CN112143713A

CN112143713A - Recombinant adenovirus expressing porcine coronavirus S1 gene and preparation method thereof

Info

Publication number: CN112143713A
Application number: CN202011061204.8A
Authority: CN
Inventors: 赵攀登; 吕玉金; 张晓战; 井汇源; 吴玉臣
Original assignee: Henan University of Animal Husbandry and Economy
Current assignee: Henan University of Animal Husbandry and Economy
Priority date: 2020-09-30
Filing date: 2020-09-30
Publication date: 2020-12-29

Abstract

The invention discloses a recombinant adenovirus expressing a porcine coronavirus S1 gene and a preparation method thereof, wherein the recombinant adenovirus comprises a porcine coronavirus S1 gene, the recombinant adenovirus can stably express a porcine coronavirus S1 protein after infecting AD293 cells, and the preparation method comprises the following steps: obtaining total RNA of the porcine coronavirus; carrying out reverse transcription on the S1 gene and identifying; obtaining a cDNA template of an S1 gene; designing a primer, amplifying an S1 gene, purifying and recovering; constructing pDC315/S1 recombinant plasmid; amplifying the pDC315/S1 recombinant plasmid obtained from S14; and (2) carrying out virus packaging on the pDC315/S1 recombinant plasmid obtained from S15 to obtain the recombinant adenovirus containing the pDC315/S1 recombinant plasmid, wherein the recombinant adenovirus is successfully packaged, and the recombinant adenovirus can express a large amount of S1 protein accurately after infecting AD293 cells, thereby laying a foundation for preparation of vaccines.

Description

Recombinant adenovirus expressing porcine coronavirus S1 gene and preparation method thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a recombinant adenovirus expressing a porcine coronavirus S1 gene and a preparation method thereof.

Background

Porcine coronavirus (PDCoV) is a new coronavirus, which can cause vomiting, diarrhea, dehydration and even death of piglets, and causes huge loss to the pig industry. The 4 structural proteins mainly coded by PDCo V are Spike protein (S1), nucleocapsid protein (N), membrane glycoprotein (M) and small membrane protein (E), wherein the Spike protein is coded by S1 gene, so the Spike protein is also called S1 protein, the S1 protein has receptor binding site and determines the tropism of the virus, and the structural protein can induce the pig to generate neutralizing antibody for immune protection, so the recombinant adenovirus carrying the S1 gene can be used for preparing vaccine, activating the humoral immunity and cellular immunity of the pig, and has great advantages for the prevention and control of the pig coronavirus, however, related research on the adenovirus carrying the S1 gene of the pig coronavirus is not available at present.

Disclosure of Invention

In view of the above, the present invention aims to provide a recombinant adenovirus expressing the S1 gene of porcine coronavirus and a preparation method thereof, and the recombinant adenovirus is successfully packaged, and can accurately express a large amount of S1 protein after infecting AD293 cells, thereby laying a foundation for vaccine preparation.

In order to achieve the purpose, the invention adopts the following technical scheme:

the recombinant adenovirus for expressing the porcine coronavirus S1 gene comprises a porcine coronavirus S1 gene, and can stably express the porcine coronavirus S1 protein after the recombinant adenovirus infects AD293 cells.

Furthermore, the sequence of the pig coronavirus S1 gene is shown as S1EQ ID NO.1, and the sequence of the pig coronavirus S1 protein is shown as S1EQ ID NO. 2.

Further, the method comprises the following steps:

s1, obtaining total RNA of the porcine coronavirus;

s2, carrying out reverse transcription on the S1 gene and identifying;

s3, obtaining a cDNA template of the S1 gene;

s4, designing a primer, amplifying the S1 gene, purifying and recovering;

s4, constructing a pDC315/S1 recombinant plasmid;

s5, amplifying pDC315/S1 recombinant plasmid obtained from S4;

s6, carrying out virus packaging on the pDC315/S1 recombinant plasmid obtained from S5 to obtain the recombinant adenovirus containing the pDC315/S1 recombinant plasmid.

Further, in step S11, the step of identifying RNA containing transcribed S1 gene comprises:

1) designing an identification primer, wherein the identification primer comprises an upstream primer and a downstream primer, the upstream primer is PDCoV-S1-pF1, see S1EQ ID No.3, and the downstream primer is PDCoV-S1-pR1, see S1EQ ID No. 4;

2) reverse transcription and amplification of total RNA;

3) running glue and observing a target strip.

Further, the primers comprise an upstream primer and a downstream primer, wherein the upstream primer is PDCoV-S1-F (shown in SEQ ID NO. 5), and the downstream primer is PDCoV-S1-R (shown in SEQ ID NO. 6).

Further, the method also comprises the following steps:

s7, infecting AD293 cells with the recombinant adenovirus obtained in the step S16, and identifying the expression condition of the S1 protein

The invention has the beneficial effects that:

1. the recombinant adenovirus containing the S1 gene is prepared, the adenovirus can accurately express the S1 protein after infecting AD293 cells, the expressed purity is high, the quantity is large, the adenovirus titer is high, and a foundation is provided for the preparation of subsequent vaccines.

2. The S1 protein expressed by the recombinant adenovirus prepared by the method after infecting eukaryotic cells has good immunogenicity, can well stimulate an organism to generate humoral immunity and cellular immunity, and has great advantages for preventing and controlling porcine coronavirus.

Drawings

FIG. 1 is a diagram showing the result of identification of the S1 gene;

FIG. 2 is a diagram showing the results of the running water after PCR amplification of the S1 gene;

FIG. 3 is a diagram showing the results of PCR identification of recombinant plasmids;

FIG. 4 is a diagram showing the results of restriction enzyme identification of recombinant plasmids;

FIG. 5 is a diagram showing the results of expressing the S1 gene after AD293 cells are infected with recombinant adenovirus;

FIG. 6 is a Western blot identification result chart of S1 protein.

Detailed Description

The technical solution in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention. It is to be understood that the described embodiments are merely exemplary of the invention, and not restrictive of the full scope of the invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The recombinant adenovirus expressing the porcine coronavirus S1 gene comprises the porcine coronavirus S1 gene and can stably express the porcine coronavirus S1 protein.

The sequence of the pig coronavirus S1 gene is shown as SEQ ID NO.1, and the sequence of the pig coronavirus S1 protein is shown as SEQ ID NO. 2.

The preparation method of the recombinant adenovirus for expressing the porcine coronavirus S1 gene comprises the following steps:

s11, obtaining total RNA of the porcine coronavirus, comprising the following steps:

1) treatment of pathological material

Taking pig disease material (intestinal tract tissue of pig infected with PDCoV), adding 1ml of sterile PBS1, fully grinding, placing in a 1.5ml EP tube, repeatedly freezing and thawing at-80 deg.C for 3 times, centrifuging at 4 deg.C and 8000Xg for 10min, and taking supernatant;

2) extraction of Total RNA

The method for extracting total RNA by adopting the viral RNA extraction kit comprises the following steps:

1. preparing a Buffer VRL/Carrier RNA mixed solution: mu.l of Carrier rRNA (1 ug/. mu.l) was added to 1ml of Buffer VRL, and the precipitate was completely dissolved in a water bath at 60 ℃ for 3 minutes before use;

2. transfer 560. mu.l of BufferVRL (containing Carrier rRNA) to a 1.5ml centrifuge tube;

3. transferring 140 mu l of supernatant obtained in the step 1) into a centrifuge tube filled with buffer VRL/Carrier rRNA, mixing uniformly by vortex for 20 seconds, and standing for 10 minutes at room temperature of 25 ℃;

4. adding 560 mul of absolute ethyl alcohol into the lysate, and uniformly mixing for 20 seconds by vortex;

5. placing HiPure RNA Micro Column in a 2ml collection tube, transferring 700. mu.l of the mixed solution to a Column, centrifuging at 10000Xg for 60 seconds, discarding the filtrate, placing the Column in the collection tube, transferring the remaining mixed supernatant to the Column, centrifuging at 10000Xg for 60 seconds, and repeating the steps until all the mixed solution is filtered from the Column;

6. the column was loaded in a fresh collection tube, 600. mu.l of BufferVHB (diluted with ethanol) was added to the column, and centrifugation was carried out at 10000Xg for 60 seconds;

7. the filtrate was decanted, the column was returned to the collection tube, 600. mu.l Buffer RW2 (diluted with ethanol) was added to the column, and centrifugation was carried out at 10000Xg for 60 seconds;

8. the filtrate was decanted, the column was returned to the collection tube, 600. mu.l Buffer RW2 (diluted with ethanol) was added to the column, and centrifugation was carried out at 10000Xg for 60 seconds;

9. pouring the filtrate, putting the column back into the collecting pipe, and centrifuging the hollow column at 13000Xg for 3 minutes to dry the column;

10. the column was transferred to a new 1.5ml centrifuge tube, 30. mu.l of RNAS1e Free Water was added to the center of the membrane of the column, left to stand at room temperature for 2 minutes, centrifuged at 13000Xg for 1 minute, the column was discarded, and the viral RNA was stored at-80 ℃.

S2, carrying out reverse transcription on the S1 gene and identifying, wherein the method comprises the following steps:

1) identification primer design

By utilizing a specific system, a primer sequence of the S1 gene is designed, the primer comprises an upstream primer and a downstream primer, the upstream primer is PDCoV-S1-pF1, and the sequence is as follows: ATGCAGAGAGCTCTATTC

See SEQ ID No. 3;

the downstream primer is PDCoV-S1-pR1, and the sequence is as follows: GAACAAACTAGGTCAGCGAT

See SEQ ID NO. 4.

S3, obtaining a cDNA template of the S1 gene, and the steps are as follows:

1) the following reverse transcription systems were prepared in RNaS1e-free centrifuge tubes, as shown in table 3:

TABLE 1 reverse transcription System

Reaction system	Total volume 8. mu.l
		Total RNA	3μl
Kandom hexamers	1μl
		ddH2O	4μ1

Mixing, removing, placing in a water bath kettle at 65 deg.C for 5min, rapidly cooling on ice, and ice-cooling for 2 min.

2) First Strand cDNA Synthesis reaction solutions were prepared, and the compositions of the synthesis reaction solutions are shown in Table 4

TABLE 2 cDNA Synthesis reaction solution

Reaction system	Total volume 20. mu.l
		The mixed liquid of the last step	8μl
2xRT Mix	10μl
		HiScript II Enzyme Mix	2μl

The mixture was gently pipetted and mixed, and first strand cDNA synthesis reaction was performed according to the conditions in table 5:

TABLE 3 reaction conditions of the reaction solution for cDNA Synthesis

Reaction temperature	Time of action
		25℃	5min
50℃	45min
		85℃	2min

After the reaction is completed, a mixture containing the first strand cDNA template is obtained.

S4, designing a primer, amplifying the S1 gene, purifying and recovering, comprising the following steps:

1) design of primers

PDCoV-S1-F：CTAGCTAGCGCCACCATGGAGAGAGCTC

See SEQ ID NO. 5; cleavage site Nhel

PDCoV-S1-R：GCGGGATCCCTAACGTAGTCTGGGACGTAAGTAGGTGTGACAATAGTAGTA，

See SEQ ID No. 6; cleavage site BamH1

2) The cDNA template obtained in step S2 was amplified to construct a PCR amplification system, as shown in table 6:

TABLE 4 PCR amplification System

The reaction steps are as follows: firstly, pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 56.2 ℃ for 30s, extension at 72 ℃ for 2min, circulating for 35 times totally, and finally extension at 72 ℃ for 10min to obtain a DNA solution;

3) the identification of the S1 gene, the preparation of agar gel, the formulation of which is shown in Table 5

TABLE 5 formulation of agar gel

Reaction system	Volume of
		Agarose (agarose)	0.3g
Nucleic acid dyes	3μL
		TAE	30mL

Wherein, the concentration of agarose is 1%, the PCR amplified product obtained in step S42) is subjected to gel running on an agarose gel, and the gel running electrophoresis chart is shown in figure 1, and as can be seen from figure 1, the S1 gene fragment with the expected size is successfully amplified.

4) Purification and recovery of S1 Gene

1. Placing the agarose gel under an ultraviolet lamp, cutting a target fragment, placing the cut fragment in a centrifugal tube of 1.5ml, and weighing;

2. according to the weight and concentration of the gel block, BufferB2 is added according to the proportion of adding 300-;

3. placing the centrifuge tube in 50 deg.C water bath for 5-10min, and mixing at intervals until the gel blocks are completely dissolved;

4. transferring all the dissolved solution into an adsorption column, centrifuging at 8000Xg for 30s, pouring out the liquid in the collecting pipe, and putting the adsorption column into the same collecting pipe;

5. adding 300 μ l Buffer B2,8000Xg to the adsorption column, centrifuging for 30s, pouring out liquid in the collecting pipe, and placing the adsorption column into the same collecting pipe;

6. adding 500 μ l of Wash Solution into the adsorption column, centrifuging at 9000Xg for 30s, pouring out the liquid in the collecting tube, and putting the adsorption column into the same collecting tube;

7. repeating the step 6 once;

8. placing the empty adsorption column and the collection tube into a centrifuge, and centrifuging for 1min at 9000 Xg;

9. adding 15-40 μ l of Elution Buffer in the center of the adsorption membrane, standing at room temperature for 1-2min, centrifuging at 9000Xg for 1min, and storing the obtained DNA solution at-20 ℃ for subsequent tests;

10. the purity of the nucleic acid product was determined and the next experiment was performed if the A260/A280 ratio was 1.94 and the concentration was 35.0. mu.g/ml.

S5 construction of pDC315/S1 recombinant plasmid

1) Extraction of pDC315 plasmid

1. Taking 12ml of overnight cultured bacterial liquid, dividing the bacterial liquid into 12 EP tubes with the volume of 1.5ml, centrifuging the bacterial liquid at 8000xg for 2min, collecting thalli, and discarding the culture medium;

2. adding 250 μ l of Buffer P1 into one EP tube, completely suspending the thallus, transferring the liquid into the next EP tube, and completely suspending the precipitate;

3. add 250. mu.l of Buffer P2 and mix by immediately inverting the tube gently 5-10 times. Standing for 2-4 minutes at room temperature;

4. adding 350 μ l Buffer P3, immediately and gently inverting the centrifuge tube for 5-10 times, and mixing uniformly;

5.12000Xg for 5-10 minutes. Transferring the supernatant into an adsorption tube, centrifuging at 8000Xg for 30s, and pouring out liquid in the collection tube;

6. adding 500 mul Buffer DW1, centrifuging at 9000Xg for 30s, and pouring out the liquid in the collecting pipe;

7. adding 500 mu l of Wash Solution, centrifuging for 30 seconds at 9000Xg, and pouring out liquid in a collecting pipe;

8. repeating the step 7 once;

9. the empty column was centrifuged at 9000Xg for 1 min;

10. the adsorption column was placed in a clean 1.5ml centrifuge tube, 50. mu.l of Elution Buffer was added to the center of the adsorption membrane, and after standing at room temperature for 1 minute, the tube was centrifuged for 1 minute, and the DNA solution in the tube was stored.

2) Double restriction enzyme digestion S1 gene and pDC315 plasmid

The S1 gene and the pDC315 vector were double-digested with NehI and BamH I, respectively.

The double enzyme system is shown in Table 6:

TABLE 6 double enzyme digestion System

	pDC315 plasmid	S1 gene
			10X
	5	5
			BamHl	1.5	2.5
Nehl	1.5	2.5
			DNA	8.7	18
ddH20	33.3	22

Water bath at 37 ℃ for 15min, after which gel recovery was carried out, the recovery procedure was the same as S43), S34), and the pDC315 plasmid and S1 gene concentrations were determined, and the data were shown in table 7:

TABLE 7 pDC315 plasmid and S1 Gene concentration

	Concentration of	A260/A280
			pDC315	16μg/ml	1.72
S1 gene	12.2μg/ml	1.89

3) The pDC315 plasmid and the S1 gene were ligated together, the ligation system being shown in Table 8:

TABLE 8 connection System

Reaction system	Total volume 20. mu.l
		10^＊Buffer	2μl
T4-DNA-Ligase	1μl
		S1 gene	13.5μl
pDC315	3.5μl

Ligation was carried out at 16 ℃ for 6 hours to obtain a ligation solution containing the pDC315/S1 recombinant plasmid.

S5, amplifying pDC315/S1 recombinant plasmid obtained from S4, comprising the following steps:

1) transforming competent cells comprising the steps of:

1. adding 100 mu lDH5 alpha competent cells into a 1.5ml EP tube, thawing on ice for 5min, adding the ligation solution obtained in step S4 into the 1.5ml EP tube, and standing on ice for 30min without shaking;

heating in water bath at 2.42 deg.C for 90s, and standing on ice for 1 min;

3. adding 900 μ l LB liquid culture medium without ampicillin, reversing, mixing, and culturing for 1h at 37 deg.C in shaking table;

4.3000 xg, centrifuging for 3min, discarding 750 mul supernatant, mixing bacterial suspension uniformly, coating plates, and culturing at 37 deg.C;

5. white single colonies were picked with an inoculating loop under a super clean bench, inoculated in an Amp + resistant LB medium, and shake-cultured for 12h at 37 ℃.

2) Extraction of pDC315/S1 recombinant plasmid

1.5ml of overnight cultured bacterial liquid is divided into five 1.5ml EP tubes, the bacteria are collected by centrifugation at 8000Xg for 2 minutes, and the culture medium is discarded;

3. adding 250 ul of Buffer P2, immediately and gently reversing the centrifuge tube for 5-10 times, uniformly mixing, and standing for 2-4 minutes at room temperature;

7. adding 500. mu.l of WaS1h S1 solution, centrifuging at 9000Xg for 30 seconds, and pouring out liquid in a collecting pipe;

8. repeating the step 7 once;

9. the empty column was centrifuged at 9000Xg for 1 min;

10. the adsorption column was placed in a clean 1.5ml centrifuge tube, 50. mu.l of Elution Buffer was added to the center of the adsorption membrane, and after standing at room temperature for 1 minute, the tube was centrifuged for 1 minute to preserve the DNA solution in the tube, which may contain the amplified pDC315/S1 recombinant plasmid.

3) Verification of pDC315/S1 recombinant plasmid

1. PCR identification of recombinant plasmids

Constructing a PCR amplification system, wherein the amplification system is as follows: 2X Buffer: 25 mu L of the solution; dNTP: 1 mu L of the solution; an upstream primer: 2 mu L of the solution; a downstream primer: 2 mu L of the solution; high fidelity enzyme: 1 mu L of the solution; recombinant plasmid solution: 1 mu L of the solution; ddH 2O: 18 mu L of the solution; after the amplification, agarose gel electrophoresis was performed, and the electrophoresis result is shown in FIG. 2, and a fragment with an appropriate size was obtained, which confirmed that pDC315 and S1 genes were combined into a recombinant plasmid.

2. Construction of enzyme digestion verification System, see Table 9

TABLE 9 pDC315/S1 recombinant plasmid restriction enzyme validation system

Reaction system	Total volume 10. mu.l
		10xBuffer	1μl
Uch T	0.5μl
		BamH I	0.5μl
pDC315/S	2.6μl
		ddH₂O	5.4μl

Wherein pDC315/S1 is the solution obtained in the step S52), water bath is carried out at 37 ℃ for 15min, and then agarose gel electrophoresis is carried out, and the result is shown in figure 3, which proves that the pDC315-S1 recombinant plasmid is successfully constructed.

S6, carrying out virus packaging on the pDC315/S1 recombinant plasmid obtained from S5 to obtain the recombinant adenovirus containing the pDC315/S1 recombinant plasmid, and comprising the following steps:

1) culture of AD293 cells

Placing AD293 cell line in a cell containing 1DMEM culture solution containing 0% calf serum, 37 deg.C, 5% CO₂The culture is carried out in an incubator, and the specific steps are as follows:

1. preparing 50ml of DMEM culture solution containing 10% calf serum, and preparing water at 38 ℃;

2. rapidly putting the frozen AD293 cell strain into water at 38 ℃ by using forceps to rapidly melt the cell strain;

3. putting the frozen tube into a centrifuge tube, and centrifuging at 800rpm for 5 min;

4. after the centrifugation is finished, removing the supernatant, sucking 1ml of 10% culture solution into a centrifuge tube, gently blowing, uniformly mixing, and transferring into a new cell bottle; adding 1ml of 10% culture solution into the freezing tube, transferring the residual cells into the same cell bottle, adding 4ml of 10% culture solution, standing at 37 deg.C and 5% CO₂Culturing in an incubator, observing after 24h, changing the culture solution, observing the growth condition of the cells under a microscope every day, and carrying out subculture once every 2 days.

2) Packaging of recombinant adenoviruses

1. Laying AD293 cells into two holes of a six-hole plate, culturing with 10% DMEM culture solution, changing the DMEM culture solution into 5% DMEM culture solution when the cells grow to about 80%, and placing in a CO2 incubator at 37 ℃ for 20 min;

2. two systems were prepared in each of two 1.5ml EP tubes, the compositions of the two systems being shown in Table 10

TABLE 10 compositions of DNA systems and transfection reagent systems

	DNA system	Transfection reagent system
			Backbone plasmid	10μl
pDC315/S plasmid	2.65μl
			P3000	5μl
Lipofectamine3000		7.5μl
			DMEM	125μl	125μl

Standing the two systems at room temperature for 5min, adding the DNA system into the transfection reagent system, reversing and uniformly mixing to form a mixed solution, and standing at room temperature for 10 min; in AD293 cells in two holes, 250 mu l of mixed solution is added into one of the AD293 cells to serve as an experimental group, 250 mu l of DMEM is added into the other AD293 cell to serve as a control group, 2.5ml of 5% DMEM culture solution is added into each hole, the cells are cultured in a CO2 incubator at 37 ℃, observation is carried out for 8-10 days, and the result is shown in figure 4, and shrinkage, bunching and shedding appear in AD293 cells of the experimental group, which indicates that the recombinant adenovirus is successfully packaged.

3) Subculturing of recombinant adenovirus

1. When the cells are diseased, collecting virus liquid, and repeatedly freezing and thawing at-80 ℃ for 3 times;

2. putting the melted primary virus solution into a 5ml centrifuge tube, and centrifuging for 20min at 12000 Xg;

3. old culture medium of AD293 cultured in a six-well plate was aspirated, and washed twice with PBS 1;

4. sucking supernatant by a syringe, filtering, adding 500 mu l of virus solution into cells with the cell density of 80% in each hole, and adding 500 mu l of 2% cell maintenance solution into a control hole;

5. adsorbing in a 37 deg.C 5% CO2 incubator for 1 hr, shaking up every 15 min;

6. removing virus solution, and adding 3ml of 2% cell maintenance solution;

7. after the second passage, F2 passages were inoculated into 24-well plates that had grown to around 80% of the cells.

S7, infecting AD293 cells by the recombinant adenovirus obtained in the step S6, and identifying the expression of S1 protein, wherein the steps are as follows: 1) the indirect immunofluorescence identification is adopted, and the specific steps are as follows:

1. laying AD293 cells into a six-hole plate, adding 3ml of 10% DMEM culture solution into each hole, culturing at 37 ℃ in a 5% carbon dioxide incubator until the cells grow to be full of a monolayer;

2. discarding the culture solution, washing with PBS twice, inoculating 200 μ l of the virus solution obtained in step S6 to AD293 cells, adding 3ml of 2% DMEM maintenance solution, and waiting for the cells to have pathological changes;

3. after the cells are diseased, the cell maintenance solution is discarded, and the cells are washed twice with precooled PBS (-20 ℃) for five minutes each time;

4. adding 400 μ l of fixing solution (methanol: acetone 1: 1) into each well, standing at-20 deg.C for 60 min;

5. the fixative was discarded and washed three times with PBS for five minutes each time;

6. adding mouse anti-S1 protein monoclonal antibody (1:100 dilution) 200 μ l per well, and incubating at 37 deg.C for 60 min;

7. discarding the antibody, washing three times with PBS;

8. adding 200 μ l of FITC-labeled donkey anti-mouse IgG (1:100 dilution) per well, and incubating at 37 deg.C for 45 min;

9. the antibody was discarded and washed three times with PBS for five minutes each.

The AD293 cells obtained in step S71)9 were observed under an electron fluorescence microscope, and the observation results are shown in fig. 5, from which fig. 5 shows: the contrast group has no fluorescence, the experimental group has specific green fluorescence, which indicates that the obtained recombinant adenovirus is successfully packaged, and the successfully packaged recombinant adenovirus can generate a large amount of protein after infecting AD293 cells.

2) Westernblot identification

Discarding the cells cleaned in the step S71), adding 1ml of lysis solution into the cultured cells to lyse the cells, collecting the cells in an EP tube, centrifuging for 3min at 10000 rpm, collecting the supernatant, adding a protein loading buffer solution, boiling in boiling water for 5min, and then carrying out Westernblot identification on the treated solution, wherein the identification result is shown in FIG. 6, and it can be known from FIG. 6 that the protein expressed in the step S71) is S1 protein.

Finally, the above embodiments are only used for illustrating the technical solutions of the present invention and not for limiting, and other modifications or equivalent substitutions made by the technical solutions of the present invention by those of ordinary skill in the art should be covered within the scope of the claims of the present invention as long as they do not depart from the spirit and scope of the technical solutions of the present invention.

SEQUENCE LISTING

<110> Henan animal husbandry economic school

<120> recombinant adenovirus expressing porcine coronavirus S1 gene and preparation method thereof

<130> /

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 1947

<212> DNA

<213> Artificial Sequence

<220>

<223> /

<400> 1

atgcagagag ctctattgat tatgacctta ctttgtctcg ttcgagcaaa gtttgctgat 60

gatctactcg atttgctcac cttcccgggt gcacatcgct tcttacataa acccacgagg 120

aattccagca gtctctactc gcgggctaat aataattttg atgttggcgt tcttcctggc 180

taccccacta agaacgttaa cctcttctca ccacttacta actccacttt gcccattaat 240

ggccttcatc ggagttacca accactcatg ctgaattgtc ttactaaaat aactaaccac 300

actctcagca tgtatctcct acctagtgag atacaaactt atagctgcgg cggtgccatg 360

gttaaatacc agacacatga tgcagttcgt atcattttag accttactgc cactgaccac 420

atctctgttg aagtcgttgg ccaacatggt gaaaattatg tgtttgtttg cagtgagcag 480

tttaactaca ccactgcatt acacaactct accttcttct cacttaattc tgagctttat 540

tgctttacta ataataccta cttaggtatt cttccacctg atttaactga ctttacggtt 600

taccgtactg gtcagttcta tgctaatggt taccttttag gtactttacc tattacggtt 660

aactatgtta ggttgtatcg gggtcatttg tctgccaata gagcccactt tgcccttgca 720

aacctaaccg atacactcat aacacttacc aatactacta tatcgcaaat cacttattgt 780

gataagtcag tagttgattc aatagcatgc cagcgctctt ctcacgaagt ggaggatggg 840

ttttactccg accctaaatc tgccgttaga gctaggcaac gtactattgt tacactacct 900

aagctccctg agcttgaagt agtgcagtta aatatttctg cacacatgga ttttggcgaa 960

gccagacttg acagcgttac catcaatggt aacacatcct attgtgtcac taagccttac 1020

ttcaggcttg aaactaactt tatgtgtaca ggttgcacta tgaatctgcg cactgatacc 1080

tgtagttttg acctgtcagc agtaaacaat ggcatgtcat tctctcaatt ctgtctaagc 1140

actgaatctg gtgcttgtga gatgaaaatt attgttacct acgtatggaa ttacttgcta 1200

aggcagcgtt tgtatgttac tgctgtagag ggccagactc acactggaac cacttcagta 1260

catgcaacag atacttctag tgtaatcact gatgtctgca ctgactacac tatctatgga 1320

gtctctggta ctggcattat taagccatca gatctcttat tgcacaatgg catagcattc 1380

acctctccaa caggtgagct ttatgcattt aaaaatataa ccactggcaa aacccttcag 1440

gtcttaccgt gtgaaacccc ttctcaactg attgtgataa acaacaccgt tgtcggtgct 1500

atcacatcca gtaattcaac tgaaaataat aggtttacta ctactattgt cacacctact 1560

ttcttttatt ccacaaatgc caccactttc aactgcacta agcctgtttt gtcctatgga 1620

cctatcagcg tgtgtagtga tggtgcaatt gtgggaacat ccacattaca gaatactcga 1680

ccatccatag tttcactata cgatggcgaa gttgaaatac catctgcatt ttctctttcc 1740

gttcagacgg agtacttgca agttcaagca gagcaagtta tagttgattg tcctcagtat 1800

gtatgcaatg gcaacagccg ttgtctacaa ttactggcac aatacacctc agcttgctct 1860

aacattgaag cagctctgca ttcctctgca cagttggata gcagagagat tataaatatg 1920

tttcaaacat caacacagtc cttgcag 1947

<210> 2

<211> 649

<212> PRT

<213> Artificial Sequence

<220>

<223> /

<400> 2

Met Gln Arg Ala Leu Leu Ile Met Thr Leu Leu Cys Leu Val Arg Ala

1 5 10 15

Lys Phe Ala Asp Asp Leu Leu Asp Leu Leu Thr Phe Pro Gly Ala His

20 25 30

Arg Phe Leu His Lys Pro Thr Arg Asn Ser Ser Ser Leu Tyr Ser Arg

35 40 45

Ala Asn Asn Asn Phe Asp Val Gly Val Leu Pro Gly Tyr Pro Thr Lys

50 55 60

Asn Val Asn Leu Phe Ser Pro Leu Thr Asn Ser Thr Leu Pro Ile Asn

65 70 75 80

Gly Leu His Arg Ser Tyr Gln Pro Leu Met Leu Asn Cys Leu Thr Lys

85 90 95

Ile Thr Asn His Thr Leu Ser Met Tyr Leu Leu Pro Ser Glu Ile Gln

100 105 110

Thr Tyr Ser Cys Gly Gly Ala Met Val Lys Tyr Gln Thr His Asp Ala

115 120 125

Val Arg Ile Ile Leu Asp Leu Thr Ala Thr Asp His Ile Ser Val Glu

130 135 140

Val Val Gly Gln His Gly Glu Asn Tyr Val Phe Val Cys Ser Glu Gln

145 150 155 160

Phe Asn Tyr Thr Thr Ala Leu His Asn Ser Thr Phe Phe Ser Leu Asn

165 170 175

Ser Glu Leu Tyr Cys Phe Thr Asn Asn Thr Tyr Leu Gly Ile Leu Pro

180 185 190

Pro Asp Leu Thr Asp Phe Thr Val Tyr Arg Thr Gly Gln Phe Tyr Ala

195 200 205

Asn Gly Tyr Leu Leu Gly Thr Leu Pro Ile Thr Val Asn Tyr Val Arg

210 215 220

Leu Tyr Arg Gly His Leu Ser Ala Asn Arg Ala His Phe Ala Leu Ala

225 230 235 240

Asn Leu Thr Asp Thr Leu Ile Thr Leu Thr Asn Thr Thr Ile Ser Gln

245 250 255

Ile Thr Tyr Cys Asp Lys Ser Val Val Asp Ser Ile Ala Cys Gln Arg

260 265 270

Ser Ser His Glu Val Glu Asp Gly Phe Tyr Ser Asp Pro Lys Ser Ala

275 280 285

Val Arg Ala Arg Gln Arg Thr Ile Val Thr Leu Pro Lys Leu Pro Glu

290 295 300

Leu Glu Val Val Gln Leu Asn Ile Ser Ala His Met Asp Phe Gly Glu

305 310 315 320

Ala Arg Leu Asp Ser Val Thr Ile Asn Gly Asn Thr Ser Tyr Cys Val

325 330 335

Thr Lys Pro Tyr Phe Arg Leu Glu Thr Asn Phe Met Cys Thr Gly Cys

340 345 350

Thr Met Asn Leu Arg Thr Asp Thr Cys Ser Phe Asp Leu Ser Ala Val

355 360 365

Asn Asn Gly Met Ser Phe Ser Gln Phe Cys Leu Ser Thr Glu Ser Gly

370 375 380

Ala Cys Glu Met Lys Ile Ile Val Thr Tyr Val Trp Asn Tyr Leu Leu

385 390 395 400

Arg Gln Arg Leu Tyr Val Thr Ala Val Glu Gly Gln Thr His Thr Gly

405 410 415

Thr Thr Ser Val His Ala Thr Asp Thr Ser Ser Val Ile Thr Asp Val

420 425 430

Cys Thr Asp Tyr Thr Ile Tyr Gly Val Ser Gly Thr Gly Ile Ile Lys

435 440 445

Pro Ser Asp Leu Leu Leu His Asn Gly Ile Ala Phe Thr Ser Pro Thr

450 455 460

Gly Glu Leu Tyr Ala Phe Lys Asn Ile Thr Thr Gly Lys Thr Leu Gln

465 470 475 480

Val Leu Pro Cys Glu Thr Pro Ser Gln Leu Ile Val Ile Asn Asn Thr

485 490 495

Val Val Gly Ala Ile Thr Ser Ser Asn Ser Thr Glu Asn Asn Arg Phe

500 505 510

Thr Thr Thr Ile Val Thr Pro Thr Phe Phe Tyr Ser Thr Asn Ala Thr

515 520 525

Thr Phe Asn Cys Thr Lys Pro Val Leu Ser Tyr Gly Pro Ile Ser Val

530 535 540

Cys Ser Asp Gly Ala Ile Val Gly Thr Ser Thr Leu Gln Asn Thr Arg

545 550 555 560

Pro Ser Ile Val Ser Leu Tyr Asp Gly Glu Val Glu Ile Pro Ser Ala

565 570 575

Phe Ser Leu Ser Val Gln Thr Glu Tyr Leu Gln Val Gln Ala Glu Gln

580 585 590

Val Ile Val Asp Cys Pro Gln Tyr Val Cys Asn Gly Asn Ser Arg Cys

595 600 605

Leu Gln Leu Leu Ala Gln Tyr Thr Ser Ala Cys Ser Asn Ile Glu Ala

610 615 620

Ala Leu His Ser Ser Ala Gln Leu Asp Ser Arg Glu Ile Ile Asn Met

625 630 635 640

Phe Gln Thr Ser Thr Gln Ser Leu Gln

645

<210> 3

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> /

<400> 3

atgcagagag ctctattc 18

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> /

<400> 4

gaacaaacta ggtcagcgat 20

<210> 5

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223> /

<400> 5

ctagctagcg ccaccatgga gagagctc 28

<210> 6

<211> 51

<212> DNA

<213> Artificial Sequence

<220>

<223> /

<400> 6

gcgggatccc taacgtagtc tgggacgtaa gtaggtgtga caatagtagt a 51

Claims

1. The recombinant adenovirus expressing the porcine coronavirus S1 gene is characterized in that: the recombinant adenovirus contains a porcine coronavirus S1 gene, and can stably express a porcine coronavirus S1 protein after the recombinant adenovirus infects AD293 cells.

2. The recombinant adenovirus expressing the porcine coronavirus S1 gene, according to claim 1, wherein the sequence of the porcine coronavirus S1 gene is shown as S1EQ ID NO.1, and the sequence of the porcine coronavirus S1 protein is shown as S1EQ ID NO. 2.

The method for preparing the recombinant adenovirus expressing the porcine coronavirus S1 gene according to claim 1 or 2, comprising the steps of:

s1, obtaining total RNA of the porcine coronavirus;

s2, carrying out reverse transcription on the S1 gene and identifying;

s3, obtaining a cDNA template of the S1 gene;

s4, designing a primer, amplifying the S1 gene, purifying and recovering;

s4, constructing a pDC315/S1 recombinant plasmid;

s5, amplifying pDC315/S1 recombinant plasmid obtained from S4;

3. The method for preparing the recombinant adenovirus expressing the S1 gene of porcine coronavirus according to claim 3, wherein the step of identifying the RNA containing the transcribed S1 gene in step S11 comprises:

2) reverse transcription and amplification of total RNA;

3) running glue and observing a target strip.

4. The method for preparing the recombinant adenovirus expressing the pig coronavirus S1 gene, according to claim 3, wherein the primer comprises an upstream primer and a downstream primer, the upstream primer is PDCoV-S1-F (see SEQ ID NO. 5), and the downstream primer is PDCoV-S1-R (see SEQ ID NO. 6).

5. The method for preparing the recombinant adenovirus expressing the porcine coronavirus S1 gene according to claim 3, further comprising:

s7, infecting AD293 cells with the recombinant adenovirus obtained in the step S16, and identifying the expression condition of the S1 protein.