obtaining a Vero cell-adapted strain, and a viral amino acid site determining its adaptability. Cell medium culture of influenza virus to obtain vaccine strain is an inevitable trend of influenza vaccine production. Vero cells are recommended by WHO as an alternative cell strain for influenza vaccine production because of their safety and reliability, but most influenza viruses are in this cell. The ability to expand is limited, so increasing the growth rate of influenza vaccine strains in mammalian cell culture systems, especially Vero cells, will play an important role in the production of influenza virus vaccines.

The invention is further illustrated below in conjunction with specific embodiments. It should be understood that these embodiments are only used to say The invention is not intended to limit the scope of the invention. The experimental methods in the following examples which do not specify the specific conditions are usually prepared according to conventional conditions such as J. Sambrook et al., Molecular Cloning Experiment Guide, Science Press, 2002, or according to the manufacturer's recommended conditions. . Percentages and parts are by weight unless otherwise stated.

Materials and Method

Reverse genetics method for obtaining PR8 virus

Rescue PR8 by means of eight-plasmid reverse genetics to rescue influenza virus (Hoffmann, E. et al., 2000. A DNA transfection system for generation of influenza A virus from eight plasmids. Proc Natl Acad Sci U S A 97: 6108-6113) virus. Briefly, a reverse genetic expression plasmid pHW2000 (available from St. Jude Children's Research Hospital, University of Tennessee, USA) containing eight PR8 viral genes, plasmid pHW2000-PR8-HA, pHW2000-PR8-NA, was provided. pHW2000-PR8-NS, pHW2000-PR8-M, pHW2000-PR8-NP, pHW2000-PR8-PB1, pHW2000-PR8-PB2, pHW2000-PR8-PA, each viral gene was inserted into the BsmBI site of pHW2000. Eight plasmids were mixed in equal amounts, 1 ug of each plasmid, and transfected into 293T cells of about 90% monolayer in a 6 cm dish with Lipofectamine 2000 (Invitrogen) reagent. After 48 hours of transfection, the supernatant was collected, MDCK cells were infected, supernatant was collected 48 hours after infection, and two rounds of plaque purification were performed on MDCK cells (purchased from ATCC), and the obtained purified virus was PR8 virus. After the virus was amplified, the genotype was further identified and no additional mutations were identified during the rescue.

Viral plaque purification, amplification and genotyping

The virus was diluted with PBS solution at a 10-fold dilution. The dilution was added to 100% MDCK monolayer cells in a 6-well plate, infected at 37 ° C for 1 h, and then 3 ml of overlay medium (1.5 ml 2 ) was added to each well. × DMEM + 1.5 ml 1.8% Agar + 1 μg / ml TPCK trypsin), after the medium was solidified, it was cultured in a 37 ° C, 5% CO ₂ incubator for 48-72 hours to form a visible plaque. A single virus plaque was picked with a pipette tip into 1 ml of PBS and allowed to stand at 4 ° C for 4 hours. The monoclonal virus-containing PBS was diluted as above with a 10-fold dilution, and one round of plaque purification was repeated. The virus after two rounds of plaque purification was amplified in Infection Medium in a single layer of MDCK cells in a 75 cm ² cell culture flask.

The harvested virus was extracted with RNeasy RNA extraction kit (Qiagen, Chatsworth, CA) by the kit instructions (Cat No. 52904), with M-MLV reverse transcriptase (Invitrogen) and influenza virus genome specific. Sex Primer Uni 12 (5'-AGCAAAAGCAGG-3' (SEQ ID NO.: 20)) (Hoffmann, E., J. Stech, Y. Guan, RG Webster, and DR Perez. 2001. Universal primer set for the full-length amplification of all influenza A viruses. Arch Virol 146: 2275-89.) Reverse transcription, the resulting viral cDNA was PCR-derived using a universal primer for influenza virus fragment containing BsmBI (Bm) or BsaI (Ba) or AarI (Aar) sites to obtain 8 viral genes (Hoffmann, E., J. Stech, Y. Guan, RG Webster, and DR Perez. 2001. Universal primer set for the full-length amplification of all influenza A viruses. Arch Virol 146: 2275-89), cloned into a pHW2000 vector, and sequenced to determine the viral gene sequence.

Influenza virus fragment-specific universal primer sequences are as follows:

Primers used to amplify PB2:

Ba-PB2-F: TATTGGTCTCAGGGAGCGAAAGCAGGTC; (SEQ ID NO.: 4)

Ba-PB2-R: AATTGGTCTCGTATTAGTAGAAACAAGGTCGTTT; (SEQ ID NO.: 5)

Primers used to amplify PB1:

Aar-PB1-F: TATTCACCTGCTTTAGGGAGCGAAAGCAGGCA; (SEQ ID NO.: 6)

Aar-PB1-R: ATCACACCTGCTTTGTATTAGTAGAAACAAGGCATTT; (SEQ ID NO.: 7)

Primers for amplifying PA:

Bm-PA-F: TATTCGTCTCAGGGAGCGAAAGCAGGTAC; (SEQ ID NO.: 8)

Bm-PA-R: ATCCGTCTCGTATTAGTAGAAACAAGGTACTT; (SEQ ID NO.: 9)

Primers for amplifying HA:

Bm-HA-F: TATTCGTCTCAGGGAGCGAAAGCAGGGG; (SEQ ID NO.: 10)

Bm-HA-R: ATCCGTCTCGTATTAGTAGAAACAAGGGTGTTTT; (SEQ ID NO.: 11)

Primers used to amplify NP:

Ba-NP-F: TATTGGTCTCAGGGAGCGAAAGCAGGGTA; (SEQ ID NO.: 12)

Ba-NP-R: ATAGAGTCTCGTATTAGTAGAAACAAGGGTATTTTT; (SEQ ID NO.: 13)

Primers for amplifying NA:

Ba-NA-F: TATTGGTCTCAGGGAGCGAAAGCAGGAGT; (SEQ ID NO.: 14)

Ba-NA-R: AATTGGTCTCGTATTAGTAGAAACAAGGAGTTTTTT; (SEQ ID NO.: 15)

Primers used to amplify M:

Bm-M-F: TATTCGTCTCAGGGAGCGAAAGCAGGTAG; (SEQ ID NO.: 16)

Bm-M-R: ATCCGTCTCGTATTAGTAGAAACAAGGTAGTTTTT; (SEQ ID NO.: 17)

Primers used to amplify NS:

Bm-NS-F: TATTCGTCTCAGGGAGCGAAAGCAGGGTG; (SEQ ID NO.: 18)

Bm-NS-R: ATCCGTCTCGTATTAGTAGAAACAAGGGTGTTTT. (SEQ ID NO.: 19)

RT-PCR

2 μl of 5 μg/ml Uni 12 primer was added to the extracted RNA, and the mixture was mixed and then subjected to a water bath at 70 ° C for 5 minutes. Then, the mixture was added to a reverse transcription reaction system (M-MLV 5×Buffer 8 μl, dNTP 10 mM 2 μl, RNase 40 U/μl 1 μl, M-MLV 200 U/μl 2 μl), and the mixture was immersed in a water bath at 37 ° C for 1-2 hours at 95 ° C for 10 minutes. cDNA product.

PCR

The cDNA product was added to the PCR reaction system (ddH ₂ O 36 μl, 10×PCR Buffer 5 μl, dNTP Mixture [2.5 mM] 4.0 μl, primers [20 μM] 1.0 μl/1.0 μl, viral cDNA [100 μg/ml] 3.0 μl, Fusion [ FINNZYMES, Cat No. F530L] 0.3 μl). The reaction was carried out according to the above system, first denatured at 94 ° C for 2 min, and then reacted for 34 cycles according to the following parameters: denaturation at 94 ° C for 1 min, annealing at 55 ° C for 30 sec, extension at 72 ° C for 1 min, and finally extension at 72 ° C for 7 min. The PCR product was applied to a DNA agarose gel under a UV lamp to fractionate the target fragment, and a viral gene was obtained using a gel recovery kit (AXYGEN, AxyPrep DNA Gel Extraction Kit, Cat No. AP-GX-250).

Reverse genetics to rescue PR8-WSN NS virus

The reverse genetics approach is as described above. With pHW2000-WSN-NS, pHW2000-PR8-HA, pHW2000-PR8-NA, pHW2000-PR8-M, pHW2000-PR8-NP, pHW2000-PR8-PB1, pHW2000-PR8-PB2, pHW2000-PR8-PA The plasmid was combined and transfected with Lipofectamine 2000 (Invitrogen) reagent into the above 8 viral genes (ie, the gene NS of WSN and the genes NP, HA, NA, M, PA, PB1, PB2 of PR8) in a 6 cm culture dish. 90% monolayer of 293T cells. After 48 hours of transfection, the supernatant was collected and infected with MDCK cells. The supernatant was collected 48 hours after infection, and two rounds of plaque purification were performed on MDCK cells. The purified virus obtained by sequencing was PR8-WSN NS. After the virus was amplified, the genotype was further identified and no additional mutations were identified during the rescue.

Reverse Genetics to Rescue PR8-WSN M Virus

The reverse genetics approach is as described above. With pHW2000-WSN-M, pHW2000-PR8-HA, pHW2000-PR8-NA, pHW2000-PR8-NS, pHW2000-PR8-NP, pHW2000-PR8-PB1, pHW2000-PR8-PB2, pHW2000-PR8-PA is a transfection plasmid combination, and the above eight viral genes are transfected with Lipofectamine2000 (Invitrogen) reagent (that is, the gene M of WSN, and the genes NS, HA, NA, NP of PR8) , PA, PB1, PB2) grew to approximately 90% monolayer of 293T cells in a 6 cm dish. After 48 hours of transfection, the supernatant was collected and infected with MDCK cells. The supernatant was collected 48 hours after infection, and two rounds of plaque purification were performed on MDCK cells. The purified virus obtained by sequencing was PR8-WSN M. After the virus was amplified, the genotype was further identified and no additional mutations were identified during the rescue.

Reverse genetics to rescue PR8-4P virus

The reverse genetics approach is as described above. With pHW2000-WSN-PA, pHW2000-WSN-NP, pHW2000-WSN-PB1, pHW2000-WSN-PB2, pHW2000-PR8-HA, pHW2000-PR8-NA, pHW2000-PR8-NS, pHW2000-PR8-M, Transfection of plasmid combinations, transfection of the above 8 viral genes (ie, genes PA, NP, PB1, PB2, and PR8 genes HA, NA, M, NS) in a 6 cm culture dish with Lipofectamine 2000 (Invitrogen) reagent. Up to about 90% monolayer of 293T cells. After 48 hours of transfection, the supernatant was collected and infected with MDCK cells. The supernatant was collected 48 hours after infection, and two rounds of plaque purification were performed on MDCK cells. The purified virus obtained by sequencing was PR8-WSN 4P. After the virus was amplified, the genotype was further identified and no additional mutations were identified during the rescue.

Reverse genetics to rescue PR8-NS mutant virus

First, construct a pHW2000-PR8-NS plasmid containing a single point mutation NS1 _K55E , NS1 _D101H , NS1 _{S103F, I106M} , NS1 _A171D /NS2 _L14M , NS2 _E22G , NS1 _D189M /NS2 _M31I , NS2 _E63G , NS1 _E221K , NS2 _K86R and NS2 _H104Q Mutations were constructed using the QuickChange kit (Stratagene) according to the product specification (Cat No 200518). Briefly, a pair of primers containing a mutation site (below) with an annealing temperature of about 78 ° C was first designed, and then the primer was directly used, and PCR was carried out using the plasmid pHW2000-PR8-NS as a template, and the obtained product was DpnI. (NEB) was digested for 1 hour, and the PCR product was directly transferred into competent cells (DH-5α), and the positive clones identified were both plasmids containing the mutation. Mutant primers:

NS1 _K55E :

Forward: GGTCTGGACATCGAGACAGCCACACG (SEQ ID NO.: 21)

Reverse: CGTGTGGCTGTCTCGATGTCCAGACC (SEQ ID NO.: 22)

NS1 _D101H :

Forward: AGGAAATGTCAAGGCACTGGTCCATGCT (SEQ ID NO.: 23)

Reverse: AGCATGGACCAGTGCCTTGACATTTCCT (SEQ ID NO.: 24)

NS1 _{S103F, I106M} :

Forward: TCAAGGGACTGGTTCATGCTCATGCCCAAGCAGAAAG (SEQ ID NO.: 25)

Reverse: CTTTCTGCTTGGGCATGAGCATGAACCAGTCCCTTGA (SEQ ID NO.: 26)

NS1 _A171D /NS2 _L14M :

Forward: CCAGGACATACTGATGAGGATGTCAAAAA (SEQ ID NO.: 27)

Reverse: TTTTTGACATCCTCATCAGTATGTCCTGG (SEQ ID NO.: 28)

NS2 _E22G :

Forward: AAAAATGCAGTTGGGGTCCTCATCGGAG (SEQ ID NO.: 29)

Reverse: CTCCGATGAGGACCCCAACTGCATTTTT (SEQ ID NO.: 30)

NS1 _D189M /NS2 _M31I :

Forward: GGACTTGAATGGAATAATAACACAGTTCGAG (SEQ ID NO.: 31)

Reverse: CTCGAACTGTGTTATTATTCCATTCAAGTCC (SEQ ID NO.: 32)

NS2 _E63G :

Forward: CCAAAACAGAAACGGGAAATGGCGGGAA (SEQ ID NO.: 33)

Reverse: TTCCCGCCATTTCCCGTTTCTGTTTTGG (SEQ ID NO.: 34)

NS1 _E221K :

Forward: CAAAACAGAAACGAAAAATGGCGGGAAC (SEQ ID NO.: 35)

Reverse: GTTCCCGCCATTTTTCGTTTCTGTTTTG (SEQ ID NO.: 36)

NS2 _K86R :

Forward: GAAGAAGTGAGACACAGACTGAAGATAACAGAGAA (SEQ ID NO.: 37)

Reverse: TTCTCTGTTATCTTCAGTCTGTGTCTCACTTCTTC (SEQ ID NO.: 38)

NS2 _H104Q :

Forward: TATGCAAGCCTTACAACTATTGCTTGAAGTGG (SEQ ID NO.: 39)

Reverse: CCACTTCAAGCAATAGTTGTAAGGCTTGCATA (SEQ ID NO.: 40)

The reverse genetics approach is as described above. With pHW2000-PR8-NSmut, pHW2000-PR8-HA, pHW2000-PR8-NA, pHW2000-PR8-PB1, pHW2000-PR8-M, pHW2000-PR8-NP, pHW2000-PR8-PB2, pHW2000-PR8-PA The plasmid was combined and the above eight viral genes were transfected with Lipofectamine 2000 (Invitrogen) reagent (that is, the gene NS of PR8 contained the above mutation, and the genes of NP, HA, NA, M, PB1, PA, PB2 of PR8) were cultured at 6 cm. Up to about 90% monolayer of 293T cells in the dish. After 48 hours of transfection, the supernatant was collected and infected with MDCK cells. The supernatant was collected 48 hours after infection, and two rounds of plaque purification were performed on MDCK cells. The purified virus obtained by sequencing was PR8-NS mut. After the virus was amplified, the genotype was further identified and no additional mutations were identified during the rescue.

Plaque immunostaining

Viral plaque immunostaining is performed according to the literature (Matrosovich, M. et al., New low-viscosity overlay medium for viral plaque assays. Virol J 3: 63). Briefly, Vero or MDCK cells were cultured in a 12-well plate to a 100% monolayer, aspirate the culture, washed once with PBS, and the virus was serially diluted in 10-fold dilutions, and 400 μl of virus dilution was added to each well to infect at 37 °C. minute. After 30 minutes, the virus infection solution was aspirated, and 2 ml of Overlay medium was added to each well (1:1 volume ratio of 2×DMEM [Gibco]: 2.4% Avicel [FMC BioPolymer], and a final concentration of 1 μg/ml TPCK-trypsin [Sigma] And 50 units/ml penicillin [Invitrogen], 50 μg/ml streptomycin [Invitrogen]), cultured in an incubator at 37 ° C, 5% CO ₂ for 48-72 hours. The 12-well plate was taken out, the Overlay culture solution was aspirated, washed twice with PBS, and fixed in a PBS solution containing 4% paraformaldehyde for 1 hour, and then the fixed solution was aspirated, and washed three times with PBS for 5 minutes each time. The permeabilizing solution (PBS containing 0.3% Tritian X-100) was then added and allowed to stand at room temperature for 30 minutes. Aspirate the transmembrane solution, wash it three times with PBS for 5 minutes, then add the anti-NP protein polyclonal antibody with horseradish peroxidase (purchased from the Shanghai Institute of Life Sciences, Chinese Academy of Sciences), and place at room temperature. hour. The antibody was aspirated and washed three times with PBS containing 0.05% Tween-20 for 5 minutes each time. Finally, the True Blue substrate (KPL) was added for color development, and the infected cells on the periphery of the plaque were blue. After photographing, the color of the picture was adjusted to black and white using Photoshop software.

Virus titration

Using the plaque immunostaining method, the number of plaques in the wells with a number of plaques of about 10 is counted. According to the dilution concentration and the amount of infection corresponding to the wells, the amount of virus containing plaques per ml of virus solution is calculated ( Pfu/ml).

Growth curve of virus in cells

The cells were grown to a 100% monolayer in a 6 cm culture dish, inoculated with MOI=0.001, infected at 37 ° C for 1 hour, aspirate the infection solution, and added 4 ml of Infection Medium (DMEM [Gibco] + 0.2% BSA + 1 μg / ml TPCK-trypsin [Sigma]), cultured in an incubator at 37 ° C, 5% CO ₂ . At the 2, 24, 48, 72, and 96 hours after infection, 40 μl of the supernatant containing the virus was collected and stored in a -80 ° C freezer. Vero cells need to be supplemented with 1 μg/ml TPCK-trypsin every 24 h. Viral titers were titrated on MDCK cells and the results were plotted as a function of time.

Hemagglutination inhibition experiment

Mouse sera were obtained from PR8 virus-immunized mice or blank mice. 0.1 ml serum plus 0.4 ml receptor-destroying enzyme (RDE, purchased from China CDC), overnight at 37 °C. Inactivated at 56 ° C for 30 minutes, add 0.5 ml PBS to a final concentration of 10 ^-1 dilution. The treated serum was diluted 2-fold in 96-well plates at dilutions ranging from 2 ^-1 to 2 ^-10 . Viral quantification was performed as follows: The virus was titrated with 1% chicken red blood cells according to standard procedures. The highest dilution that can cause complete hemagglutination is the end point of the titration, which is 1 HA unit / 50 μl. This dilution is 3HA units/25 μl in the first 3 dilutions. 25 μl of the designated virus containing 4 HA units was added to each well and mixed with the diluted serum, and the cells were fully incubated by incubating at 37 ° C for 1 hour, and 50 μl of 1% chicken red blood cells were added to each well, and allowed to stand at room temperature for 30 minutes. The hemagglutination inhibition titer of serum is the reciprocal of the highest dilution capable of inhibiting red blood cell agglutination (Kendal A, PM, & Skehel J. 1982. Concepts and procedures for laboratory-based influenza surveillance.. Geneva: World Health Organization.).

Chicken embryo lethal experiment

10 day old SPF chicken embryos (purchased from Shandong SPF experimental chicken farm), the embryo activity was determined according to the eggs, 100 μl of 10-fold gradient virus, 10 ⁶ PFU/embryo to 10 ² PFU/embryo, inoculated to chicken embryos The allantoic cavity was observed and the chick embryos were observed to survive 48 hours after inoculation. ELD50 was calculated according to the Reed & Muench method (Matsuoka, Y. et al., 2009. The mouse model for influenza. Curr Protoc Microbiol Chapter 15: Unit 15G 3).

Mouse experiment

The median lethal dose (MLD ₅₀ ) of the virus was measured by the following method. 6-8 weeks old SPF BALB/c female mice (purchased from Shanghai Slack Laboratory Animal Co., Ltd.), each group of 5, anesthetized with ether, and then 10 times gradient diluted virus solution 50 μl (containing 1×10) ⁴ to 1 × 10 ¹ virus) was instilled into the lungs of mice by nasal inoculation, and the body weight of the mice was observed daily until the 14th day after infection. During the 14 days, if the mice developed obvious symptoms, such as vertical hair and contracture, and the weight loss exceeded 25%, the mice were judged to be dead, and the mice were euthanized due to humanitarian factors (first anesthetized with ether) The rat's neck is dislocated and killed.) MLD50 was calculated according to the Reed & Muench method (Matsuoka, Y., EWLamirande, and K. Subbarao. 2009. The mouse model for influenza. Curr Protoc Microbiol Chapter 15: Unit 15G 3.).

Example 1. The NS gene derived from the WSN strain can promote the high-speed growth of the PR8 strain on Vero cells.

The safety of Vero cells as a mammalian cell line produced by WHO recommended vaccine has been well documented, but the skeletal strain PR8 used in the production of influenza vaccine is an adaptive strain of chicken embryo and adapts to the mammalian cell line Vero. The sex is not good enough to meet the production requirements.

Therefore, the inventors recombined the PR8 strain with other strains WSN which are more suitable for mammalian cell lines, and improved the adaptability of PR8 on Vero cells. Reverse genetics was used to replace the gene of PR8 strain (except HA, NA) with WSN. By comparing the plaque size, only the NS gene from WSN replaces the NS gene of PR8, and the recombinant virus PR8-WSN NS can be in Vero. A larger plaque than PR8 was formed on the cells (Fig. 1A). The recombinant virus PR8-WSN M (M gene from WSN replaces the M gene of PR8) and PR8-WSN 4P (from the WSN polymerase complex genes PB1, PB2, PA and NP replace the PR8 polymerase complex gene PB1, PB2, PA and NP) can only form needle-like plaques similar to PR8 (Fig. 1, A). Further, the virus was inoculated with MOI=0.001, infected with Vero cells, and the virus growth curve was drawn. Only the growth rate of PR8-WSN NS virus was significantly higher than that of PR8 virus and close to the growth rate of WSN virus (Fig. 1, B). At 24 h after infection, the virus titer of PR8-WSN NS was about 128 times higher than that of PR8 virus (the virus titers of PR8-WT and PR8-WSN NS were 2.9*10^3pfu/ml and 3.7*10^5pfu/, respectively). Ml,). At 48 h after infection, the virus titer of PR8-WSN NS was about 55 times higher than that of PR8 virus (the virus titers of PR8-WT and PR8-WSN NS were 3.3*10^4pfu/ml and 1.8*10^6pfu/, respectively). Ml) (Figure 1, B).

The above data indicates that the NS gene from WSN can significantly increase the growth rate of PR8 on Vero cells and improve the adaptability of PR8 on Vero cells.

Example 2. The NS2 _K86R mutation promotes high-speed growth of PR8 on Vero.

In order to identify a site on the NS gene that promotes rapid growth of PR8 on Vero cells, the NS gene of the PR8 strain was sequence aligned with the NS gene of the WSN strain. The NS gene of PR8 shares a total of 11 non-synonymous mutations in the nucleotide sequence with the NS gene of WSN, located at positions 163, 301, 308, 318, 512, 537, 565, 660, 661, 729, 784 of the nucleotide (Fig. 2, A). Since the NS gene undergoes selective cleavage upon transcription into mRNA, two different mRNAs are formed, encoding two proteins, the non-structural protein NS1 and the nuclear transporter NS2 (NEP), respectively. This 11 nucleotide mutation resulted in 7 amino acid mutations on the NS1 protein and 6 amino acid mutations on the NS2 protein (Fig. 2, A).

The reverse genetics method rescued the PR8-based strains with non-synonymous mutations of all of the above NS genes (103F and 106M are known to synergistically stabilize the binding of the NS1 protein to the host factor CPSF30). Simultaneous mutation). The virus was inoculated with MOI=0.001, infected with Vero cells, by comparing growth curves with nucleotides 163 (ie NS1 _K55E ), 301 (ie NS1 _D101H ), 565 (ie NS1 _D189M / NS2 _M31I ), 660 (ie NS2 _E63G) The strains mutated with 729 (ie NS2 _K86R ) site promoted the growth efficiency of PR8 on Vero to varying degrees, and the promotion of NS2 _K86R mutation was the strongest (Fig. 2, B). Mutations at other sites did not have a significant effect on the growth of PR8 on Vero. Since the addition of other promoting mutations based on NS2 _K86R does not further increase the virus titer, NS2 _K86R is the most important mutation that promotes the growth of PR8 virus in Vero cells.

The titer of the virus in Vero cells was further analyzed, and the virus was inoculated with MOI=0.001. The PR8 virus containing the NS2 _K86R mutation (PR8-NS2 _K86R ) was able to obtain a higher virus titer 48 hours after infection with Vero cells. 30 times the PR8 virus titer (Fig. 3, A), plaque assays showed that the NS2 _K86R single point mutation has enabled the PR8 virus to produce a larger, distinct plaque similar to WSN (Fig. 3, B).

Example 3. Mutation of NS2 _K86R did not alter the antigenicity of PR8, as well as pathogenicity to mouse and chicken embryos.

In a mammalian cell culture system, the PR8 high-yield strain (PR8-NS2 _K86R ) has a faster growth rate than the PR8 wild-type virus, and the inventors need to measure whether the pathogenicity to mammals and birds is correspondingly increased. It is of great significance for the safe production of vaccines.

In order to examine whether the mutation of NS2K86R affects the antigenicity of HA expressed by the PR8 skeleton, the inventors performed a hemagglutination inhibition experiment of a PR8-NS2 _K86R high-yield strain using a specific antiserum against the PR8 virus HA protein, and the results showed that NS2 _K86R Mutation did not alter the antigen specificity of the high-yielding strain HA (Table 2). In order to measure whether the lethality of the PR8 high-yield strain (PR8-NS2 _K86R ) changes to the chicken embryo, the inventors determined the half-lethal lethal dose (ELD50) of the PR8, PR8-NS2 _K86R virus, and the results showed that the two viruses There was no significant difference in ELD50 (Table 1), indicating that the PR8 high-yield strain did not increase the virulence of the virus to chicken embryos. The present inventors measured the median lethal dose (MLD50) of the strains of the PR8, PR8-NS2 _K86R strains of the strains of female BALB/c mice of 6-8 weeks old (Table 1). The results showed that the MLD50 of the two strains did not differ much. This indicates that the PR8 high-yield strain does not increase the virulence of the virus to mammals.

Table 2

in conclusion

The present invention finds an amino acid site mutation that increases the growth rate of the virus in mammalian cells such as Vero cell culture system by recombining the PR8 strain with the WSN strain, namely: NS2 _K86R . This point mutation can greatly increase the yield of the PR8 strain in mammalian cell culture systems without increasing its pathogenic ability to mammals and chicken embryos. The invention provides a high-yield and safe adaptable improved vaccine virus strain which uses mammalian cells as a culture medium, and has great value for vaccine research and production.

All documents mentioned in the present application are hereby incorporated by reference in their entirety in their entireties in the the the the the the the the In addition, it should be understood that various modifications and changes may be made by those skilled in the art in the form of the appended claims.

Claims (15)

1. A mutant protein of the influenza A virus out nuclear transporter NS2, characterized in that the 86th amino acid of the mutant protein is mutated from K to R.
2. The mutein according to claim 1, wherein the amino acid sequence of the mutein is as shown in SEQ ID NO.: 2.
3. The mutein according to claim 1, wherein said mutein further comprises a derivative protein obtained by engineering based on said mutein, wherein said derivatized protein is included in the base of said mutein Substitution of one or more (usually 1-10, preferably 1-8, more preferably 1-6, 1-5, 1-3 or 1-2) amino acids A derivative protein containing an amino acid at position 86 of NS2 from K to an R mutation after insertion and/or substitution.
4. The mutein according to claim 1, wherein said derivative protein further comprises one or more additions (usually 1-10) at the C-terminus and/or N-terminus of said mutein. Preferably, it is 1-8, more preferably 1-6, 1-5, 1-3 or 1-2) amino acids.
5. An isolated polynucleotide, characterized in that the polynucleotide encodes the mutein of any of claims 1-4.
6. An expression vector comprising the polynucleotide of claim 5.
7. A host cell comprising the expression vector of claim 6, or the host cell has a chromosomal integration of the polynucleotide of claim 5.
8. A recombinant PR8 influenza A virus strain characterized in that the 86th amino acid mutation of the PR8 influenza A virus strain NS2 protein is mutated from K to R.
9. A virus rescue system characterized in that the viral rescue system comprises an expression vector expressing an influenza A virus out nuclear transporter NS2 mutein.
10. The viral rescue system according to claim 9, wherein said one or more expression vectors expressing a protein required for a wild-type PR8 influenza A virus strain comprise a vector expressing a protein selected from the group consisting of RNA polymerase PB2. (SEQ ID NO.: 41), RNA polymerase PB1 (SEQ ID NO.: 42), RNA polymerase PA (SEQ ID NO.: 43), hemagglutinin HA (SEQ ID NO.: 44), nuclear coat nucleoprotein NP (SEQ ID NO.: 45), ceramidase NA (SEQ ID NO.: 46), matrix protein M1 (SEQ ID NO.: 47), non-structural protein NS1 (SEQ ID NO.: 48), and matrix Protein M2 (SEQ ID NO.: 49).
11. A virus rescue system according to claim 10, wherein said wild type PR8 The sequence of the influenza A virus strain is shown in SEQ ID NO.: 50-57.
12. The viral rescue system according to claim 9, wherein said viral rescue system comprises an expression vector expressing the proteins of SEQ ID NO.: 2, and SEQ ID NOs.: 41-49.
13. Use of the mutant protein of any one of claims 1 to 4, or a gene encoding the same, the expression vector of claim 6, or the host cell of claim 7, wherein the recombinant PR8 of claim 8 is prepared. Influenza A strain.
14. A kit for producing the recombinant PR8 influenza A virus strain according to claim 8, wherein the kit comprises the virus rescue system according to claim 9.
15. A method for producing the recombinant PR8 influenza A virus strain according to claim 8, comprising the steps of:

    (a) providing the virus rescue system of claim 9, comprising an expression vector expressing an influenza A virus out nuclear transporter NS2 mutein, and another expression vector expressing a protein required for a wild type PR8 influenza A virus strain; Other expression vectors for the protein required for the wild-type PR8 influenza A virus strain include a vector expressing a sub-histone: RNA polymerase PB2, RNA polymerase PB1, RNA polymerase PA, hemagglutinin HA, nuclear coat nucleoprotein NP, Ceramidease NA, matrix proteins M1 and M2, and non-structural protein NS1;

    (b) transfecting the virus rescue system in the step (a) with a host cell, culturing the host cell, thereby obtaining the recombinant PR8 influenza A virus strain of claim 8.

Images