CN105671002A - Construction and application of H9N2-subtype avian influenza virus cell high-yield vaccine strain - Google Patents
Construction and application of H9N2-subtype avian influenza virus cell high-yield vaccine strain Download PDFInfo
- Publication number
- CN105671002A CN105671002A CN201510648976.4A CN201510648976A CN105671002A CN 105671002 A CN105671002 A CN 105671002A CN 201510648976 A CN201510648976 A CN 201510648976A CN 105671002 A CN105671002 A CN 105671002A
- Authority
- CN
- China
- Prior art keywords
- avian influenza
- strain
- influenza virus
- cell
- vaccine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of animal vaccine preparation and particularly relates to construction and application of an H9N2-subtype avian influenza virus cell high-yield vaccine strain. The cell vaccine strain is prepared through artificially induced mutation screening of an avian influenza isolate and is named H9N2-subtype avian influenza virus W1-HA358 strain, of which an original isolate is A/duck/Hubei/W1/2004 (H9N2) strain. The 3rd, 5th and 8th loca of a 3'-terminal of an HA gene non-coding region of the isolate are subjected to artificial site-specific mutagenesis, and a mutation strain is saved through reverse genetic operation, wherein the mutation strain is subjected to passage on an MDCK cell until a stable generation to obtain a high-proliferation-titer virus strain, thereby producing the H9N2-subtype avian influenza virus cell vaccine. The invention solves the problem of instable proliferation of the H9N2-subtype avian influenza on the MDCK cell, and overcomes a defect of shortage of large quantity of chick embryo during outbreak of the avian influenza, thereby increasing preparation efficiency of the vaccine.
Description
Technical field
The invention belongs to animal vaccine preparing technical field. Be specifically related to a strain H9N2 subtype avian influenza virus cell high yieldVaccine strain construction and application.
Background technology
H9N2 subtype avian influenza (Avianinfluenza, AI) is by causing a kind of biography after A type influenza infection poultryMetachromia syndrome, worldwide wide-scale distribution, the development of animal husbandry in serious threat. Within 1966, from turkey, detect firstH9N2 hypotype AIV, after this, AIV wide-scale distribution in bird is popular. 1994, China's reported first was divided from the chicken house of GuangdongFrom to H9N2 hypotype AIV, and after this H9N2 hypotype AIV always in the foster fowl area of China wide-scale distribution. Although H9N2 hypotype AIVBelong to low pathogenicity AIV, but now research shows that it can also infecting mouse, ferret and the mankind. In addition, can causeFowl laying rate declines, causes immunosupress and excite mixing or the scabies secondary infection of other viruses or bacterium, gives the foster fowl of ChinaIndustry causes serious economic loss. And the internal gene of H5N1 influenza virus all likely forms the internal gene of H9N2, thisCause the great attention of people to H9N2 avian influenza virus. 1999, there is people in Hong-Kong and infected H9N2 hypotype AIVEvent. To in December, 2009, Hong Kong detects H9N2AIV the 7th time on the person again. This shows, H9N2AIV can from bird toMammal crosses over species obstacle and propagates, thereby has expanded host range. 2013, there is H7N9 avian flu in ChinaPoison infects people's event, causes 134 people to infect and 45 people's death. Till on February 23rd, 2014 always has 213 people and infects 66 peopleDead. Show according to avian influenza virus genome alignment and parentage analysis, 6 genetic fragments of H7N9 virus derive fromH9N2AIV. This shows, H9N2 likely becomes in the future popular one virus, should cause the attention of height. Therefore, forThe sound development of human health and livestock economy, must strengthen the prevention and control to H9N2 hypotype AIV.
Vaccine inoculation is that birds flu-preventing occurs and propagates the most effective means. From flu outbreak in 1878 till now, chickenEmbryo inactivated vaccine is one of important vaccine of birds flu-preventing generation always. At present, the H9N2 hypotype AIV vaccine that China is usedBe chick embryo allantoic liquid inactivated vaccine. Chicken embryo is the main material that avian influenza vaccine is produced and studied. Although chicken embryo inactivated vaccine toolHave the advantages such as convenience is transported, and preparation technology is simple, safety and stability, but also there is following many frauds in chicken embryo culture influenza virusEnd: (one), in influenza large-scale outbreak, collecting in a short time 9-10 day instar chicken embryo is very difficulty. (2) use chicken embryo cultureInfluenza virus, easily produces the residual of a large amount of discarded chicken embryos and virus thereof, is discharged in nature very large to environmental hazard. (3)Be subject to the impact of maternal antibody; (4) shortcomings such as production cost is high, periodicity is long. A large amount of chicken embryos when overcoming Avian InfluenzaShortage problem and long shortcoming of production cycle, by utilizing reverse genetic manipulation technology, transform viral internal gene, improveThe viral titer of H9N2 avian influenza virus in mdck cell. The method of cultivating AIV with cell replaces the vaccine with chicken embryo production AIVMethod, change traditional method, improve H9N2 subtype avian influenza vaccine inactivation immunogenic production process.
Summary of the invention
The object of the invention is to overcome the conventional method of present use chicken embryo culture avian influenza virus, obtain a kind of carefullyThe upper stable cell vaccine of breeding and thering is high virus titer of born of the same parents.
Technical scheme of the present invention is as follows:
The original separated strain H9N2 avian flu strain A/duck/ of the vaccine strain of H9N2 bird flu cell vaccine of the present inventionHubei/W1/2004 (H9N2) be applicant 2004 separate at Hubei chicken house and obtain [referring to: Xiao ?JuanXu, Gao ?YuanXu,Hong‐BoZhou,Zheng‐JunYu.EvolutionarycharacterizationofinfluenzavirusA/duck/Hubei/W1/2004(H9N2)isolatedfromcentralChinaVirusGenes.2008Feb; 36 (1): 79 ?83.Epub2007Nov20]; By in A/chicken/Hubei/W1/2004 (H9N2)8 internal gene fragments (its nucleotide sequence has been incorporated in NCBI), be cloned into respectively transcribe/expression vector pWH2000Upper (doctor Webster of St.Jude child study hospital of the U.S. is so kind as to give), builds and obtains 8 plasmids. Build the inside base of W1 strainThe carrier of cause respectively called after PWH2000-PB2, PWH2000-PB1, PWH2000-PA, PWH2000-NP, PWH2000-NA,PWH2000-HA, PWH2000-M, PWH2000-NS, wherein the base in called after PWH2000-HA plasmid 3,5,8 sites is carried outArtificial mutation (sudden change direction is: G3 → A3, U5 → C5 and C8 → U8), builds and obtains a mutant plasmid, then utilizes oppositelyGenetic Manipulative Technology, by this mutant plasmid and all the other 7 inner influenza genetic fragments, by all the other 7 plasmids that build of W1 andMutant plasmid cotransfection 293T+MDCK cell mixing, rescue obtains H9N2 avian influenza virus mutant strain W1-HA358, by describedH9N2 avian flu sudden change strain W1-HA358 goes down to posterity on mdck cell, obtains the poison that high value-added titre stabilized cell adapt toStrain, will detect its immunogenicity as oil emulsion inactivated vaccine after its deactivation, proves that the vaccine strain that builds gained has good immunityOriginality.
Applicant by this cell adapted strain called after H9N2 subtype avian influenza virus W1 ?HA358 strain, in 2015 6The moon is delivered China on the 11st. Wuhan. and the center preservation of Wuhan University's Chinese Typical Representative culture collection, deposit number is: CCTCCNO:V201522。
Compared with prior art, advantage of the present invention is;
(1) the present invention utilizes avian influenza virus H9N2 as a setting, and the base in 3,5,8 sites of the 3' end of HA gene is enteredRow artificial mutation, then saves and obtains the strain that suddenlys change. This sudden change strain has better adaptability on mdck cell, improvesVirus titer.
(2) the sudden change strain that prepared by the present invention goes down to posterity and obtains the cell adapted strain of high proliferation titre on mdck cell,While being conducive to alleviate Avian Influenza, need a large amount of chicken embryos and chicken embryo shortage problem badly.
More detailed technical scheme is with reference to seeing shown in " specific embodiments ".
Brief description of the drawings
Sequence table SEQ IDNO:1 is H9N2 bird flu isolate A/chicken/Hubei/W1/2004 (H9N2) insideThe DNA sequence dna of gene HA, sequence length is 1472bp.
Sequence table SEQ IDNO:2 is H9N2 bird flu isolate A/chicken/Hubei/W1/2004 (H9N2) insideThe DNA sequence dna of gene NA, sequence length is 1457bp.
Sequence table SEQ IDNO:3 is H9N2 bird flu isolate A/chicken/Hubei/W1/2004 (H9N2) insideThe DNA sequence dna of gene M gene, sequence length is 1027bp.
Sequence table SEQ IDNO:4 is H9N2 bird flu isolate A/chicken/Hubei/W1/2004 (H9N2) insideThe DNA sequence dna of gene NP, sequence length is 1565bp.
Sequence table SEQ IDNO:5 is H9N2 bird flu isolate A/chicken/Hubei/W1/2004 (H9N2) insideThe DNA sequence dna of gene NS gene, sequence length is 890bp.
Sequence table SEQ IDNO:6 is H9N2 bird flu isolate A/chicken/Hubei/W1/2004 (H9N2) insideThe DNA sequence dna of gene PA, sequence length is 2233bp.
Sequence table SEQ IDNO:7 is H9N2 bird flu isolate A/chicken/Hubei/W1/2004 (H9N2) insideThe DNA sequence dna of gene PB1, sequence length is 2341bp.
Sequence table SEQ IDNO:8 is H9N2 bird flu isolate A/chicken/Hubei/W1/2004 (H9N2) insideThe DNA sequence dna of gene PB2, sequence length is 2341bp.
Sequence table SEQ IDNO:9 is the DNA sequence dna of the universal primer Uni12 of amplification related gene.
Sequence table SEQ IDNO:10 is the upstream primer of the primer pair of amplification HA gene (accession number: DQ465400.1).
Sequence table SEQ IDNO:11 is the downstream primer of the primer pair of HA gene (accession number: DQ465400.1).
Sequence table SEQ IDNO:12 is the upstream primer of the primer pair of amplification NA gene (accession number: DQ465402.1).
Sequence table SEQ IDNO:13 is the downstream primer of the primer pair of amplification NA gene (accession number: DQ465402.1).
Sequence table SEQ IDNO:14 is the upstream primer of the primer pair of amplification M gene (accession number: DQ465403.1).
Sequence table SEQ IDNO:15 is the downstream primer of the primer pair of amplification M gene (accession number: DQ465403.1).
Sequence table SEQ IDNO:16 is the upstream primer of the primer pair of amplification NP gene (accession number: DQ465401.1).
Sequence table SEQ IDNO:17 is the downstream primer of the primer pair of amplification NP gene (accession number: DQ465401.1).
Sequence table SEQ IDNO:18 is the upstream primer of the primer pair of amplification NS gene (accession number: DQ465404.1).
Sequence table SEQ IDNO:19 is the downstream primer of the primer pair of amplification NS gene (accession number: DQ465404.1).
Sequence table SEQ IDNO:20 is the upstream primer of the primer pair of amplification PA gene (accession number: DQ465399.1).
Sequence table SEQ IDNO:21 is that draw in the right downstream of primer pair of amplification PA gene (accession number: DQ465399.1)Thing.
Sequence table SEQ IDNO:22 is the upstream primer of the primer pair of amplification PB1 gene (accession number: DQ465398.1).
Sequence table SEQ IDNO:23 is the downstream primer of the primer pair of amplification PB1 gene (accession number: DQ465398.1).
Sequence table SEQ IDNO:24 is the upstream primer of the primer pair of amplification PB2 gene (accession number: DQ465397.1).
Sequence table SEQ IDNO:25 is the downstream primer of the primer pair of amplification PB2 gene (accession number: DQ465397.1).
Fig. 1: be the original plasmid map of PHW2000 relating in the present invention. This plasmid is for building reverse genetic manipulationThe original plasmid of 8 plasmids.
Fig. 2: the each segment cDNA of influenza virus is cloned into pHW2000 vector construction schematic diagram.
Fig. 3: influenza virus HA3 ?5 ?8 mutation construction schematic diagrames.
Fig. 4: be the PCR figure that the present invention relates to W1 strain complete genome sequence clone. Description of reference numerals: swimming lane from left to rightBe followed successively by: DL15000marker; PB2, PBI, PA; DL2000marker; HA, NP, NA; DL2000marker; M, NS.
Fig. 5: the PCR figure of HA gene (number of logging in: DQ465400) 3-5-8 site mutation. Description of reference numerals: swimming lane successivelyFor: Plus2000marker; The plasmid amplification electrophoresis result of PHW2000-HA3-5-8.
Fig. 6: be that sudden change strain prepared by the present invention is bred the result going down to posterity on mdck cell.
Specific embodiments
Embodiment 1: the complete genome infectious clone of avian influenza virus isolate A/chicken/Hubei/W1/2004 strain
1, the extraction of avian influenza virus isolate A/chicken/Hubei/W1/2004RNA
From-80 DEG C of refrigerators, take out chick embryo allantoic liquid avian influenza virus isolate A/chicken/Hubei/W1/ for subsequent use2004 (being called for short virus), [referring to: Xiao-JuanXu, Gao-YuanXu, Hong-BoZhou, Zheng-JunYu.EvolutionarycharacterizationofinfluenzavirusA/duck/Hubei/W1/2004(H9N2)isolatedfromcentralChinaVirusGenes.2008Feb；36(1):79-83.Epub2007Nov20] be placed under room temperature and dissolve, get 300 μ L virus liquids and join and be equipped with in 1mLTrizol1.5mLEP pipe, gentlyTurn upside down, be placed on ice bath 15min on ice; Then add 200 μ L chloroforms, mix 15s with oscillator vortex, place quiet on icePut 10min, with 4 DEG C, the centrifugal 10min of 12000r/min, gets supernatant (avoiding being drawn onto white precipitate) and moves into a new 1.5mLEPPipe, adds isopyknic isopropyl alcohol, turns upside down and mixes, and room temperature is placed 10min, and the centrifugal 10min of room temperature 12000r/min, abandonsClearly, add 1mL75% ethanol, the centrifugal 10min of room temperature 12000r/min, inhales and abandons ethanol, EP pipe is placed in to super-clean bench air-dry,After RNA precipitation is dissolved in to the DEPC water of 10 μ l, put-80 DEG C and save backup that (the general employing effect of reversing is immediately better, avoids RNADegraded by airborne RNA enzyme).
2, design of primers is synthetic
The universal primer of 8 full-length gene fragments of all A type influenza viruses of being used for increasing is as follows. Primer is given birth to by ShanghaiThing Engineering Co., Ltd is synthetic, and the nucleotide sequence of concrete primer is as follows:
Reverse transcription universal primer Uni12primer:5 ' AGCAAAAGCAGG3 ' (SEQIDNO:9)
(1) primer pair of amplification HA gene (accession number: DQ465400.1):
P15’TATTCGTCTCAGGGAGCAAAAGCAGGGG3’(SEQIDNO：10)
P25’ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT3’(SEQIDNO：11)
(2) primer pair of amplification NA gene (accession number: DQ465402.1):
P15’TATTCGTCTCAGGGAGCAAAAGCAGGAGT3’(SEQIDNO：12)
P25’ATATCGTCTCGTATTAGTAGAAACAAGGAGTTTTTT3’(SEQIDNO：13)
(3) primer pair of amplification M gene (accession number: DQ465403.1):
P15’TATTCGTCTCAGGGAGCAAAAGCAGGTAG3’(SEQIDNO：14)
P25’ATATCGTCTCGTATTAGTAGAAACAAGGTAGTTTTT3’(SEQIDNO：15)
(4) primer pair of amplification NP gene (accession number: DQ465401.1):
P15’TATTCGTCTCAGGGAGCAAAAGCAGGGTA3’(SEQIDNO：16)
P25’ATATCGTCTCGTATTAGTAGAAACAAGGGTATTTTT3’(SEQIDNO：17)
(5) primer pair of amplification NS gene (accession number: DQ465404.1):
P15’TATTCGTCTCAGGGAGCAAAAGCAGGGTG3’(SEQIDNO：18)
P25’ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT3’(SEQIDNO：19)
(6) primer pair of amplification PA gene (accession number: DQ465399.1):
P15’TATTCGTCTCAGGGAGCAAAAGCAGGTAC3’(SEQIDNO：20)
P25’ATATCGTCTCGTATTAGTAGAAACAAGGTACTT3’(SEQIDNO：21)
(7) primer pair of amplification PB1 gene (accession number: DQ465398.1):
P15’TATTCGTCTCAGGGAGCAAAAGCAGGCA3’(SEQIDNO：22)
P25’ATATCGTCTCGTATTAGTAGAAACAAGGCATTT3’(SEQIDNO：23)
(8) primer pair of amplification PB2 gene (accession number: DQ465397.1):
P15’TATTCGTCTCAGGGAGCAAAAGCAGGTC3’(SEQIDNO：24)
P25’ATATCGTCTCGTATTAGTAGAAACAAGGTCGTTT3’(SEQIDNO：5)
3, the reverse transcription of avian influenza A/chicken/Hubei/W1/2004 viral RNA
In 20 μ l reverse transcription systems, carry out, add successively component as described in Table 1, mix on rearmounted PCR instrument in 42 DEG CCarry out reverse transcription reaction 60min, product is directly used in PCR or is placed in 4 DEG C and saves backup.
Table 1: the reverse transcription system of avian influenza virus A/chicken/Hubei/W1/2004 viral RNA
4, the pcr amplification of avian influenza virus A/chicken/Hubei/W1/2004cDNA
In PCR reaction tube, add the amplification system described in table 2. After being mixed, the system configuring carries out on PCR instrumentAmplification. Pcr amplification program is 94 DEG C of 5min of denaturation, 94 DEG C of 20sec of sex change, and the 58 DEG C of 30sec that anneal, extend 72 DEG C of 5min, fortune30 circulations of row are finally extended 10min after 72 DEG C. Establish the negative control without template simultaneously. After reaction finishes, PCR product is eachGet 5 μ l, carry out electrophoretic analysis on 1.0% Ago-Gel, residue is put 4 DEG C and is saved backup.
Table 2: the pcr amplification system of avian influenza virus A/chicken/Hubei/W1/2004cDNA
| Trans-T DNA | 1.0μl |
| dNTP Mixture | 2.0μl |
| PCR Buffer | 5.0μl |
| P1(10μm) | 2.0μl |
| P2(10μm) | 2.0μl |
| CDNA template | 2.0μl |
| RNase freed H2O | 36.0μl |
| Reaction cumulative volume | 50 μ l/ samples (Sample) |
5, the retrieve and purification of PCR product
After electrophoresis finishes, under ultraviolet light, cut the Ago-Gel of target DNA fragment from gel, reclaim fast with DNAKit (purchased from Shanghai Sheng Gong bioengineering Co., Ltd) reclaims DNA. Concrete grammar is as follows: cuts target DNA and reclaims fragment,The EP pipe of putting into an aseptic 1.5mL, adds 500-750 μ lBindingBuffer, in 50-60 DEG C of water-bath 5min, therebetweenFlick EP pipe, gel is dissolved completely. Then by liquid rotating to the recovery post dissolving, leave standstill 2min, 8000r/ in room temperatureMin, centrifugal 1min, outwells the waste liquid in collecting pipe, and with 500 μ lWashingsolution8000r/min, centrifugal 1min, washesTwice; The last centrifugal 15s of 12000r/min, goes in a clean 1.5mLEP pipe reclaiming post, adds 10-20 μ lddH2O washesDe-, place 5min in room temperature, the centrifugal 1min of 12000r/min, is the DNA fragmentation of recovery in collecting pipe, can be directly used in DNAConnect, also can save backup in-20 DEG C.
6, coupled reaction
The PCR product of recovery is directly linked to pMD18-T carrier (purchased from precious bioengineering Dalian Co., Ltd), connectorSystem is as table 3. After system configurations is good, linked system is put in to the connection of spending the night in 16 DEG C of water-baths.
Table 3 linked system
| pMD18-T vector DNA | 1.0μl |
| Ligation Solution I | 9.0μl |
| PCR reclaims product | 10.0μl |
| Reaction cumulative volume | 20 μ l/ samples (Sample) |
7, connect the conversion of product
The competent cell DH5 α that gets the fresh preparation of 100 μ l is placed on ice. Add 10 μ l to connect product, after mixing, ice bath30min. 42 DEG C of heat shock 90s, ice bath 2min, makes it cooling. Add 400 μ lLB to mix, 220r/min, 37 DEG C of shaking tables are cultivatedAfter 45min in 5000r/min centrifugal 5 minutes, inhale and abandon 300 μ l supernatants, after resuspended thalline, draw 200 μ l nutrient solutions, coating resistanceOn flat board. Cultivate 10h-12h for 37 DEG C and can occur single bacterium colony.
8, PCR identifies positive recombinant plasmid
The program of PCR screening positive clone is as follows: the EP that gets the 0.5ml of sterilizing manages 8-12, adds successively in every pipeThe sterilizing distilled water of 30 μ l. With the single bacterium colony on sterilizing rifle head scraping plate, in EP pipe, to make several times thalline be suspended in two for pressure-vaccumSteam in water. The aseptic 10 μ l thalline suspensions of getting of each sample are cultivated use, remaining 20 μ l boiling water water-baths in order to further expanding10min, the centrifugal 5min of 12000r/min, gets supernatant 5 μ l and makes pcr template. Pcr amplification goes out to expect the sample of object fragment, gets itCorresponding thalline suspension expands to be cultivated, and prepares plasmid order-checking and uses. For the identification of PCR program with amplification this gene program phaseWith, concrete PCR system is as table 4.
Table 4PCR identification system
| Trans-Taq DNA | 0.5μl |
| dNTP Mixture | 1.0μl |
| Trans-Taq PCR Buffer | 2.0μl |
| P1(10μm) | 1.0μl |
| P2(10μm) | 1.0μl |
| Template | 5.0μl |
| RNase freed H2O | 9.5μl |
| Reaction cumulative volume | 20 μ l/ samples (Sample) |
8 genes of the positive colony that above-mentioned screening is obtained, each gene selects 4 samples to serve the biological work of the raw work in seaJourney Co., Ltd checks order, and then uses software DNAStar4.0 to compare to the sequence of order-checking.
9, plasmid is little carries
Adopt plasmid extraction kit (purchased from Beijing Quanshijin Biotechnology Co., Ltd)
(1) the single bacterium colony transforming on random picking flat board, is seeded to 5mL containing antibiotic (Amp, final concentration is 0.1%)LB nutrient solution in, 37 DEG C of 300r/min shaken cultivation are spent the night;
(2) get 2mL bacterium liquid and add in a new EP pipe, with the centrifugal 2min of 12000r/min, collect thalline, until cultivateLiquid collects, supernatant discarded, collecting precipitation;
(3) add 250 μ LP1 solution (kit carries) (add RnaseA before use, be put in 4 DEG C of Refrigerator stores) heavyOutstanding bacterial sediment, thoroughly resuspended even to thalline;
(4) add 250 μ LP2 solution (kit carries), then leniently spin upside down 4-7 time and evenly mix, make bacteriumThe complete cracking of body, room temperature is placed;
(4) add 350 μ LP3 solution (kit carries), leniently spin upside down and mix for 4-7 time immediately, untilThere is white flocculent deposit, treat that liquid color is transparent by yellow; Then at room temperature centrifugal with 12000r/min10min, carefully draws supernatant, tries not to suck precipitation;
(5) previous step gained supernatant is added to (adsorption column has been put into collecting pipe) in adsorption column, at room temperature leave standstill2min, then, with the centrifugal 60s of 12000r/mim, outwells the waste liquid in collecting pipe. If gained supernatant volume is greater than 750 μ L, canTo add several times in adsorption column, again centrifugal, outwell waste liquid;
(6) toward the WashingBuffer that adds 600 μ L in adsorption column, with the centrifugal 1min of 12000r/mim, outwell collectionWaste liquid in pipe;
(7) repeating step (6);
(8) adsorption column is put into collecting pipe again, the centrifugal 2min of 12000r/min removes Washing as far as possible completelyBuffer, in order to avoid residual ethanol impact wherein;
(9) take out adsorption column, put into a clean new EP pipe, add 20-unsettled adding at the mid portion of adsorbed film50 μ L elution buffer (Elutionbuffer; The source of elution buffer or its formula and collocation method are provided, is used wash-outBefore buffer solution, after 65-75 DEG C of heating water bath, elute effect is better), room temperature is placed 2min, with the centrifugal 3min of 12000r/min,Collect DNA;
(10) save backup in-20 DEG C after getting 0.1 μ LDNA plasmid UV spectrophotometer measuring concentration.
10, the structure of PHW2000 recombinant plasmid
The plasmid of said extracted is carried out to enzyme and cut, use BsmBI linearized vector pHW2000 (U.S. St.Jude children simultaneouslyResearch doctor Webster of hospital is so kind as to give, and plasmid map as shown in Figure 1). Wherein PB1, PA, HA, NA, M and NS genetic fragment (sheetDuan Xulie is with the sequence shown in " brief description of the drawings ") cut with BsmBI enzyme, after reclaiming, the carrier pHW2000 of collinearity is connected. WithBsmBI enzyme is cut after PB2 genetic fragment, produces 1.9kb and 0.4kb two bands; With BsaI enzyme cut NP genetic fragment produce 1.1kb and0.4kb two bands. After two bands are reclaimed together, be connected with linearizing carrier pHW2000 respectively, three fragments are connectedConnect. Transform bacillus coli DH 5 alpha competent cell with connecting product, the single bacterium colony of picking after transforming, shakes bacterium, little upgrading grain. WithEnzyme cuts and PCR method (employing conventional method) carrys out screening positive clone. Positive colony of gained is served to the raw work biology in seaAfter Engineering Co., Ltd's qualification, prove that sequence connects correct.
11, result
(1) the full genomic clone of W1 strain
Utilize disclosed 8 pairs of primer amplification whole genome sequences in step 2 (design of primers synthetic) (PB1, PB2, PA, HA,NP, NA, M, NS) target gene, obtain 8 fragments of W1 influenza virus pnca gene, clip size for be about successively 2.3kb,2.3kb, 2.2kb, 1.7kb, 1.5kb, 1.4kb, 1.0kb and 0.9kb (as shown in Figure 2).
Build PHW2000-HA358 mutant plasmid
By the primer of the synthetic HA3-5-8 site mutation of Shanghai bioengineering Co., Ltd, the nucleotide sequence of primer is as 5Show:
The primer of table 5HA3-5-8 site mutation
Design a pair of primer that has 10 base reverse complementals containing catastrophe point, as described in Table 5. With the DNA polymerization of high-fidelityThe primerStarPCR full DNA (HA-PHW2000) that increases, runs glue qualification (the results are shown in Figure 3), processes 3.5h with DpnI enzymeRemove the template plasmid that do not methylate, after conversion, choose several bacterium colony order-checking qualifications mutational site. PCR system is as table 6:
Table 6PCR system
| primerstar Taq DNA | 1.0μl |
| dNTP Mixture | 2.0μl |
| primerstar PCR Buffer | 5.0μl |
| P1(10μm) | 2.0μl |
| P2(10μm) | 2.0μl |
| Template | 1.0μl |
| RNase freed H2O | 37.0μl |
| Reaction cumulative volume | 50 μ l/ samples (Sample) |
Embodiment 2: rescue and the Observation of biological characteristics thereof of sudden change strain W1-HA358 avian influenza virus
1, go the extraction of endotoxin plasmid
Adopt Omega company produce without the little extraction reagent kit (Endo-freePlasmidMini of the ultrapure plasmid of endotoxinKitII) extract plasmid. Concrete steps are as follows:
(1) by pHW2000-PB1, pHW2000-PB2, pHW2000-PA, pHW2000-HA358, pHW2000-NA,PHW2000-NP, pHW200-M, the Escherichia coli bacteria liquid that the plasmid that eight of pHW2000-NS have built is preserved is inoculated in 100mLLB fluid nutrient medium in, then at 37 DEG C of shaking table incubated overnight Escherichia coli 12-16h.
(2) all 100mL bacterium liquid is added in 50mL centrifuge tube, trim, at 4 DEG C, 12000r/min is centrifugal, and 8min discardsCulture medium supernatant, collects thalline.
(3) abandon supernatant, in precipitation, add appropriate physiological saline or the resuspended thalline of PBS, divide and install in the EP pipe of 2mL,At 4 DEG C, the centrifugal 2min of 12000r/min discards culture medium supernatant, collects thalline.
(4) abandon supernatant, add the resuspended thalline of SolutionI solution (adding RNaseA) of 500 μ L.
(5) add the SolutionII solution of 500 μ L, put upside down and mix 7-10 time gently, (in advance will until supernatant is limpidBufferN3 is placed on ice, and centrifuge is cooled to 4 DEG C.
(6) add the BufferN3 (kit carries) of 250 μ L ice baths, and leniently turn upside down centrifuge tube for several times extremelyTill white flocculent deposit forms (if there is yellow block on upper strata, being uncracked thalline), then at 4 DEG C, 12000r/The centrifugal 10min of min.
(7) supernatant is transferred in the EP pipe of new 1.5mL, again with 4 DEG C, the centrifugal 2min of 12000r/min.
(8) supernatant is transferred in the EP pipe of new 1.5mL, added the ETR of 0.1 times of volume, after mixing gently, be placed on iceUpper 10min, puts upside down several times every 2min that (ETR is blue solution, is loaded in white bottle, is stored in 4 DEG C of refrigerators, and this liquidThickness, absorption slowly, for removing endotoxin).
(9) after placing on ice, liquid is limpid, then is put into 5min in 42 DEG C of water-baths, and now liquid becomes muddy again,Under room temperature, with the centrifugal 10min of 12000r/min, now ETR is sunken to the pipe end.
(10) supernatant is transferred in new 2mLEP pipe, added the absolute ethyl alcohol of 0.5 times of volume, mix, leave standstill 2min;
(11) adding in advance 200-300 μ LbufferGPS to infiltrate in HiBindDNAMin post, leave standstill 5min,Under room temperature, with the centrifugal 30-60s of 12000r/min, outwell the liquid in collecting pipe;
(12) solution in step (10) is proceeded to the HiBindDNAMin post of new infiltration, each 700 μ L, leave standstill2min, with the centrifugal 30-60s of 12000r/min;
(13) discard the liquid in collecting pipe, add 500 μ LbufferHB to wash pillar, under room temperature with 12000r/min fromHeart 30-60s;
(14) discard the liquid in collecting pipe, add 700 μ L elution buffers (washingbuffer) (adding ethanol) to washPillar, under room temperature with the centrifugal 30-60s of 12000r/min;
(15) repeating step (14);
(16) pillar is relay and is reclaimed in collector, under room temperature with the centrifugal 2min of 12000r/min;
(17) pillar is put into new 1.5mLEP pipe, be put in 5min in 42 DEG C of incubators, simultaneously will be without endotoxin wash-outBuffer solution (Endo-freeElutionbuffer) is put into baking oven;
(18) get 70-100 μ LEB eluent, join pillar central authorities, leave standstill 2min, under room temperature with 12000r/min fromHeart 2min;
(19) get after 0.1 μ LDNA plasmid UV spectrophotometer measuring concentration, in-20 DEG C or-80 DEG C of refrigerators guarantorsDeposit for subsequent use.
2, the preparation of cell for transfection
(1) cultivate respectively MDCK with the DMEM culture medium that contains 10% hyclone (FBS) (buying from Thermo company)Cell and 293T cell, after cell covers with individual layer, with 0.25% trypsinization, after cell is dispelled, access appropriate cellTo 6 hole tissue culturing plates.
(2) wherein 293T+MDCK cell co-cultivation group meets 6 hole tissue culturing plates by cells ratio 1:1, treats cell densityWhile growing to 80%-90%, carry out transfection. Wherein, as the cell of transfection, its state must be excellent, only in this way just can provideSufficient enzyme is required for genetic transcription.
3, the cotransfection of eight plasmids
The method of 10 μ L liposome (lipofectin) transfection reagent by specification introductions is diluted to 90 μ L serum-free trainingsSupport in base OPTI-MEM (purchased from GIBCO company), room temperature is placed 5min, separately by 2-3 μ g mixings plasmid (contain PB2:PB1:PA:HA:NP:NA:M:NS (concentration ratio is 1:1:0.5:1:1:1:1:1) be diluted to 100 μ l serum free medium OPTI-MEM (purchased fromGIBCO company) in. Then the liposome (lipofectin) (purchased from Invitrogen company) of dilution is slowly dropped to mixingIn plasmid, pressure-vaccum more than 10 times, fully mixes gently, and room temperature, in conjunction with 20min, is established lipofectin contrast simultaneously, lack one orThe contrast of several plasmids. To in 6 hole tissue culturing plates, cultivate about 18-24h, 80%-90% abundance, shape is evenly distributed, growsThe 293T+MDCK cell that condition is good. Wash after twice with the DMEM culture medium of serum-free, antibiotic-free, then use OPTI-MEM culture mediumWash once, finally add 500 μ LOPTI-MEM culture mediums (purchased from GIBCO company) to be covered on cell; Add plasmid withThe bond of lipofectin (purchased from Invitrogen company) (totally 200 μ l), make its uniform fold on cell, at 37 DEG C,5％CO2In incubator, adsorb 8h, change to the DMEM culture medium 1mL containing 10% serum, use phosphate buffer after 30h (PBS, forConventional buffer solution) wash twice, finally adding containing final concentration is that 2.5 μ g/mLTPCK pancreatin are (limited purchased from the raw work bioengineering in ShanghaiCompany) serum-free DMEM culture medium 1mL, the cell that carefully blows off after 72h is collected together with supernatant.
4, the propagation of W1-HA358 avian influenza virus and qualification
Appropriate dual anti-(ammonia benzyl mycin 50mg/ml and kanamycins will be added in the cell of collecting after transfection and supernatant50mg/ml), after fully mixing, the SPF chicken embryo of inoculating 9-11 age in days with the amount of 0.2ml/ embryo is (logical moving purchased from Beijing Cimmeria dimensionThing experimental technique Co., Ltd), put 37 DEG C of cultivations, the death condition of observing chicken embryo every day is collected chick embryo allantoic liquid, then in good timeSurvey its blood clotting valency with red blood cell, be kept in-80 DEG C of refrigerators. Blind passage three generations on chicken embryo, exists W1-HA358 avian influenza virusStable propagation on it.
5, the experiment of the cell infection of W1-HA358 avian influenza virus and going down to posterity on mdck cell thereof
After mdck cell is cultured to individual layer, go down to posterity, the cell dispelling is evenly accessed in 6 hole tissue culturing plates, 37℃，5％CO2In incubator, being cultured to Cell abundance reaches more than 90%. After culture medium in cell is discarded, wash twice with PBS,After cell being washed once with the DMEM of serum-free again, add and be diluted to 10 with DMEM-1Allantoic fluid, in 37 DEG C, 5%CO2CultivateIn case, adsorb after 1h, add the DMEM maintenance medium containing the serum-free of 1.0 μ g/ml pancreatin, put 37 DEG C, 5%CO2In incubator, trainSupport. Get 25 μ L hole supernatants every 24h, measure blood clotting valency. Use the same method, the W1-HA358 avian influenza virus of getting previous generation continuesW1-HA358 avian influenza virus resumes generation, until can be stablized propagation (propagation result as shown in Figure 4) on cell.
6, avian flu strain W1-358 and the W1 of bird flu street strain organize half to cause infective dose (TCID50) mensuration
After mdck cell is cultured to individual layer, go down to posterity, the cell dispelling is evenly accessed to every hole in 96 hole tissue culturing plates100 μ L, at 37 DEG C, 5%CO2In incubator, being cultured to Cell abundance reaches more than 90%. After culture medium in cell is discarded, usePBS washes twice. Add with getting and freeze in-80 DEG C of refrigerators virus allantoic fluids, with serum-free DMEM culture medium by avian influenza virus from 10-1Be diluted to 10-6, each dilution factor virus inoculation 8 holes (0.1mL/ hole). Do two repetitions, be put in 37 DEG C of incubation 72h, detectCell culture medium supernatant blood clotting valency, calculates median infective dose (result is as table 7 and table 8) by Reed-Muench method formula.
Calculate and press Reed and the calculating of Muench method:
Distance proportion=(higher than percentage-50% of 50% pathology rate)/((higher than the percentage of 50% pathology rate-lower thanThe percentage of 50% pathology rate)
TCID50Logarithm=higher than the logarithm of the logarithm+distance proportion × coefficient of dilution of 50% viral dilution degree.
The TCID of the table 7 bird flu W1 of street strain50
The TCID of table 8 avian influenza virus mutant strain W1-HA35850
7, avian influenza virus chicken embryo median lethal dose (ELD50) mensuration
Get and freeze in-80 DEG C of refrigerator avian influenza virus allantoic fluids, with aseptic PBS by avian influenza virus from 10-2Be diluted to 10-7，5 pieces of chicken embryos of each dilution factor virus inoculation (0.2mL/ piece), are put in 37 DEG C of incubation 72h, dead giving up in 24h, soAfter chicken embryo is placed on to 4 DEG C of refrigerator overnight, detect allantoic fluid blood clotting, calculate median lethal dose by Reed-Muench method formula and (tieFruit is in table 9 and table 10).
The ELD of table 9 avian influenza virus mutant strain W1-HA35850
The ELD of the table 10 bird flu W1-358 of street strain50
Table 9 and table 10 result show, viral dilution degree is 10-5Time, the virulence of mutant strain W1-HA358 is compared the W1-of street strain358 virulence obviously decline.
Main bibliography
1.Xiao‐JuanXu,Gao‐YuanXu,Hong‐BoZhou,Zheng‐JunYu.EvolutionarycharacterizationofinfluenzavirusA/duck/Hubei/W1/2004(H9N2)isolatedfromcentralChinaVirusGenes.2008Feb；36(1):79‐83.Epub2007Nov20
2. an extra extra, utilizes Reverse Genetics to build the H9N2 influenza virus of cell high-adaptability. and Chinese animal passesThe journal of catching an illness, 2014,22 (2): 7-12
3.AzzehM etc., FunctionalanalysisoftheinfluenzaAviruscRNApromoterandconstructionofanambisensetranscriptionsystem.Virology.2001.289,400–410.
4.BaronMD&BarrettT.RescueofrinderpestvirusfromclonedcDNA.JournalofVirology,1997,71,1265-1271
5.BernadetteCrescenzo-Chaigne,DifferentialEffectofNucleotideSubstitutionsinthe3’ArmoftheInfluenzaAVirusvRNAPromoteronTranscription/ReplicationbyAvianandHumanPolymeraseComplexesIsRelatedtotheNatureofPB2AminoAcid627.Virology.2002.303,240–252
6.FinchC,LiW,DesignofAlternativeLiveAttenuatedInfluenzaVirusVaccines.InfluenzaPathogenesisandControl-VolumeII.SpringerInternationalPublishing,2015:205-235.
7.JohnSteel etc. .LiveAttenuatedInfluenzaVirusesContainingNS1TruncationsasVaccineCandidatesagainstH5N1HighlyPathogenicAvianInfluenza..J.Virol.2009,83(4):1742–1753
8.JadMaamary,AttenuatedInfluenzaVirusConstructwithEnhancedHemagglutininProteinExpression.J.Virol.2012,86(10):5782。
Claims (3)
- One strain artificial mutation have immunogenic H9N2 subtype avian influenza virus mutant strain W1 ?HA358, be deposited in ChinaTypical case's culture collection center, its preserving number is: CCTCCNO:V201522.
- A strain artificial mutation claimed in claim 1 have immunogenic H9N2 subtype avian influenza virus mutant strain W1 ?H9N2 subtype avian influenza cell vaccine prepared by HA358.
- A strain artificial mutation claimed in claim 1 have immunogenic H9N2 subtype avian influenza virus mutant strain W1 ?The application of HA358 in the H9N2 subtype avian influenza cell vaccine of preparation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510648976.4A CN105671002B (en) | 2015-10-09 | 2015-10-09 | The building of H9N2 subtype avian influenza virus cell high yield vaccine strain and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510648976.4A CN105671002B (en) | 2015-10-09 | 2015-10-09 | The building of H9N2 subtype avian influenza virus cell high yield vaccine strain and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105671002A true CN105671002A (en) | 2016-06-15 |
| CN105671002B CN105671002B (en) | 2019-08-30 |
Family
ID=56946948
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510648976.4A Active CN105671002B (en) | 2015-10-09 | 2015-10-09 | The building of H9N2 subtype avian influenza virus cell high yield vaccine strain and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105671002B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108913701A (en) * | 2018-08-13 | 2018-11-30 | 中国动物卫生与流行病学中心 | A method of improving H7N9 subtype avian influenza vaccine strain viral titer |
| CN109295011A (en) * | 2018-10-25 | 2019-02-01 | 扬州大学 | One strain vaccine strain rSN-R92G-E93K and its construction method and application |
| CN109880835A (en) * | 2019-03-28 | 2019-06-14 | 扬州大学 | Recombinate H9N2 avian flu strain, preparation method, avian influenza vaccine and its application |
| CN110305898A (en) * | 2019-06-18 | 2019-10-08 | 扬州大学 | The rescue of the non-susceptible H9N2 hypotype acclimatization to cold avian influenza virus of mammalian cell |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102526718A (en) * | 2010-12-30 | 2012-07-04 | 华中农业大学 | Recombinant H5N1 (Hemagglutinin 5 Neuraminidase 1) avian influenza virus cell vaccine and application thereof |
| CN104560888A (en) * | 2013-10-21 | 2015-04-29 | 华中农业大学 | Large-scale culture method of H9N2 subtype avian influenza virus |
-
2015
- 2015-10-09 CN CN201510648976.4A patent/CN105671002B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102526718A (en) * | 2010-12-30 | 2012-07-04 | 华中农业大学 | Recombinant H5N1 (Hemagglutinin 5 Neuraminidase 1) avian influenza virus cell vaccine and application thereof |
| CN104560888A (en) * | 2013-10-21 | 2015-04-29 | 华中农业大学 | Large-scale culture method of H9N2 subtype avian influenza virus |
Non-Patent Citations (3)
| Title |
|---|
| NCBI: "GenBank登录号：DQ465400.1", 《NCBI GENBANK》 * |
| XIAO-JUAN XU等: "Evolutionary characterization of influenza virus A/duck/Hubei/W1/2004 (H9N2) isolated from central China", 《VIRUS GENES》 * |
| 徐晓娟等: "禽流感病毒A/duck/Hubei/W1/2004(H9N2)的基因组序列分析及其分子进化", 《第15届世界禽病大会、中国畜牧兽医学会2007年学术年会论文集》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108913701A (en) * | 2018-08-13 | 2018-11-30 | 中国动物卫生与流行病学中心 | A method of improving H7N9 subtype avian influenza vaccine strain viral titer |
| CN108913701B (en) * | 2018-08-13 | 2020-08-28 | 中国动物卫生与流行病学中心 | Method for improving multiplication titer of H7N9 subtype avian influenza vaccine strain |
| CN109295011A (en) * | 2018-10-25 | 2019-02-01 | 扬州大学 | One strain vaccine strain rSN-R92G-E93K and its construction method and application |
| CN109295011B (en) * | 2018-10-25 | 2020-06-19 | 扬州大学 | Vaccine strain rSN-R92G-E93K and construction method and application thereof |
| CN109880835A (en) * | 2019-03-28 | 2019-06-14 | 扬州大学 | Recombinate H9N2 avian flu strain, preparation method, avian influenza vaccine and its application |
| CN109880835B (en) * | 2019-03-28 | 2022-03-25 | 扬州大学 | Recombinant H9N2 avian influenza virus strain, preparation method thereof, avian influenza vaccine and application thereof |
| CN110305898A (en) * | 2019-06-18 | 2019-10-08 | 扬州大学 | The rescue of the non-susceptible H9N2 hypotype acclimatization to cold avian influenza virus of mammalian cell |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105671002B (en) | 2019-08-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105420261B (en) | A kind of heat-resisting remodeling method of newcastle disease virus and application | |
| CN105671002A (en) | Construction and application of H9N2-subtype avian influenza virus cell high-yield vaccine strain | |
| CN102732545B (en) | Duck plague virus transfer vector pUC-deltagC-EGFP, and gC-deleted recombinant strain DPV-deltagC-EGFP | |
| CN108728419A (en) | Express aviadenovirus penton Protein reconstitutions newcastle disease vaccine Candidate Strain rAI4-penton and construction method | |
| CN102757942A (en) | Recombinant vaccine strain for foot-and-mouth disease type A as well as preparation method thereof and application thereof | |
| US11607448B2 (en) | Whole avian-origin reverse genetic system and its use in producing H7N9 subtype avian influenza vaccine | |
| CN105087645A (en) | Building and application of M protein three-amino acid site-mutated vesicular stomatitis virus (VSV) carrier for pigs | |
| CN110218706A (en) | Express the building and application of the recombinant herpesvirus of turkeys of H7N9 subtype highly pathogenic avian influenza virus HA albumen | |
| US11512117B1 (en) | Whole avian-origin reverse genetic system and recombinant H5N2 subtype avian influenza virus, vaccine and uses thereof | |
| CN106520710A (en) | Preparation method and application of live vector vaccine for expressing duck Tembusu virus (DTMUV) prm and E protein recombinant Newcastle disease virus (NDV) | |
| CN104353070B (en) | Genetic engineering subunit vaccine of chicken infectious bronchitis virus and preparation method thereof | |
| CN113151191A (en) | Pigeon Newcastle disease virus VI-HZ strain and application thereof | |
| CN102776156A (en) | Gene VIb subtype Rubulavirus Newcastle disease virus attenuated strain VIbI4 and construction method thereof | |
| CN112111503B (en) | Adenovirus vector bivalent vaccine for simultaneously preventing H5 and H9 subtypes of avian influenza and preparation method thereof | |
| CN104611299B (en) | H9N2 avian flus strain, preparation method, vaccine combination and its application of a kind of artificial recombination | |
| CN105582526A (en) | Application of trefoil factor 2 in preparation of medicine for treating and preventing lung/bronchial acute inflammation diseases | |
| CN102526718B (en) | Recombinant H5N1 (Hemagglutinin 5 Neuraminidase 1) avian influenza virus cell vaccine and application thereof | |
| CN102796708A (en) | Method for proliferating influenza A viruses | |
| CN107254450A (en) | The chimeric Newcastle Disease Virus Vaccine carrier Candidate Strain and construction method for overcoming newcastle disease maternal antibody to influence | |
| CN106967691A (en) | A kind of recombinant rabies virus for carrying IL-6 gene and its application | |
| CN103333916A (en) | Construction method and application of BHK cell line suitable for newcastle disease virus proliferation | |
| CN109943576A (en) | A kind of recombinant rabies virus of chimeric canine distemper virus principal immune gene and its application | |
| CN112891528B (en) | Vaccine strain for infectious bronchitis | |
| CN109293769A (en) | A kind of QX type avian infectious bronchitis virus positive serum and preparation method thereof | |
| CN104531690A (en) | Primers for obtaining genes of sheep interferon tau and preparation method for recombinant sheep interferon tau |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |