CN107213460B

CN107213460B - Gene VII type newcastle disease vaccine

Info

Publication number: CN107213460B
Application number: CN201710389314.9A
Authority: CN
Inventors: 李明义; 孙化露; 金红岩; 李思菲; 于泽坤; 毕云英; 刘阳; 单学强; 栾志舫; 马礼照; 李朝阳
Original assignee: Qingdao Sinder Pharmaceutical Co ltd; Shandong Sinder Technology Co ltd
Current assignee: Qingdao Sinder Pharmaceutical Co ltd; Shandong Sinder Technology Co ltd
Priority date: 2017-05-27
Filing date: 2017-05-27
Publication date: 2020-10-09
Anticipated expiration: 2037-05-27
Also published as: CN107213460A

Abstract

The invention provides a gene VII type Newcastle disease vaccine, wherein the used antigen is an inactivated gene VII type Newcastle disease virus low virulent strain WF strain which is preserved in China center for type culture Collection of Wuhan university in Wuhan, Wuhan university in 2017 at 3, 7 months, and the preservation number is CCTCC NO: V201708. The vaccine candidate strain WF strain obtained by natural screening is used as an antigen to prepare the vaccine, and the vaccine immunized animals find that the prepared vaccine can effectively induce and generate neutralizing antibodies, can resist the invasion of the virulent gene VII type Newcastle disease virus, and has wide application prospect.

Description

Gene VII type newcastle disease vaccine

Technical Field

The invention belongs to the technical field of vaccine preparation, and particularly relates to a gene VII type Newcastle disease vaccine.

Technical Field

Newcastle disease is an acute virulent infectious disease caused by Newcastle disease virus, is extremely harmful to the poultry industry, and has been once classified as a type A disease by the International animal and disease Bureau (OIE). ND was first discovered in java, indonesia, in 1926, and in necalsel, england, in the same year, and thereafter rapidly spread worldwide. Currently, ND has four pandemics around the world and the host range is expanding.

Sequence analysis of 29 Newcastle disease viruses isolated from Jiangsu Zhejiang area in 1985 and 2003 revealed that 17 of the viruses were of genotype VII, of which 10 were isolated from diseased goose groups. Analysis of 83 newcastle disease viruses isolated from the mainland china in 2005 showed that 64 of them were of genotype VII. Lien et al are genotypic VII for the 20 strains of newcastle disease virus isolated from taiwan in 2003-2006. Furthermore, the NDV prevalent in Korea and Japan around China at the same stage is also mostly genotype VII. We also performed sequencing analysis on a part of NDV strains isolated in recent years in this laboratory, and the results show that more than 70% of the strains are genotype VII. Therefore, the gene VII type Newcastle disease virus is widely epidemic in the poultry group in China and is the current absolute dominant genotype.

Currently, the prevention and control of newcastle disease virus in the market mainly uses gene type II strains such as IV vaccine strains Lasota, clone30 and II vaccine strain B1, which can provide a certain immune protection, but cannot completely prevent the transmission and diffusion of newcastle disease virus, and especially the epidemic of gene type VII newcastle disease virus causes huge economic loss to the breeding industry. Because the epidemic gene VII type Newcastle disease virus is strong virus, most strains are not suitable for being used as vaccine strains unless natural low-virulent strains or artificially low-virulent strains by genetic engineering means. Obtaining low virulent strain is key to producing vaccine.

Disclosure of Invention

The invention aims to provide a gene VII type Newcastle disease vaccine, thereby making up the defects of the prior art.

The gene VII type Newcastle disease vaccine provided by the invention uses an inactivated gene VII type Newcastle disease virus low virulent strain WF strain which is preserved in China center for type culture Collection of Wuhan university in Wuhan, Wuhan university in 3 and 7 months in 2017, wherein the preservation number is CCTCC NO: V201708;

the P protein of WF strain has mutations at amino acids 237 and 240, wherein threonine (T) is at position 237 and isoleucine (I) is at position 240.

The vaccine of (1), wherein the WF strain is inactivated with formaldehyde.

The vaccine candidate strain WF strain obtained by natural screening is used as an antigen to prepare the vaccine, and the vaccine immunized animals find that the prepared vaccine can effectively induce and generate neutralizing antibodies, can resist the invasion of the virulent gene VII type Newcastle disease virus, and has wide application prospect.

Drawings

FIG. 1: a PCR identification picture of the Newcastle disease F gene fragment;

FIG. 2: NDV strains (WF strain, SL strain) based on F gene fragment phylogenetic tree;

FIG. 3: a PCR identification result chart of 9 gene segments of Newcastle disease;

FIG. 4: constructing a PCR identification result graph by whole genome segmentation;

FIG. 5: and the enzyme digestion identification picture of the NP, P and L helper plasmids.

Detailed Description

According to the invention, through researching two clinically separated gene VII type NDV, a strain is found to be a medium and weak virulence strain (WF strain), and a strain is a virulent strain (SL strain); by sequencing their genomes and making extensive alignments with the P gene of the gene type VII NDV published by NCBI, it was found that WF strains differ from other strains in amino acids 237 and 240 of the P protein, presumably in relation to the virulence of newcastle disease. And modifying the P gene of the SL strain according to the sequence of the P protein of the WF strain to obtain a highly attenuated gene VII type Newcastle disease vaccine candidate strain. Biological characteristics of the WF strain and the modified SL strain are respectively researched, and after the WF strain and the modified SL strain are respectively prepared into inactivated seedlings to immunize animals, good immune protection effect can be provided; thus leading to the present invention.

The present invention will be described in detail with reference to examples.

Example 1 screening and sequence analysis of wild strains of Gene type VII NDV

Two suspected NDV strains are separated from clinically diseased chickens, chick embryos are inoculated to collect allantoic fluid, and HA titer is determined. And designing a primer according to the F gene sequence of NDV published by NCBI, and identifying the Newcastle disease strain. An upstream primer: NDV F-F: ATGGGCTCCAAACCTTCTACCAG, respectively; a downstream primer: NDV F-R: AAACTGCTGCATCTTCCCAACCG are provided.

Collecting collected allantoic fluid 250uL, extracting RNA by conventional method, and reverse transcribing. NDV F-F/NDV F-R is used as a primer to amplify partial fragments of the F gene, and the size of the fragments is about 500 bp. After nucleic acid electrophoresis, positive bands are cut, recovered and connected with T vector for sequencing. And (3) drawing a gene evolutionary tree by taking a sequence between 47nt and 420nt of the F gene, and analyzing the genotype of the separated strain. Strains GenBank accession numbers used for experimental analysis are: 1-2 (AY935499), 1-2 (AY935500), 18719-03 (GQ288385), B1(NC _002617), HB92(AY225110), Herts (AY741404), Italien (EU293914), JS-07 (FJ766527), Lasota (AF077761), NA-1 (DQ659677), paramyxovirus-1 (AJ 277), ZJ1(AF 880431744), Muktesbear (EF 201805).

The results show that the two isolated strains are newcastle disease viruses, and the amino acid sequences of F gene cleavage sites are all¹¹²R-R-Q-K-R-F¹¹⁷And the characteristics of virulent strains are met, and further gene evolution analysis shows that the virulent strains are gene VII strains. HA titer measurement shows that the titers of two strains of virus chick embryo allantoic fluid are respectively stabilized at 2⁹And 2⁷‐2⁸. The isolated NDV strains were designated as WF strain and SL strain, respectively. Wherein the gene VII type Newcastle disease virus low virulent strain WF strain is preserved in China center for type culture Collection of Wuhan, Wuhan university in 2017, 3, 7 months, with the preservation number of CCTCC NO: V201708.

Example 2 measurement of Newcastle disease SL and WF MDT and ICPI strains

MDT refers to the average time of death of chick embryos due to the minimum lethal dose, and the MDT is an virulent NDV strain when the MDT is less than 60 hours; MDT value is between 60h and 90h, and is a mesogenic strain; MDT is more than 90h and is a low virulent strain. Diluting freshly harvested allantoic fluid containing toxin with sterile physiological saline by 10-fold serial dilution, and taking 10^‐6、10^‐7、10^‐8And 10^‐94 dilution, inoculating 10-day-old chick embryos, inoculating 5 chick embryos per dilution, and injecting 0.1mL per allantoic cavity. Embryos were photographed once a day in the morning and afternoon, and the death time of each chick embryo was recorded for 7 consecutive days. (results are shown in Table 1) the MDT calculation formula is:

ICPI refers to the index of pathogenicity in the brain of 1 day old chicks. Taking 15 SPF chicks of 1 day age, injecting 10 in each brain^‐1Diluted fresh allantoic fluid containing venom 0.05 mL. Another 5 of the above-mentioned animals were treated with the same injection of 0.05mL of sterile physiological saline as a control. After inoculation, chicks were recorded daily at the time of the respective inoculation, and classified as normal (active, without ataxia), sick (including paralyzed, lying on bed, but not including those showing only dull) and dead.

Observing for 8 days, calculating the total number of normal, diseased and dead chickens, and accumulating the total score according to different weights (normal is 0, diseased is 1, and dead is 2).

ICPI is the average of the cumulative total score divided by the cumulative total of normal, diseased and dead animals (results are shown in table 1).

Table 1: measurement of WF Strain and SL Strain MDT and ICPI

The results show that the SL strain conforms to the characteristics of a virulent strain and is consistent with the characteristics of the virulent strain of the F gene cleavage site; although the F gene cleavage site of the WF strain also conforms to the characteristics of a virulent strain, the results in Table 1 show that the WF strain belongs to a medium-weak strain, and the virulence of the Newcastle disease is proved to be related to not only the F protein, but also other proteins such as the P protein and the like.

Example 3: determination of whole genome sequence of Newcastle disease WF strain and SL strain

In order to determine whether a p protein also generates a mutation, 9 pairs of primers were designed based on the NDV gene sequence published by NCBI, and partial nucleic acid sequences between adjacent amplified fragments overlapped with each other. The primers were synthesized by Shanghai Bioengineering, Inc., and the sequences are shown in Table 2.

TABLE 2 primer sequences for amplifying the entire genome of the NDV SL strain

Extracting virus RNA by a conventional method, carrying out reverse transcription, carrying out PCR amplification by the primer, connecting PMD 19-T vector sequencing, comparing the sequenced sequences at an NCBI website, and splicing by Lasergene software to obtain the whole gene sequences of the WF strain and the SL strain.

The results show that the total length of the genome of the WF strain and the SL strain is 15192bp, compared with the strains such as Lasota and the like, the genome has more than 6 bases between the 1646-th 1647-th bases, and the characteristics of the gene VII type Newcastle disease strain are met.

Further, the comparison of the P genes of the WF strain and the SL strain with the P genes of other genes VII type Newcastle disease viruses published by NCBI shows that the 237 th and 240 th amino acids of the P protein of the WF strain are different from those of other strains, the 237 th and 240 th amino acids of the P protein of the SL strain of other strains are K/R and K, and the P proteins of the WF strain are T and I respectively (the amino acid sequences are SEQ ID NO:1, and the nucleotide sequences of the coding genes are SEQ ID NO: 2).

Example 4: construction of gene VII type Newcastle disease virus attenuated strain

The reverse genetic manipulation technology is used for verifying whether the mutation of the WF strain P protein is the reason for the WF strain to become a low virulent strain. The reverse genetic manipulation technique generally refers to the functional genome research of viruses and the development of novel vaccines by constructing genomic cDNA clones of the viruses, reactivating the viruses in cultured cells or/and susceptible hosts, modifying the genome sequences of the viruses by methods such as gene insertion or deletion and the like. The rescue process of the NDV of this example is to co-transfect cells with the constructed whole genome cDNA clone (transcription vector) and helper plasmids (expression vectors) containing NP, P and L genes, respectively, under the action of enzymes provided by the helper plasmids, the cDNA clone is transcribed and each gene is expressed, finally, infectious virions are assembled, and then, a large amount of viruses are amplified by inoculating chicken embryos to obtain the rescued NDV. The rescued NDV genome was finally derived from a cDNA clone.

The specific steps are described below.

1) Construction of cell lines expressing T7RNA polymerase

Selecting a single clone of escherichia coli BL21, shaking the bacteria in a test tube, taking 400uL of bacteria liquid, centrifuging at 13000rpm for 10 minutes, and removing a supernatant; resuspending with ultrapure water, centrifuging, and removing supernatant; resuspending with 100uL of ultrapure water, boiling for 10min, and ice-cooling for 10 min; centrifuging, and taking the supernatant as a DNA template. According to the T7RNA polymerase gene sequence of BL21 strain published by NCBI, primers are designed: T7-F: 5'CTGCTCGAGCCACCATGAACACGATTAACATCGCTAAGAACGAC 3', T7-R: 5' CTGTCTAGATTACGCGAACGCGAAGTCCGACTCTAAGATGT, the upstream primer contains an Xho I cleavage site and the downstream primer contains an Xba I cleavage site. PCR amplification was carried out using the prepared DNA as a template, and the amplified fragment was about 2.6Kb in size.

And taking 5uL PCR product for nucleic acid electrophoresis identification, and if the band is correct, purifying the rest PCR product by using a nucleic acid purification kit. The purified product was subjected to Xba I/Xho I double digestion with eukaryotic expression vector PCI-neo. Positive bands were recovered and ligated with T4DNA Ligase. Transformation, small-scale extraction of plasmid, enzyme digestion identification and the like are carried out according to a conventional method. The positive plasmid is sent to Shanghai biological engineering company Limited for sequencing to obtain a recombinant plasmid PCI-T7.

DF1 cells were cultured in DMEM medium containing 10% fetal bovine serum, and inoculated uniformly onto a 60mm Dish, and transfected when the cells grew to 70% -90%. 2ug of PCI-T7 recombinant plasmid was used to transfect DF1 cells as required by the calcium phosphate transfection kit instructions. The medium was changed to fresh G418-free growth medium 4h after transfection and to growth medium containing 400ng/mL G418 24h later. The growth medium containing 600ng/mL G418 was used for the first passage, and the concentration of G418 was gradually increased for the subsequent passages until the concentration of G418 reached 1 mg/mL. Cells are continuously passaged for 20 generations, RNA is extracted, reverse transcription is carried out after the cells are treated by DNase, the cells are amplified by a primer T7-F/T7-R, and the expression condition of T7RNA polymerase is identified.

The constructed cell line can be stably passaged through identification, and the T7RNA polymerase gene obtained by transfection can be continuously expressed. The constructed cell line stably expressing T7RNA polymerase was named DF 1-T7.

2) Construction of full-Length cDNA cloning vector for SL Strain

Based on the determined genome-wide sequence of the SL strain, the digestion sites were analyzed by Oligo 7 software. The whole genome is divided into 7 segments, and the segments are connected to the modified vector PBRT. Wherein, the 710 th and 719 th base mutations in the P gene are modified and then connected, the constructed full-length cDNA cloning vector is named as PBRT-NDV-P, and after the sequencing is correct, the full-length cDNA cloning vector is stored for later use. On the basis of the constructed PBRT-NDV-P vector, the basic amino acid cleavage site of the F gene representing the characteristics of a virulent strain in the 3 rd segment is mutated into a sequence with low pathogenicity, the constructed full-length cDNA cloning vector is named as PBRT-NDV, and the PBRT-NDV is stored for later use after the sequencing is correct. The primers were synthesized by Shanghai Bioengineering Co., Ltd, and the sequences of the primers are shown in Table 3. Wherein CL 2-T1/CL 2-T2/CL 2-T3/CL 2-T4 is an F gene mutation primer, and CL 2-2F/CL 2-T5/CL 2-T6/CL 2-2R is a P gene mutation primer.

Table 3: primer sequence for NDV whole genome vector construction

3) Construction of helper plasmids

Respectively introducing enzyme cutting sites at the upstream and downstream of the NP, P and L genes of the SL strain, carrying out enzyme cutting after PCR amplification, connecting a PCI-neo vector treated by the same endonuclease, carrying out sequencing and storing,

named PCI-NP, PCI-P, and PCI-L, respectively. The primers used were synthesized by Shanghai Bioengineering Co., Ltd, and the sequences of the primers are shown in Table 4.

Table 4: primer sequence for NDV helper plasmid construction

4) Virus rescue

DF 1-T7 cells are inoculated in a 35mm six-hole plate and grow to 70% -80% of a monolayer, transcription plasmid PBRT-NDV-P and auxiliary plasmids PCI-NP, PCI-P and PCI-L are co-transfected into a DF 1-T7 cell line respectively according to the proportion of 5ug, 2.5ug, 1.25ug and 1.25ug, a calcium phosphate transfection kit is adopted, and the operation is carried out according to the kit instruction. At the same time, the transcription plasmid PBRT-NDV was co-transfected with the above helper plasmid DF 1-T7 cell line in the same amount and manner. After 3-5 days of transfection, culture supernatant is harvested and inoculated into allantoic cavities of SPF chick embryos of 9-11 days old, the chick embryos are cultured for 3-5 days, and the chick embryo allantoic fluid is taken to measure HA titer. And (4) harvesting the positive allantoic fluid of the HA test result, subpackaging and freezing at-70 ℃. The rescued P gene-only modified strain was designated as strain rSL-P, and the rescued P and F gene co-modified strain was designated as strain rSL.

Wherein the gene VII type Newcastle disease virus rSL-P strain is preserved in the China center for type culture Collection of Wuhan university in Wuhan, Wuhan university in 2017, 3 months and 20 days, and the preservation number is CCTCC NO: V201710;

the gene VII type Newcastle disease virus rSL strain is preserved in the China center for type culture Collection of the university of Wuhan and Wuhan in 2017, 3 and 20 months, with the preservation number of CCTCC NO: V201709;

allantoic fluid is harvested 4 days after embryo inoculation of transfection solution, the Hemagglutination (HA) test is positive, the chicken embryo titer is 2⁶‐2⁸In the meantime. Diluting the harvested allantoic fluid at a ratio of 1: 1000-1: 10000, continuing embryo inoculation at a thickness of 0.1mL/piece, collecting embryos after 4-5 days; passage was continued to passage 15. Respectively taking rSL-P strain and rSL primary, 5 th, 10 th and 15 th generation virus allantoic fluid to extract RNA, amplifying mutant sequence sites (P gene and P/F gene) by PCR and sequencing, wherein the identification result is consistent with the expected result. The virus rescue is successful, the passage is stable, and the reconstructed site does not generate back mutation again.

Example 5 mean lethal time (MDT) of chick embryos of newly rescued viruses (rSL-P and rSL strains)

Diluting newly harvested allantoic fluid containing toxin with sterile physiological saline by 10 times, and collecting 10 times^‐7、10^‐8、10^‐93 dilutions, respectively inoculating 10-day-old chick embryos, inoculating 5 chick embryos at each dilution, injecting 0.1mL into allantoic cavity of each chick, irradiating eggs for 1 time at the same time of inoculation every day, recording death time of each chick embryo, and determining HA activity. After continuous observation for 7 days, the highest dilution of all the inoculated chick embryos which are dead is the minimum lethal dose.

The results showed that the MDT value of rSL-P strain was 108h, and the MDT value of rSL strain was 128h, and the specific results are shown in Table 5.

Table 5: determination of average mortality time (MDT) of chick embryos of rSL-P strain and rSL strain

Example 6, rSL-P Strain, rSL Strain determination of intracerebral pathogenicity index (ICPI)

10 SPF chicks of 1 day old are taken and injected into each brain for 10 times^‐1Diluted fresh allantoic fluid containing venom 0.05 mL. Another 5 of the virus-diluted solutions were injected in the same manner, each 0.05 mL.

After inoculation, chicks were recorded daily at the corresponding inoculation time and scored as normal, sick and dead. Observing for 8 days, calculating the total number of normal, diseased and dead chickens, and accumulating the total score according to different weights (normal is 0, diseased is 1, and dead is 2). ICPI is the average of the cumulative total score divided by the cumulative total of normal, diseased and dead chickens.

The results showed that the ICPI value of rSL-P strain was 0.9 and that of rSL strain was 0.35, and the specific results are shown in Table 6.

Table 6: measurement of ICPI of rSL-P Strain and rSL Strain

Example 7, rSL-P Strain, rSL Strain determination of intravenous pathogenicity index (IVPI)

10 SPF chickens of 6 weeks old are taken and inoculated into each vein with 10 chickens^‐1Diluted allantoic fluid containing venom 0.1mL, and 5 additional inoculations of physiological saline as control. The inoculated chickens were recorded, normal, sick, paralyzed and dead, observed daily at the corresponding time of inoculation.

After 10 days of observation, the number of normal, sick, paralyzed and dead animals was accumulated, and the total score was accumulated according to different weights (normal 0, sick 1, paralyzed 2 and dead 3). IVPI is the cumulative total divided by the cumulative total of normal, diseased and dead animals.

The results showed that IVPI values of rSL-P strain and rSL strain were 0, and the specific results are shown in Table 7.

By combining the analysis of the measurement results of MDT, ICPI and IVPI values of two rescued strains, the toxicity of rSL-P strain is greatly reduced compared with that of a wild SL strain, which indicates that two sites of P gene really influence the toxicity of SL strain, and rSL strain obtained by combined transformation of P gene and F gene has completely reduced toxicity, completely accords with the characteristics of low-toxicity strain, and can better ensure the safety of vaccine use as a vaccine candidate strain.

Table 7: measurement of IVPI of rSL-P Strain and rSL Strain

Example 8 inactivation of WF Strain and stability test after inactivation

Through a series of verification, the WF strain is proved to have biological safety and potential as a candidate strain of the vaccine.

The harvested WF strain was added to a 0.1% final concentration formaldehyde solution, inactivated at 37 ℃ for 24 hours, and stored at 4 ℃. HA titers were determined at 0h, 24h, 48h, 7 days, 15 days, 1 month after inactivation, respectively, and the stability of the inactivated viruses was determined, and the results are shown in Table 8. And inoculating 10 SPF (specific pathogen free) chick embryos of 10 days old to the inactivated stock solution, culturing for 120h at 37 ℃, collecting embryos, measuring the titer, and checking the inactivation completeness.

The results show that the inactivated virus is stable, and the HA titer is not obviously reduced after the inactivated virus is placed for a period of time. And the inactivation is more thorough, the inactivated antigen stock solution inoculated with the chick embryos does not die, and the HA titer is all negative.

Table 8: inactivated antigen HA potency

Example 9 preparation of inactivated vaccine against WF Strain and safety test and sterility test

Preparing the inactivated virus stock solution into the oil adjuvant inactivated vaccine according to a conventional method. 10 SPF (specific pathogen free) chickens of 7 days old are respectively used for each group of inactivated vaccine, 1.0mL of vaccine is injected subcutaneously into each neck, 5 controls are respectively arranged at the same time, the inactivated vaccine is raised under the same condition, the continuous observation is carried out for 14 days, and the feeding, drinking and clinical conditions of the test chickens are recorded. The result shows that the vaccine absorption effect is good after immunization, the immune chicken does not have any local and systemic adverse reaction, and the state of the chicken is completely normal.

And (3) taking the prepared WF strain adjuvant vaccine, and carrying out sterile inspection according to the appendix of Chinese animal pharmacopoeia 2010 edition, wherein the result meets the standard and no bacterial pollution exists.

Example 10 evaluation of immune Effect of WF Strain oil-adjuvanted inactivated vaccine

40 SPF chickens of 21 days old are randomly divided into three groups, one group is a negative control group, one group is a WF strain vaccine immunization group, and the other group is a Lasota strain immunization group. 0.2mL of vaccine is injected subcutaneously into each neck of an immune group, the control group is immunized with PBS with the same dose, and the immune group and the control group are kept separately. Blood was collected 21 days and 28 days after the immunization, and serum was separated and antibody was measured. After the blood collection for 28 days, the virulent strain WH strain of the clinically isolated gene VII type wild strain is used for counteracting the virulent strain, and each chicken is injected with 10 intramuscular injections⁶EID50 isolatorFeeding, observing for 14 days, and recording the morbidity and mortality of the chickens every day; and collecting throat swabs and cloaca swabs of two groups of immune group chickens to be connected with embryos on the 3 rd day after the detoxification, and detecting the detoxification condition.

The results show that the immunization group produced higher levels of antibody after 21 days of immunization, and the antibody levels were higher at 28 days, and the results are shown in Table 9. After challenge, none of the immunized groups died, while all of the negative control groups died after 5 days. The detoxification condition shows that animals immunized with WF strain vaccine have no detoxification, while Lasota strain still has detoxification phenomenon, as shown in tables 10 and 11.

Table 9: post-immunization antibody titer determination

Table 10: results of immunopotency experiments

TABLE 11 day 3 Virus isolation results after challenge

In conclusion, the vaccine candidate strain WF strain obtained by natural screening can induce and generate higher neutralizing antibody after being prepared into vaccine to immunize animals, can resist the invasion of virulent gene VII type Newcastle disease virus, and has wide application prospect.

SEQUENCE LISTING

<110> Shandong Xin De science and technology Co., Ltd

<120> a gene VII type Newcastle disease vaccine

<130>

<160>2

<170>PatentIn version 3.5

<210>1

<211>395

<212>PRT

<213>1

<400>1

Met Ala Thr Phe Thr Asp Ala Glu Ile Asp Asp Ile Phe Glu Thr Ser

1 5 10 15

Gly Thr Val Ile Asp Ser Ile Ile Thr Ala Gln Gly Lys Ser Ala Glu

20 25 30

Thr Val Gly Arg Ser Ala Ile Pro Gln Gly Lys Thr Lys Gly Leu Ser

35 40 45

Thr Ala Trp Glu Lys His Gly Ser Val Gln Pro His Ala Ser Gln Asp

50 55 60

Ala Pro Asp Gln Pro Asp Arg Thr Glu Lys Gln Pro Ser Thr Pro Gly

65 70 75 80

Gln Ala Thr Pro His Asn Asn Pro Pro Ile Thr Ser Thr Glu Pro Pro

85 9095

Pro Thr Gln Ala Ala Ser Glu Thr Ser Asp Thr Gln Leu Lys Thr Gly

100 105 110

Ala Ser Asn Ser Leu Leu Ser Met Leu Asp Lys Leu Ser Asn Lys Ser

115 120 125

Ser Asn Ala Lys Lys Gly Pro Trp Ser Gly Pro Gln Glu Gly His His

130 135 140

Gln Ser Pro Ala Gln Gln His Gly Asp Gln Pro Ser His Gly Ser Asn

145 150 155 160

Gln Gly Arg Pro Gln His Gln Ala Lys Ala Val Pro Gly Asn Arg Gly

165 170 175

Ile Asp Glu Asn Thr Ala Tyr His Gly Gln Arg Lys Glu Ser Gln Pro

180 185 190

Ser Ala Gly Ala Thr Pro His Ala Pro Gln Ser Gly Gln Ser Gln Asp

195 200 205

Asn Ile Pro Val Pro Val Asp Arg Val Gln Leu Pro Ala Asp Phe Ala

210 215 220

Gln Ala Met Met Ser Met Met Glu Ala Leu Ser Gln Thr Val Ser Ile

225 230 235 240

Val Asp His Gln Leu Asp Leu Val Leu Lys Gln Thr Ser Ser Ile Pro

245 250 255

Met Met Arg Ser Glu Ile Gln Gln Leu Lys Thr Ser Val Ala Ile Met

260 265 270

Glu Ala Asn Leu Gly Met Met Lys Ile Leu Asp Pro Gly Cys Ala Asn

275 280 285

Val Ser Ser Leu Ser Asp Leu Arg Ala Val Ala Arg Ser His Pro Val

290 295 300

Leu Val Ser Gly Pro Gly Asp Pro Ser Pro Tyr Val Thr Gln Glu Gly

305 310 315 320

Glu Met Thr Leu Asn Lys Leu Ser Gln Pro Val Gln His Pro Ser Glu

325 330 335

Leu Ile Lys Ser Ala Thr Ala Ser Gly Pro Asp Met Gly Val Glu Lys

340 345 350

Asp Thr Val Arg Ala Leu Ile Thr Ser Arg Pro Met His Pro Ser Ser

355 360 365

Ser Ala Lys Leu Leu Ser Lys Leu Asp Ala Ala Lys Ser Ile Glu Glu

370 375 380

Ile Arg Lys Ile Lys Arg Leu Ala Leu Asn Gly

385 390 395

<210>2

<211>1188

<212>DNA

<213>2

<400>2

atggctactt ttacagatgc ggagatagat gacatatttg agaccagcgg gactgtcatt 60

gatagcataa ttacggccca gggcaaatca gctgagaccg tcggaagaag cgcgatcccg 120

cagggcaaga ccaaaggtct aagcacagca tgggagaagc acgggagtgt ccagccacac 180

gccagtcagg acgcccctga ccaaccagac agaacagaaa aacagccatc cacacctggg 240

caggcgactc cacacaacaa cccgccgatc acatccactg aaccgccccc cactcaggcc 300

gcaagcgaga ccagcgacac acagctcaaa accggagcaa gcaactccct tctgtccatg 360

ctcgacaaat tgagcaataa atcgtctaat gctaaaaagg gcccatggtc gggtccccaa 420

gaagggcatc accaatctcc ggcccaacaa cacggggacc agccgagcca tggaagcaac 480

cagggaagac cacagcacca ggccaaagcc gtccctggaa accggggcat agacgagaac 540

acagcatatc atggacaacg gaaggagtca caaccatcag ctggtgcaac ccctcatgcg 600

ccccagtcag ggcagagcca agacaatatt cctgtacctg tggatcgtgt ccagctacct 660

gccgactttg cgcaggcgat gatgtctatg atggaggcat tatctcagac ggtaagtata 720

gttgatcatc agctggacct agtcttgaaa cagacatcct ctattcctat gatgcgatct 780

gaaatccaac agctcaagac atctgttgcg atcatggaag ctaacttagg catgatgaaa 840

attctggacc ctggttgtgc caacgtttca tccttaagtg atctccgggc agtagcccga 900

tcccacccag tcctagtttc aggccccgga gacccatctc cttacgtgac acaagaaggt 960

gaaatgacgc tcaataaact ctcacaacca gtgcagcacc cttctgaatt gattaagtct 1020

gccaccgcaa gcgggcctga catgggagtg gagaaggaca ctgtccgcgc attaatcacc 1080

tcacgcccga tgcatccaag ctcctcggct aagctcctga gcaagctaga tgcagccaag 1140

tcaattgaag agatcaggaa gattaaacgc cttgcgctga atggttga 1188

Claims

1. The gene VII type newcastle disease inactivated vaccine is characterized in that an antigen used in the gene VII type newcastle disease inactivated vaccine is an inactivated gene VII type newcastle disease virus low virulent strain, and the preservation number of the gene VII type newcastle disease virus low virulent strain is CCTCC NO: V201708.

2. The inactivated vaccine of newcastle disease gene VII as claimed in claim 1, wherein said attenuated strain of newcastle disease virus gene VII is inactivated with formaldehyde.

3. A composite vaccine is characterized in that an antigen in the vaccine comprises a gene VII type Newcastle disease virus low virulent strain with a preservation number of CCTCC NO: V201708.