CN109880835A

CN109880835A - Recombinate H9N2 avian flu strain, preparation method, avian influenza vaccine and its application

Info

Publication number: CN109880835A
Application number: CN201910248018.6A
Authority: CN
Inventors: 石火英; 苏海龙
Original assignee: Yangzhou University
Current assignee: Yangzhou University
Priority date: 2019-03-28
Filing date: 2019-03-28
Publication date: 2019-06-14
Anticipated expiration: 2039-03-28
Also published as: CN109880835B

Abstract

The invention discloses a kind of PB2 mutated genes, mutein, recombinant vector and recombinant cells.The invention also discloses a kind of recombinant viruses and its preparation method and application.The invention also discloses a kind of H9N2 avian influenza virus vaccine and its applications.The present invention introduces 1185K on F/98 plants of H9N2 subtype avian influenza virus of PB2 gene respectively, the mutation of R355K amino acid, the F/98 plants of replication capacities in chicken embryo can be made to significantly increase, virus replication titre significantly increases, to improve production of vaccine efficiency, reduces production cost and provide a kind of effective technical method.The present invention has great market applicability and creates significant economic benefit.

Description

Recombinate H9N2 avian flu strain, preparation method, avian influenza vaccine and its application

Technical field

The invention belongs to production of vaccine fields, and in particular to recombination H9N2 avian flu strain, preparation method, bird flu Vaccine and its application.

Background technique

Bird flu is poultry caused by influenza A and the para-infectious highly contagious disease of wild fowl, is divided into height Pathogenic and low pathogenicity.H9N2 hypotype belongs to low pathogenicity influenza virus, can cause laying rate of poultry degradation, and hold Easily cause to be complicated by infection, causes serious economic loss.China is popular from outburst H9N2 influenza virus in 1998, and vaccine is in the disease It plays an important role in the prevention and control of disease, the immune effect of especially bird flu embryo poison oil-emulsion bacterin is extremely significant. The inactivated vaccine produced with H9N2 subtype avian influenza virus has preferable immunoprotection to poultry prevention H9N2 subtype avian influenza Effect.But there is the early dead rate of chicken embryo and final death rate height in process of production, average list embryo harvest yield is small, and potency is unstable The problems such as.Enough a variety of antigens cannot be accommodated in conventional immunizing dose, influence its immune efficacy；Obtain immune animal Enough avian influenza virus antigens must just increase injection dosage, to influence the application of vaccine.The effect of vaccine and its antigen Amount is positively correlated, and to obtain higher immune protective rate, enough amount of antigen are essential.The antigen for improving unit volume contains Amount is the key that production influenza virus vaccine.The polymerase of avian influenza virus is made of 3 heterotrimeric complex subunits, point It is not PB2, PB1 and PA albumen.PB2 and PB1 is basic protein, and PA is acidic protein.Researches show that the amino acid of polymerase Mutation will affect the virulence and replication capacity of virus.

In vitro by the infective molecule cloning of building RNA virus, i.e., the reverse genetics manipulation technology of RNA virus refers to By virus genome RNA reverse transcription at cDNA, various external manual operations are carried out to it in DNA molecular level, by viral base A technology of new RNA virus is assembled because of group cDNA and various auxilins.Since the RNA virus that final " rescue " goes out is come It, therefore, can be by the DNA circle section that is artificially added in pilot process, to rna virus cdna on DNA level derived from cDNA clone Group carries out various external manual operations, such as carries out gene mutation, gene knockout (missing), gene insertion, gene substitution and gene The transformation such as complementation, constructs new Strain.

Avian influenza vaccine is mainly inactivated vaccine at present, is mainly derived from chicken embryo amplification.But exist in process of production The problems such as early dead rate of chicken embryo and the final death rate are high, and average list embryo harvest two is small, and potency is unstable.Immune animal is set to obtain foot The avian influenza virus antigen of amount must just increase injection dosage, to influence the application of vaccine.The antigen for improving unit volume contains Amount is the key that production avian influenza virus vaccine.

Summary of the invention

Goal of the invention: technical problem to be solved by the invention is to provide a kind of PB2 mutated genes.

Also there is provided recombinant protein, recombinant vector, recombinant cell and recombinant viruses for technical problems to be solved by the present invention And preparation method thereof.

The last technical problems to be solved of the present invention are a kind of H9N2 avian influenza virus vaccine and its application.

Technical solution: in view of the above-mentioned problems, in order to improve titre of the avian influenza virus in chick embryo allantoic liquid, present invention benefit With reverse genetics manipulation technology, the Low Pathogenic Avian Influenza Virus chicken embryo height adapted strain A/ separated using China's Mainland in 1998 8 genes of F/98 plants of the gene constructed H9N2 subtype avian influenza virus of 8 of Chciken/Shanghai/F/98 (H9N2) turn Record/expression plasmid, and point mutation I185K or R355K are introduced on its PB2 gene, successfully save out recombinant virus rFPB2- I185K and rFPB2-R355K plants, and to its virulence, pathogenic and immune efficacy is identified.

In order to solve the above technical problems, The technical solution adopted by the invention is as follows: a kind of PB2 mutated genes, 554th nucleotide of the PB2 gene order of H9N2 avian influenza virus by T sport A and/or its in the 1064th nucleotide A is sported by G.

Wherein, its nucleotide sequence of PB2 gene order such as SEQ ID No:1 or SEQ ID No:3 institute after the mutation Show.

The content of present invention further includes a kind of PB2 mutein, the coding PB2 mutated genes, the recombination Protein sequence is as shown in SEQ ID No:2 or SEQ ID No:4.

The content of present invention further includes a kind of recombinant vector, contains the PB2 mutated genes, the saltant type egg It is white.

The content of present invention further includes a kind of recombinant cell, contains the PB2 mutated genes, the PB2 mutation Type albumen, the recombinant vector.

The content of present invention further includes a kind of recombinant virus rFPB2-I185K, contains the PB2 mutated genes, institute The PB2 mutein stated, the recombinant vector, recombinant cell.

The content of present invention further includes the preparation method of recombinant virus, comprising the following steps:

1) by carrying out rite-directed mutagenesis to F/98 plants of H9N2 avian influenza virus of PB2 gene, by the 554th nucleotide by T A is sported, or the 1064th nucleotide is sported into A by G and obtains PB2 mutated genes；

2) PB2 mutated genes are inserted into transcription or expression vector, obtain and contains PB2 mutated genes plasmid；

3) F/98 plants of 7 gene plasmids are mixed with PB2 mutated genes plasmid, cotransfection 393T cell is recombinated Virus.

Wherein, F/98 described in step 3) plants of 7 gene plasmids be respectively pHW202-PB1, pHW203-PA, 7 expression vector plasmids of pHW204-HA, pHW205-NP, pHW206-NA, pHW207-M and pHW208-NS.

The content of present invention further includes a kind of H9N2 avian influenza virus vaccine, and the H9N2 avian influenza virus vaccine includes immune The recombinant virus antigens of amount.

Wherein, the H9N2 avian influenza virus EID₅₀It is 10^-6.67/ 0.2mL or 10^-6.67/0.2mL。

The content of present invention further includes the H9N2 avian influenza virus vaccine in preparation prevention or treatment H9N2 bird flu Application in drug.

The present invention with F/98 plants (A/Chicken/Shanghai/F/98, H9N2) be skeleton, using Reverse Genetics side Method introduces the mutation of the amino acid of I185K or R355K respectively in F/98 plants of PB2 gene, saves out PB2 gene containing a little The recombinant virus of mutation.

It comprises the concrete steps that:

(1) first construct F/98 plant of H9N2 subtype avian influenza virus 8 genes transcription/expression plasmid, i.e., transcribe/ In expression vector pHW2000, F/98 plants of 8 gene cDNAs are inserted respectively, are respectively formed 8 transcriptions/expression vector plasmid: 201(PB2),202(PB1),203(PA),204(HA),205(NP),206(NA),207(M),208(NS)；

(2) then using F/98 plants of PB2 gene as template, by molecular cloning methods such as overlap PCR, at F/98 plants PB2 segment 554 introducing T to A base mutation (I185K), insertion transcription/expression vector pHW2000 in；2 are obtained respectively A transcription/expression vector containing PB2 amino acid mutation: i.e. pHWPB2-I185K；

(3) rFPB2-I185K plants of recombinant virus are saved out using Reverse Genetics.

(4) by the four anti-continuous 10 times of doubling dilutions of PBS of recombinant virus, from 10^-4To 10^-11By each dilution through allantois Chamber approach is inoculated with 5 piece of 10 age in days SPF chicken embryo, and 0.2mL/ pieces, 37 DEG C are incubated for.Dead embryo in for 24 hours is discarded, it is sterile to collect for 24 hours extremely The dead and not dead chick embryo allantoic liquid of 120h, measures its HA potency.The dead feelings of chicken embryo are observed and recorded in time simultaneously every 12h Condition is calculated the EID of virus to be measured by Reed-Muench formula₅₀。

The utility model has the advantages that the present invention introduces I185K on F/98 plants of H9N2 subtype avian influenza virus of PB2 gene respectively, The mutation of R355K amino acid can be such that the F/98 plants of replication capacities in chicken embryo significantly increase, and virus replication titre significantly increases Height reduces production cost and provides a kind of effective technical method to improve production of vaccine efficiency.Avian influenza virus of the invention RFPB2-I185K plants of EID₅₀It is 10^-16.25/ 0.2mL, and the EID of maternal F/98 plants of virus₅₀It is 10^-6.67/ 0.2mL, with female parent Virus compares, the EID that rFPB2-I185K plants of mutant strain₅₀Improve 9 × 10⁹Again (P < 0.001).The result shows that in PB2 gene I185K, R355K amino acid can significantly improve duplication titre of the H9N2 influenza virus in chick embryo allantoic liquid.The present invention has Great market applicability and create significant economic benefit.

Detailed description of the invention

RFPB2-I185K and rFPB2-R355K plants of building flow charts of Fig. 1 avian flu strain.

F/98 plants of full-length genome PCR amplification figures of Fig. 2；M indicates that DL2000DNAMarker, swimming lane 1 indicate PB2-1 gene, Swimming lane 2 indicates that PB2-2 gene, swimming lane 3 indicate that PB1-1 gene, swimming lane 4 indicate that PB1-2 gene, swimming lane 5 indicate PA-1 gene, swimming Road 6 indicates that PA-2 gene, swimming lane 7 indicate that HA gene, swimming lane 8 indicate that NP gene, swimming lane 9 indicate that NA gene, swimming lane 10 indicate M base Cause, swimming lane 11 indicate NS gene；

The full PB2 gene PCR of rFPB2-I185K and rFPB2-R355K plants of Fig. 3 avian flu strain expands electrophoretogram；M is indicated DL2000DNA Marker, swimming lane 1 indicate that rFPB2-I185K plants of PB2-1 genes, swimming lane 2 indicate rFPB2-I185K plants of PB2-2 Gene, swimming lane 3 indicate that rFPB2-R355K plants of PB2-1 genes, swimming lane 4 indicate rFPB2-R355K plants of PB2-2 genes.

Specific embodiment

Embodiment of the present invention is described in detail below in conjunction with embodiment, but those skilled in the art will Understand, the following example is merely to illustrate the present invention, and should not be taken as limiting the scope of the invention.It is not specified in embodiment specific Condition person carries out according to conventional conditions or manufacturer's recommended conditions.Reagents or instruments used without specified manufacturer is It can be with conventional products that are commercially available.

The embodiment of the present invention has selected the Low Pathogenic Avian Influenza Virus A/Chicken/ as H9N2 subgroup vaccine Shanghai/F/98 plants (H9N2 is abbreviated as F/98 plants), the strain is open by the Ministry of Agriculture, Yangzhou University livestock and poultry pestology emphasis Laboratory isolates and purifies, and is accredited as H9N2 hypotype through national influenza center, complete genome sequence logs in GenBank, and accession number is AY253750-AY253756。

8 Plasma viral rescue system pHW2000 are won by the Robert Webster of St.Jude child study hospital, the U.S. Scholar give.

The extraction of 1:F/98 plants of RNA of embodiment

F/98 plants are inoculated in SPF chicken embryo, collect allantoic fluid 300ml, and 6000rpm (30# rotor) is centrifuged 15min, takes supernatant； 4 DEG C of centrifugation 1.5h of 18000rpm, with 40ml STE (10mM pH8.0Tris-HCl, 100mM NaCl, 5mM pH8.0EDTA) Suspend precipitating.With 10% sucrose cushions bottom, it is carefully added into suspension, 4 DEG C of centrifugation 1.5h foreigh protein removings of 18000rpm abandon supernatant, sink It forms sediment and is suspended with 30mL STE, 4 DEG C of centrifugation 1h of 18000rpm remove sucrose, and precipitating is suspended with 7mL STE, dispense dactylethrae, every pipe 450μL。

RNA is extracted with the RNA extraction agent box of Shanghai biotechnology Services Co., Ltd.Take the viruria of 300 μ L Cyst fluid is added 400 μ L Trizol and mixes well；100 μ L chloroforms/isoamyl alcohol (24: 1) is added, shakes 30 seconds, 12,000rpm from The heart 5 minutes；Supernatant is moved into sterile 1.5mL RNase-free centrifuge tube, 150 μ L dehydrated alcohols are added, is mixed；It is placed in In MNIQ-10 column, 2 minutes are placed at room temperature for, 8,000rpm centrifugations 1 minute；Waste liquid is discarded, 450 μ are added in pillar LSolution RPE, 10,000rpm, it is centrifuged 30 seconds；Step is primary before repeating；Discard waste liquid, 10,000rpm, it is centrifuged 15 seconds；It moves Pillar enters in sterile, RNase-free centrifuge tube, and 50 μ L DEPC-H are added in pillar center₂O, 55-80 DEG C are placed 2 minutes, 10,000rpm, it is centrifuged 1 minute, the solution in collecting pipe is RNA sample.

2 F/98 plants of embodiment of 8 gene magnifications, clone and sequencing

Design of primers expands F/98 plants of 8 gene orders, and is sequenced.

The primer sequence for expanding 8 internal genes of F/98 strain is as follows:

Bm-HA-1 5 '-TATTCGTCTCAGGGAGCAAAAGCAGGGG-3 ',

Bm-HA-2 5-ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT-3’。

Bm-NA-1 5'-TATTCGTCTCAGGGAGCAAAAGCAGGAGT-3'；

Bm-NA-2 5 '-ATATCGTCTCGTATTAGTAGAAACAAGGAGTTTTTT-3 ',

Bm-PB1-1 5'-TATTCGTCTCAGGGAGCGAAAGCAGGCA-3'；

Bm-PB1-2 5 '-ATATCGTCTCGTATTAGTAGAAACAAGGCATTT-3 ',

Bm-PA-1 5'-TATTCGTCTCAGGGAGCGAAAGCAGGTACTGAT-3'；

Bm-PA-2 5 '-ATATCGTCTCGTATTAGTAGAAACAAGGTACTTTT-3 ',

Bm-NP-1 5'-TATTCGTCTCAGGGAGCA AAAGCAGGGTAGATAATC-3'；

Bm-NP-2 5'-ATATCGTCTCGTATTAGTAGAAACAAGGGTATTTTTC-3'；

Bm-PB2-1 5'-TATTCGTCTCAGGGAGCGAAAGCAGGTC-3'；

Bm-PB2-2 5 '-ATATCGTCTCGTATTAGTAGAAACAAGGTCGTTT-3 ',

Bm-M-1 5'-TATTCGTCTCAGGGAGCAAAAGCAGGTAG-3'；

5 '-ATATCGTCTCGTATTAGTAGAAACAAGGTAGTT TTT-3 ' of Bm-M-2,

Bm-NS-1 5'-TATTCGTCTCAGGGAGCAAAAGCAGGGTG-3'；

Bm-NS-2 5’-ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT-3’。

Universal primer: 12uni5 '-AGCAAAAGCAGG-3 '

(there is BsmBI digestion position on transcription/expression vector to transcription/expression vector for convenience of above 8 gene fragment clones Point), when designing the primer of PCR amplification genetic fragment, at 5 ' ends of upstream and downstream primer plus the restriction enzyme site BsmBI of clone Bm is abbreviated as in site, with the recognition site at underscore being corresponding enzyme.In addition, all have with the end all segment cDNA 5 ' 12nt is configured as the universal primer (12uni) of reverse transcription (RT), is used for reverse transcription.All primers are limited by precious biological (Dalian) Company's synthesis.

F/98 plants of full-length genomes of reverse transcription (25 μ l reaction system):

The 15 μ l of F/98 pnca gene group RNA of the above extraction is taken respectively, and 70 DEG C of primer of 1 μ l 50p mol/L12nt changes are added Property 5min, sets 0 DEG C immediately, then sequentially adds following reagent:

42 DEG C of effect 1h, can immediately using or set -20 DEG C it is spare.

Polymerase chain reaction (PCR) expands 8 full length gene segments (50 μ L reaction system):

It takes in above-mentioned 10 μ L to 0.5mL PCR reaction tube of RT product (cDNA), wherein using primer when amplification PB2 segment: Bm-PB2-1, Bm-PB2-2；Primer: Bm-PB1-1, Bm-PB1-2 is used when expanding PB1 segment；Using drawing when expanding PA segment Object: Bm-PA-1, Bm-PA-2；Primer: Bm-HA-1, Bm-HA-2 is used when expanding HA segment；Primer is used when expanding NP segment: Bm-NP-1, Bm-NP-2；Primer: Bm-NA-1, Bm-NA-2 is used when expanding NA segment；Primer: Bm- is used when expanding M segment M-1, Bm-M-2；Primer: Bm-NS-1, Bm-NS-2 is used when expanding NS segment；Sequentially add following reagent:

Brief centrifugation, 94 DEG C of initial denaturation 5min, at 75-80 DEG C plus 0.5 μ L of Expand High Fidelity polymerase (2.5U).With 94 DEG C of 40s, 58 DEG C of 35s, 72 DEG C of 2min 30 circulations.Last 72 DEG C of extensions 7 minutes, 4 DEG C of operation 10min.It takes 5 μ L of PCR product is identified with 0.8% agarose gel electrophoresis.Electroresis appraisal result figure is referring to fig. 2.

Clone, identification and the sequencing of PCR product:

PCR product cuts the gel of the segment of size containing purpose, uses Agrose through electroresis appraisal, remaining product whole electrophoresis Gel DNA Extraction Kit recycling, connect with pGEM-T easy vector, conversion to e. coli jm109 competence Cell is identified through EcoR I digestion, send PCR product and the product connecting with carrier T to raw work bioengineering (Shanghai) stock simultaneously The sequencing of part Co., Ltd.

With 11.0 software of DNASTAR, sequence is edited with EditSeq, the Clustal method in MegAlign, by RT-PCR The fragment assembly of amplification at each gene complete sequence.F/98 plants of complete genome sequence logs in GenBank, and accession number is AY253750-AY253756。

Embodiment 3 constructs transcription/expression vector plasmid of F/98 plants of 8 genes:

In 8 plasmid transcriptions/expression vector pHW2000, respectively be inserted into 8 internal genes of F/98 strain (PB2, PB1, PA, HA, NP, M, NS, NA) cDNA formed 8 reconfiguration plasmids: pHW202-PB2, pHW202-PB1, pHW203-PA, pHW204-HA, PHW205-NP, pHW206-NA, pHW207-M and pHW208-NS.

It is analyzed through sequence, selects correct sequence for being cloned into 8 plasmid transcriptions/expression vector pHW2000.It uses first F/98 plants of BsmBI digestion of 6 internal genes, D3 plants of NA gene and 8 plasmid transcriptions/expression vector pHW2000, BsmBI enzyme It is as follows to cut system (40 μ L), Plasmid DNA (0.3 μ g/ μ L) takes 5 μ L.55 DEG C of effect 4h.

Endonuclease bamhi and carrier are connected through gel electrophoresis, recycling, then with T4DNA ligase respectively, conversion to Escherichia coli JM109 competent cell chooses bacterium colony and expands culture, extracts plasmid in a small amount, is made with the corresponding plasmid of 8 pUC pUC Plays sizes Control, gel electrophoresis is of the same size to be initially identified as positive colony, and -20 DEG C freeze.

Transcription/expression vector plasmid of the building PB2 mutation gene of embodiment 4

Using F/98 plants of pHW202-PB2 as template, design PCR primer exists to pHW-PB2-185-1, pHW-PB2-185-2 On PB2 gene by 554 coding mutations be A, so that 185 amino acids of PB2 gene is sported K (I185K) from I；Its primer To as follows:

PHW-PB2-185-1:CAGAATCGCAATTGACAAAAACAAA

PHW-PB2-185-2:TCAATTGCGATTCTGATGTCAATA

Sequentially add following reagent:

Brief centrifugation, 94 DEG C of initial denaturation 5min, at 75-80 DEG C plus 0.5 μ L of Expand High Fidelity polymerase (2.5U).With 94 DEG C of 40s, 58 DEG C of 35s, 72 DEG C of 2min 30 circulations.Last 72 DEG C of extensions 10 minutes, 4 DEG C of operation 10min.

PCR product is taken, is identified with 1% agarose gel electrophoresis, glue recycling.Only source recombination kit is approved of to say according to promise Bright book operation, carries out homologous recombination.Following reagent is sequentially added according to following system under condition of ice bath first:

The plasmid that will have been recombinated, conversion to escherichia coli jm109 competent cell choose bacterium colony and expand culture, a small amount of to extract Plasmid by PCR amplification and is sequenced (Fig. 3), is accredited as positive colony, and -20 DEG C freeze.

The rescue and identification of 5 PB2 point mutation strain avian influenza virus of embodiment

Transfection plasmid and the transfection preparation of cell:

It will be from F/98 plants of plasmid: pHW202-PB1, pHW203-PA, pHW205-NP, pHW207-M, pHW208-NS The PB2 gene plasmid pHW-PB2-185 containing point mutation expands culture respectively, and small with QIAGEN company mentions plasmid kit Upgrading grain, and content and purity are measured, the plasmid of high-purity is prepared for transfecting.By the good 293T cell dissociation of growth conditions After count, by 10⁶The cell concentration of a cells/well is placed in overnight incubation in 24 porocyte culture plates.

Virus rescue:

Will be from the 8 of F/98 plants plasmids: pHW201-PB2, pHW202-PB1, pHW203-PA, pHW205-NP, PHW207-M, pHW208-NS are respectively and containing PB2 point mutation plasmid pHW-PB2-185, pHW-PB2-355, in 1: 1 ratio Mixing.It is transfected according to QIAGEN transfection reagent operating instruction: mixed plasmid and transfection reagent being added in 293T cell, set Containing 5%CO₂, in 37 DEG C of incubators, after culture for 24 hours, scrape the 10 age in days SPF chicken embryo of cell inoculation of transfection；It is harvested after culture 48h Allantoic fluid continues to be inoculated with 10 age in days SPF chicken embryos, daily to observe chicken embryo death and lesion situation, collects chick embryo allantoic liquid in due course and carries out Viruses indentification, rescued virus abbreviation rFPB2-1185, rFPB2-R355K plant avian influenza virus.

Viruses indentification:

The hemagglutination test of avian influenza virus is carried out by OIE standard: the 10 age in days SPF chick embryo allantoic liquid blood clotting of the first generation of inoculation Potency is up to 2⁸；10 age in days SPF chick embryo allantoic liquid of the first generation is diluted 10³~10⁵Times, the passage of 10 age in days SPF chicken embryo of aseptic inoculation Afterwards, hemagglutinative titer is up to 2¹¹。

Sequence Identification: obtaining rFPB2-I185K with RT-PCR method, the PB2 in rFPB2-R355K plant avian influenza virus with HA gene, is identified by Sangon Biotech (Shanghai) Co., Ltd., and method is shown in embodiment 2.The result is that in addition to PB2 gene with Other outer 7 genes are the related gene of F/98, and the 185th of rFPB2-1185K plants of PB2 genes is K, rFPB2- The 355th of R355K plants of PB2 genes is K.

Mutation on the PB2 gene of 6rFPB2-I185K and rFPB2-R355K plants of avian influenza virus of embodiment is in SPF chicken embryo In Stability Determination

To the Detection of Stability that rFPB2-1185K and rFPB2-R355K plants of avian influenza virus is passed in SPF chicken embryo, F/98 Strain is as control:

By transfecting the 10 age in days SPF chick embryo allantoic liquid of the first generation of 293T cell inoculation, HA hemagglutinative titer is up to 2⁸；By the first generation 10 age in days SPF chick embryo allantoic liquids continuously passed for 20 generations, and the allantoic fluid of previous generation is all diluted 10 by every generation⁵Times, it is imitated in 1-15 for HA For valence between 8-10, the HA potency to the 20th generation chick embryo allantoic liquid reaches 2¹¹(1: 2048) (table 1).

The F/98 strain in the 20th generation in SPF chicken embryo, rFPB2-I185K and rFPB2-R355K plants are obtained with RT-PCR method The PB2 gene of avian influenza virus, is sequenced by Sangon Biotech (Shanghai) Co., Ltd., the results show that the results show that F/ 554 nucleotide are still T on 98 plants of PB2 gene, are G on the 1064th nucleotide；On the PB2 gene of rFPB2-I185K 554 nucleotide are A, are A on the 1064th nucleotide of PB2 gene of rFPB2-R355K plants of avian influenza virus.Illustrate rFPB2- I185K and rFPB2-R355K plants of avian influenza virus is by passage, and there is no variations for mutation.

The HA potency (2 that 1 rFPB2-I185K and rFPB2-R355K avian influenza virus of table passes in SPF chicken embryoⁿ)

Embodiment 7F/98 and rFPB2-I185K and rFPB2-R355K avian influenza virus median infective dose in chicken embryo (EID₅₀Replicate titre) detection

The allantoic fluid of viral (F/98 and rFPB2-1185K) to be measured is done 10 respectively with four anti-PBS^-1~10^-20Multiple proportions it is dilute It releases.Each dilution is inoculated with 5 piece of 10 age in days SPF chicken embryo, and 0.2mL/ pieces, 37 DEG C are incubated for.Dead embryo in for 24 hours is discarded, it is sterile to collect For 24 hours to the dead and not dead chick embryo allantoic liquid of 120h.Blood clotting is carried out to the viral allantoic fluid for carrying out the measurement of chicken embryo median infective dose The detection of potency (HA), with potency >=2 every strain virus HA³It is determined as positive (table 2), and is calculated according to Reed-Muench formula. The results show that rFPB2-1185K plants of EID₅₀It is 10^-16.625/ 0.2mL, and the EID of maternal F/98 plants of virus₅₀It is 10^-6.67/ 0.2mL, compared with maternal F/98 plants of virus, the EID that rFPB2-I185K plant of mutant strain₅₀Improve 9 × 10⁹Again (P < 0.001). The result shows that the I185K amino acid in PB2 gene can significantly improve H9N2 influenza by two amino acid point mutants on PB2 Duplication titre of the virus in chick embryo allantoic liquid.

Table 2:rFPB2-I185K and rFPB2-R355K avian influenza virus EID₅₀Detect dilution

Although a specific embodiment of the invention has been described in detail, it will be understood to those of skill in the art that.According to All introductions having disclosed can be carry out various modifications and be replaced to those details, these are in protection scope of the present invention It is interior.Full scope of the invention is provided by extremely any equivalent of appended patent requirements.

Sequence table

<110>Yangzhou University

<120>H9N2 avian flu strain, preparation method, avian influenza vaccine and its application are recombinated

<160> 21

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2341

<212> DNA

<213>PB2-185 mutated genes (PB2-185)

<400> 1

agcgaaagca ggtcaaatat attcagtatg gagagaataa aagaattaag agatctaatg 60

tcgcaatccc gcacccgcga gatactaaca aaaaccactg tggaccatat ggccataatc 120

aagaagtaca catcaggaag acaagagaag aaccctgctc tcagaatgaa atggatgatg 180

gctatgaaat atccaatcac agcagacaag agaataatgg agatgattcc cgaaaggaat 240

gagcaagggc aaacgctttg gagcaagaca aatgatgctg gatcggacag ggtgatggtg 300

tctcccctag ctgtaacttg gtggaacagg aatgggccaa caacaagtac agtccattac 360

ccaaaggttt acaaaacata ctttgagaag gttgagaggt taaagcatgg aacctttggt 420

cccgttcact tccgaaatca agttaaaata cgccgccggg ttgatataaa cccgggtcat 480

gcagatctca gtgctaaaga agcacaagat gttatcatgg aggtcgtttt cccaaatgaa 540

gtgggagcta gaaaattgac atcagaatcg caattgacaa aaacaaaaga gaagaaagaa 600

gagctccagg attgtaagat tgctccttta atggtggcat acatgttgga aagagaactg 660

gtccggaaaa ccagattcct accggtagca ggtggaacaa gcagtgtata cattgaagta 720

ttgcatttga ctcaagggac ctgctgggaa cagatgtaca ctccaggcgg agaagtgaga 780

aatgatgatg ttgaccagag tttgatcatt gctgccagaa atattgttag gagatcaacg 840

gtgtcagcag atccattggc atcactatta gagatgtgcc acagcacaca aattggtggg 900

ataaggatgg tggacatcct taggcaaaat ccaactgagg aacaagctgt ggatatatgc 960

aaagcagcaa tgggattgag gatcagttca tcttttagct ttggaggatt cactttcaaa 1020

agaacaagtg ggtcatctgt caagaaggaa gaggaagtgc ttacgggcaa cctccaaaca 1080

ctgaaaataa gagtacatga ggggtatgag gaattcacaa tggttgggcg gagagcaaca 1140

gctatcctga ggaaagcaac cagaaggctg attcagctga tagtaagtgg aagagatgaa 1200

caatcaatcg ctgaagcgat cattgtagca atggtgttct cacaggaaga ttgcatgata 1260

aaagcagtca gaggtgatct gaatttcgta aatagagcaa atcaaaggtt aaaccccatg 1320

catcaactcc ttaggcactt ccaaaaagat gcaaaggtgc tatttcagaa ctggggaatt 1380

gaacctattg acgatgtcat ggggatgatc ggactattac ctgacatgac tccaagcaca 1440

gaaatgtcac tgagaggagt aagagttagt aaaatggggg tggatgaata ttccagcact 1500

gagagagtgg ttgtaagtat tgaccgtttc ttaagggttc gagatcagcg ggggaacgta 1560

ctcttatccc ccgaagaggt cagcgaaaca caggggactg agaaattgac aataacatat 1620

tcatcaccaa tgatgtggga aatcaacggt cctgaatcag tgcttgttaa cacctatcaa 1680

tggatcatca gaaattggga aactgtgaag attcaatggt ctcaagaccc aacaatgctg 1740

tacaataaga tggagtttga accgttccaa tccttggtgc ctaaagctgc cagaggtcaa 1800

tacagtggat ttgtgagaac actattccaa cagatgcgtg acgtattggg aacatttgat 1860

actgtacaga taataaagct gctaccattt gcagcagccc caccggagca gagcagaatg 1920

cagttttctt ctctaactgt gaatgtgaga ggctcgggaa tgaggatact cgtaagggga 1980

aactcccccg tgttcaacta taataaggca accaaaaggc ttaccgttct tggaaaggat 2040

gcaggtgcat taacagaaga tccagatgag ggaacagcag gagtggaatc tgcagtactg 2100

aggggattcc taattctagg caaggaggac aaaaggtatg gaccagcatt gagcatcaat 2160

gaactgagca atcttgcgaa aggggagaaa gctaatgtgc ttatagggca aggagacgtg 2220

gtgttggtaa tgaaacggaa acgggactct agcatactta ctgacagcca gacagcgacc 2280

aaaaggattc ggatggccat caattagtgt cgaattgttt aaaaacgacc ttgtttctac 2340

t 2341

<210> 2

<211> 759

<212> PRT

<213>PB2-185 mutein (PB2-185)

<400> 2

Met Glu Arg Ile Lys Glu Leu Arg Asp Leu Met Ser Gln Ser Arg Thr

1 5 10 15

Arg Glu Ile Leu Thr Lys Thr Thr Val Asp His Met Ala Ile Ile Lys

20 25 30

Lys Tyr Thr Ser Gly Arg Gln Glu Lys Asn Pro Ala Leu Arg Met Lys

35 40 45

Trp Met Met Ala Met Lys Tyr Pro Ile Thr Ala Asp Lys Arg Ile Met

50 55 60

Glu Met Ile Pro Glu Arg Asn Glu Gln Gly Gln Thr Leu Trp Ser Lys

65 70 75 80

Thr Asn Asp Ala Gly Ser Asp Arg Val Met Val Ser Pro Leu Ala Val

85 90 95

Thr Trp Trp Asn Arg Asn Gly Pro Thr Thr Ser Thr Val His Tyr Pro

100 105 110

Lys Val Tyr Lys Thr Tyr Phe Glu Lys Val Glu Arg Leu Lys His Gly

115 120 125

Thr Phe Gly Pro Val His Phe Arg Asn Gln Val Lys Ile Arg Arg Arg

130 135 140

Val Asp Ile Asn Pro Gly His Ala Asp Leu Ser Ala Lys Glu Ala Gln

145 150 155 160

Asp Val Ile Met Glu Val Val Phe Pro Asn Glu Val Gly Ala Arg Lys

165 170 175

Leu Thr Ser Glu Ser Gln Leu Thr Lys Thr Lys Glu Lys Lys Glu Glu

180 185 190

Leu Gln Asp Cys Lys Ile Ala Pro Leu Met Val Ala Tyr Met Leu Glu

195 200 205

Arg Glu Leu Val Arg Lys Thr Arg Phe Leu Pro Val Ala Gly Gly Thr

210 215 220

Ser Ser Val Tyr Ile Glu Val Leu His Leu Thr Gln Gly Thr Cys Trp

225 230 235 240

Glu Gln Met Tyr Thr Pro Gly Gly Glu Val Arg Asn Asp Asp Val Asp

245 250 255

Gln Ser Leu Ile Ile Ala Ala Arg Asn Ile Val Arg Arg Ser Thr Val

260 265 270

Ser Ala Asp Pro Leu Ala Ser Leu Leu Glu Met Cys His Ser Thr Gln

275 280 285

Ile Gly Gly Ile Arg Met Val Asp Ile Leu Arg Gln Asn Pro Thr Glu

290 295 300

Glu Gln Ala Val Asp Ile Cys Lys Ala Ala Met Gly Leu Arg Ile Ser

305 310 315 320

Ser Ser Phe Ser Phe Gly Gly Phe Thr Phe Lys Arg Thr Ser Gly Ser

325 330 335

Ser Val Lys Lys Glu Glu Glu Val Leu Thr Gly Asn Leu Gln Thr Leu

340 345 350

Lys Ile Arg Val His Glu Gly Tyr Glu Glu Phe Thr Met Val Gly Arg

355 360 365

Arg Ala Thr Ala Ile Leu Arg Lys Ala Thr Arg Arg Leu Ile Gln Leu

370 375 380

Ile Val Ser Gly Arg Asp Glu Gln Ser Ile Ala Glu Ala Ile Ile Val

385 390 395 400

Ala Met Val Phe Ser Gln Glu Asp Cys Met Ile Lys Ala Val Arg Gly

405 410 415

Asp Leu Asn Phe Val Asn Arg Ala Asn Gln Arg Leu Asn Pro Met His

420 425 430

Gln Leu Leu Arg His Phe Gln Lys Asp Ala Lys Val Leu Phe Gln Asn

435 440 445

Trp Gly Ile Glu Pro Ile Asp Asp Val Met Gly Met Ile Gly Leu Leu

450 455 460

Pro Asp Met Thr Pro Ser Thr Glu Met Ser Leu Arg Gly Val Arg Val

465 470 475 480

Ser Lys Met Gly Val Asp Glu Tyr Ser Ser Thr Glu Arg Val Val Val

485 490 495

Ser Ile Asp Arg Phe Leu Arg Val Arg Asp Gln Arg Gly Asn Val Leu

500 505 510

Leu Ser Pro Glu Glu Val Ser Glu Thr Gln Gly Thr Glu Lys Leu Thr

515 520 525

Ile Thr Tyr Ser Ser Pro Met Met Trp Glu Ile Asn Gly Pro Glu Ser

530 535 540

Val Leu Val Asn Thr Tyr Gln Trp Ile Ile Arg Asn Trp Glu Thr Val

545 550 555 560

Lys Ile Gln Trp Ser Gln Asp Pro Thr Met Leu Tyr Asn Lys Met Glu

565 570 575

Phe Glu Pro Phe Gln Ser Leu Val Pro Lys Ala Ala Arg Gly Gln Tyr

580 585 590

Ser Gly Phe Val Arg Thr Leu Phe Gln Gln Met Arg Asp Val Leu Gly

595 600 605

Thr Phe Asp Thr Val Gln Ile Ile Lys Leu Leu Pro Phe Ala Ala Ala

610 615 620

Pro Pro Glu Gln Ser Arg Met Gln Phe Ser Ser Leu Thr Val Asn Val

625 630 635 640

Arg Gly Ser Gly Met Arg Ile Leu Val Arg Gly Asn Ser Pro Val Phe

645 650 655

Asn Tyr Asn Lys Ala Thr Lys Arg Leu Thr Val Leu Gly Lys Asp Ala

660 665 670

Gly Ala Leu Thr Glu Asp Pro Asp Glu Gly Thr Ala Gly Val Glu Ser

675 680 685

Ala Val Leu Arg Gly Phe Leu Ile Leu Gly Lys Glu Asp Lys Arg Tyr

690 695 700

Gly Pro Ala Leu Ser Ile Asn Glu Leu Ser Asn Leu Ala Lys Gly Glu

705 710 715 720

Lys Ala Asn Val Leu Ile Gly Gln Gly Asp Val Val Leu Val Met Lys

725 730 735

Arg Lys Arg Asp Ser Ser Ile Leu Thr Asp Ser Gln Thr Ala Thr Lys

740 745 750

Arg Ile Arg Met Ala Ile Asn

755

<210> 3

<211> 2341

<212> DNA

<213>PB2-355 mutated genes (PB2-355)

<400> 3

agcgaaagca ggtcaaatat attcagtatg gagagaataa aagaattaag agatctaatg 60

tcgcaatccc gcacccgcga gatactaaca aaaaccactg tggaccatat ggccataatc 120

aagaagtaca catcaggaag acaagagaag aaccctgctc tcagaatgaa atggatgatg 180

gctatgaaat atccaatcac agcagacaag agaataatgg agatgattcc cgaaaggaat 240

gagcaagggc aaacgctttg gagcaagaca aatgatgctg gatcggacag ggtgatggtg 300

tctcccctag ctgtaacttg gtggaacagg aatgggccaa caacaagtac agtccattac 360

ccaaaggttt acaaaacata ctttgagaag gttgagaggt taaagcatgg aacctttggt 420

cccgttcact tccgaaatca agttaaaata cgccgccggg ttgatataaa cccgggtcat 480

gcagatctca gtgctaaaga agcacaagat gttatcatgg aggtcgtttt cccaaatgaa 540

gtgggagcta gaatattgac atcagaatcg caattgacaa taacaaaaga gaagaaagaa 600

gagctccagg attgtaagat tgctccttta atggtggcat acatgttgga aagagaactg 660

gtccggaaaa ccagattcct accggtagca ggtggaacaa gcagtgtata cattgaagta 720

ttgcatttga ctcaagggac ctgctgggaa cagatgtaca ctccaggcgg agaagtgaga 780

aatgatgatg ttgaccagag tttgatcatt gctgccagaa atattgttag gagatcaacg 840

gtgtcagcag atccattggc atcactatta gagatgtgcc acagcacaca aattggtggg 900

ataaggatgg tggacatcct taggcaaaat ccaactgagg aacaagctgt ggatatatgc 960

aaagcagcaa tgggattgag gatcagttca tcttttagct ttggaggatt cactttcaaa 1020

agaacaagtg ggtcatctgt caagaaggaa gaggaagtgc ttacgggcaa cctccaaaca 1080

ctgaaaataa aagtacatga ggggtatgag gaattcacaa tggttgggcg gagagcaaca 1140

gctatcctga ggaaagcaac cagaaggctg attcagctga tagtaagtgg aagagatgaa 1200

caatcaatcg ctgaagcgat cattgtagca atggtgttct cacaggaaga ttgcatgata 1260

aaagcagtca gaggtgatct gaatttcgta aatagagcaa atcaaaggtt aaaccccatg 1320

catcaactcc ttaggcactt ccaaaaagat gcaaaggtgc tatttcagaa ctggggaatt 1380

gaacctattg acgatgtcat ggggatgatc ggactattac ctgacatgac tccaagcaca 1440

gaaatgtcac tgagaggagt aagagttagt aaaatggggg tggatgaata ttccagcact 1500

gagagagtgg ttgtaagtat tgaccgtttc ttaagggttc gagatcagcg ggggaacgta 1560

ctcttatccc ccgaagaggt cagcgaaaca caggggactg agaaattgac aataacatat 1620

tcatcaccaa tgatgtggga aatcaacggt cctgaatcag tgcttgttaa cacctatcaa 1680

tggatcatca gaaattggga aactgtgaag attcaatggt ctcaagaccc aacaatgctg 1740

tacaataaga tggagtttga accgttccaa tccttggtgc ctaaagctgc cagaggtcaa 1800

tacagtggat ttgtgagaac actattccaa cagatgcgtg acgtattggg aacatttgat 1860

actgtacaga taataaagct gctaccattt gcagcagccc caccggagca gagcagaatg 1920

cagttttctt ctctaactgt gaatgtgaga ggctcgggaa tgaggatact cgtaagggga 1980

aactcccccg tgttcaacta taataaggca accaaaaggc ttaccgttct tggaaaggat 2040

gcaggtgcat taacagaaga tccagatgag ggaacagcag gagtggaatc tgcagtactg 2100

aggggattcc taattctagg caaggaggac aaaaggtatg gaccagcatt gagcatcaat 2160

gaactgagca atcttgcgaa aggggagaaa gctaatgtgc ttatagggca aggagacgtg 2220

gtgttggtaa tgaaacggaa acgggactct agcatactta ctgacagcca gacagcgacc 2280

aaaaggattc ggatggccat caattagtgt cgaattgttt aaaaacgacc ttgtttctac 2340

t 2341

<210> 5

<211> 759

<212> PRT

<213>PB2-355 mutein (PB2-355)

<400> 5

Met Glu Arg Ile Lys Glu Leu Arg Asp Leu Met Ser Gln Ser Arg Thr

1 5 10 15

Arg Glu Ile Leu Thr Lys Thr Thr Val Asp His Met Ala Ile Ile Lys

20 25 30

Lys Tyr Thr Ser Gly Arg Gln Glu Lys Asn Pro Ala Leu Arg Met Lys

35 40 45

Trp Met Met Ala Met Lys Tyr Pro Ile Thr Ala Asp Lys Arg Ile Met

50 55 60

Glu Met Ile Pro Glu Arg Asn Glu Gln Gly Gln Thr Leu Trp Ser Lys

65 70 75 80

Thr Asn Asp Ala Gly Ser Asp Arg Val Met Val Ser Pro Leu Ala Val

85 90 95

Thr Trp Trp Asn Arg Asn Gly Pro Thr Thr Ser Thr Val His Tyr Pro

100 105 110

Lys Val Tyr Lys Thr Tyr Phe Glu Lys Val Glu Arg Leu Lys His Gly

115 120 125

Thr Phe Gly Pro Val His Phe Arg Asn Gln Val Lys Ile Arg Arg Arg

130 135 140

Val Asp Ile Asn Pro Gly His Ala Asp Leu Ser Ala Lys Glu Ala Gln

145 150 155 160

Asp Val Ile Met Glu Val Val Phe Pro Asn Glu Val Gly Ala Arg Ile

165 170 175

Leu Thr Ser Glu Ser Gln Leu Thr Ile Thr Lys Glu Lys Lys Glu Glu

180 185 190

Leu Gln Asp Cys Lys Ile Ala Pro Leu Met Val Ala Tyr Met Leu Glu

195 200 205

Arg Glu Leu Val Arg Lys Thr Arg Phe Leu Pro Val Ala Gly Gly Thr

210 215 220

Ser Ser Val Tyr Ile Glu Val Leu His Leu Thr Gln Gly Thr Cys Trp

225 230 235 240

Glu Gln Met Tyr Thr Pro Gly Gly Glu Val Arg Asn Asp Asp Val Asp

245 250 255

Gln Ser Leu Ile Ile Ala Ala Arg Asn Ile Val Arg Arg Ser Thr Val

260 265 270

Ser Ala Asp Pro Leu Ala Ser Leu Leu Glu Met Cys His Ser Thr Gln

275 280 285

Ile Gly Gly Ile Arg Met Val Asp Ile Leu Arg Gln Asn Pro Thr Glu

290 295 300

Glu Gln Ala Val Asp Ile Cys Lys Ala Ala Met Gly Leu Arg Ile Ser

305 310 315 320

Ser Ser Phe Ser Phe Gly Gly Phe Thr Phe Lys Arg Thr Ser Gly Ser

325 330 335

Ser Val Lys Lys Glu Glu Glu Val Leu Thr Gly Asn Leu Gln Thr Leu

340 345 350

Lys Ile Lys Val His Glu Gly Tyr Glu Glu Phe Thr Met Val Gly Arg

355 360 365

Arg Ala Thr Ala Ile Leu Arg Lys Ala Thr Arg Arg Leu Ile Gln Leu

370 375 380

Ile Val Ser Gly Arg Asp Glu Gln Ser Ile Ala Glu Ala Ile Ile Val

385 390 395 400

Ala Met Val Phe Ser Gln Glu Asp Cys Met Ile Lys Ala Val Arg Gly

405 410 415

Asp Leu Asn Phe Val Asn Arg Ala Asn Gln Arg Leu Asn Pro Met His

420 425 430

Gln Leu Leu Arg His Phe Gln Lys Asp Ala Lys Val Leu Phe Gln Asn

435 440 445

Trp Gly Ile Glu Pro Ile Asp Asp Val Met Gly Met Ile Gly Leu Leu

450 455 460

Pro Asp Met Thr Pro Ser Thr Glu Met Ser Leu Arg Gly Val Arg Val

465 470 475 480

Ser Lys Met Gly Val Asp Glu Tyr Ser Ser Thr Glu Arg Val Val Val

485 490 495

Ser Ile Asp Arg Phe Leu Arg Val Arg Asp Gln Arg Gly Asn Val Leu

500 505 510

Leu Ser Pro Glu Glu Val Ser Glu Thr Gln Gly Thr Glu Lys Leu Thr

515 520 525

Ile Thr Tyr Ser Ser Pro Met Met Trp Glu Ile Asn Gly Pro Glu Ser

530 535 540

Val Leu Val Asn Thr Tyr Gln Trp Ile Ile Arg Asn Trp Glu Thr Val

545 550 555 560

Lys Ile Gln Trp Ser Gln Asp Pro Thr Met Leu Tyr Asn Lys Met Glu

565 570 575

Phe Glu Pro Phe Gln Ser Leu Val Pro Lys Ala Ala Arg Gly Gln Tyr

580 585 590

Ser Gly Phe Val Arg Thr Leu Phe Gln Gln Met Arg Asp Val Leu Gly

595 600 605

Thr Phe Asp Thr Val Gln Ile Ile Lys Leu Leu Pro Phe Ala Ala Ala

610 615 620

Pro Pro Glu Gln Ser Arg Met Gln Phe Ser Ser Leu Thr Val Asn Val

625 630 635 640

Arg Gly Ser Gly Met Arg Ile Leu Val Arg Gly Asn Ser Pro Val Phe

645 650 655

Asn Tyr Asn Lys Ala Thr Lys Arg Leu Thr Val Leu Gly Lys Asp Ala

660 665 670

Gly Ala Leu Thr Glu Asp Pro Asp Glu Gly Thr Ala Gly Val Glu Ser

675 680 685

Ala Val Leu Arg Gly Phe Leu Ile Leu Gly Lys Glu Asp Lys Arg Tyr

690 695 700

Gly Pro Ala Leu Ser Ile Asn Glu Leu Ser Asn Leu Ala Lys Gly Glu

705 710 715 720

Lys Ala Asn Val Leu Ile Gly Gln Gly Asp Val Val Leu Val Met Lys

725 730 735

Arg Lys Arg Asp Ser Ser Ile Leu Thr Asp Ser Gln Thr Ala Thr Lys

740 745 750

Arg Ile Arg Met Ala Ile Asn

755

<210> 5

<211> 28

<212> DNA

<213>upstream primer (Bm-HA-1)

<400> 5

tattcgtctc agggagcaaa agcagggg 28

<210> 6

<211> 35

<212> DNA

<213>downstream primer (Bm-HA-2)

<400> 6

atatcgtctc gtattagtag aaacaagggt gtttt 35

<210> 7

<211> 29

<212> DNA

<213>upstream primer (Bm-NA-1)

<400> 7

tattcgtctc agggagcaaa agcaggagt 29

<210> 8

<211> 36

<212> DNA

<213>downstream primer (Bm-NA-2)

<400> 8

atatcgtctc gtattagtag aaacaaggag tttttt 36

<210> 9

<211> 28

<212> DNA

<213>upstream primer (Bm-PB1-1)

<400> 9

tattcgtctc agggagcgaa agcaggca 28

<210> 10

<211> 35

<212> DNA

<213>downstream primer (Bm-PA-2)

<400> 10

atatcgtctc gtattagtag aaacaaggta ctttt 35

<210> 11

<211> 36

<212> DNA

<213>upstream primer (Bm-NP-1)

<400> 11

tattcgtctc agggagcaaa agcagggtag ataatc 36

<210> 12

<211> 37

<212> DNA

<213>downstream primer (Bm-NP-2)

<400> 12

atatcgtctc gtattagtag aaacaagggt atttttc 37

<210> 13

<211> 28

<212> DNA

<213>upstream primer (Bm-PB2-1)

<400> 13

tattcgtctc agggagcgaa agcaggtc 28

<210> 14

<211> 34

<212> DNA

<213>downstream primer (Bm-PB2-2)

<400> 14

atatcgtctc gtattagtag aaacaaggtc gttt 34

<210> 15

<211> 29

<212> DNA

<213>upstream primer (Bm-M-1)

<400> 15

tattcgtctc agggagcaaa agcaggtag 29

<210> 16

<211> 36

<212> DNA

<213>downstream primer (Bm-M-2)

<400> 16

atatcgtctc gtattagtag aaacaaggta gttttt 36

<210> 17

<211> 29

<212> DNA

<213>upstream primer (Bm-NS-1)

<400> 17

tattcgtctc agggagcaaa agcagggtg 29

<210> 18

<211> 35

<212> DNA

<213>downstream primer (Bm-NS-2)

<400> 18

atatcgtctc gtattagtag aaacaagggt gtttt 35

<210> 19

<211> 12

<212> DNA

<213>random primer (12nt)

<400> 19

agcaaaagca gg 12

<210> 20

<211> 25

<212> DNA

<213>upstream primer (pHW-PB2-185-1)

<400> 20

cagaatcgca attgacaaaa acaaa 25

<210> 21

<211> 24

<212> DNA

<213>downstream primer (pHW-PB2-185-2)

<400> 21

tcaattgcga ttctgatgtc aata 24

Claims

1. a kind of PB2 mutated genes are mutated in the 554th nucleotide of the PB2 gene order of H9N2 avian influenza virus by T For A and/or its A is sported by G in the 1064th nucleotide.

2. a kind of PB2 mutated genes according to claim 1, which is characterized in that PB2 gene order its core after mutation Nucleotide sequence is as shown in SEQ ID No:1 or SEQ ID No:3.

3. a kind of PB2 mutein encodes PB2 mutated genes of any of claims 1 or 2, the recombinant protein Amino acid sequence is as shown in SEQ ID No:2 or SEQ ID No:4.

4. a kind of recombinant vector, prominent containing PB2 mutated genes of any of claims 1 or 2, PB2 as claimed in claim 3 Modification albumen.

5. a kind of recombinant cell, prominent containing PB2 mutated genes of any of claims 1 or 2, PB2 as claimed in claim 3 Modification albumen, recombinant vector as claimed in claim 4.

6. a kind of recombinant virus, prominent containing PB2 mutated genes of any of claims 1 or 2, PB2 as claimed in claim 3 Modification albumen, recombinant vector as claimed in claim 4, recombinant cell.

7. the preparation method of recombinant virus as claimed in claim 6, which comprises the following steps:

1) by carrying out rite-directed mutagenesis to F/98 plants of H9N2 avian influenza virus of PB2 gene, the 554th nucleotide is mutated by T For A, and/or it is sported into A by G in the 1064th nucleotide and obtains PB2 mutated genes；

3) F/98 plants of 7 gene plasmids are mixed with PB2 mutated genes plasmid, cotransfection 393T cell obtains recombination disease Poison.

8. a kind of H9N2 avian influenza virus vaccine, which is characterized in that the H9N2 avian influenza virus vaccine includes the power of immune amount Benefit require 6 described in recombinant virus antigens.

9. H9N2 avian influenza virus vaccine according to claim 8, which is characterized in that the H9N2 avian influenza virus EID₅₀ It is 10^-6.67/ 0.2mL or 10^-6.67/0.2mL。

10. the described in any item H9N2 avian influenza virus vaccines of claim 8 or 9 are in preparation prevention or treat H9N2 bird flu Application in drug.