CN107236747A

CN107236747A - Foot and mouth disease virus recombinant virus like-particles and its preparation method and application

Info

Publication number: CN107236747A
Application number: CN201710646938.4A
Authority: CN
Inventors: 张晓战; 张国栋; 王楠; 王飞; 巴利民; 李玲; 肖进; 齐鹏
Original assignee: China Animal Husbandry Industry Co Ltd
Current assignee: China Animal Husbandry Industry Co Ltd
Priority date: 2017-08-01
Filing date: 2017-08-01
Publication date: 2017-10-10
Anticipated expiration: 2037-08-01
Also published as: CN107236747B

Abstract

The invention discloses foot and mouth disease virus recombinant virus like-particles and its preparation method and application.The recombined foot-and-mouth disease virus like-particles are to assemble expression jointly by the component in DNA molecular composition.The DNA molecular composition, including O-shaped aftosa VP0 genes, O-shaped aftosa VP1 genes and O-shaped aftosa VP3 genes.Further also include green fluorescence protein gene.The present invention is self-assembled into FMDV VLPs characteristic with VP0, VP3 and VP1, improve baculoviral construction of recombinant vector method, and Green Fluorescent Protein is added in the carrier, FMDV VLPs are successfully prepared by pFBDM Bac to Bac systems, are further to develop safe and effective O-shaped FMDV recombinant vaccines to have established theoretical foundation.

Description

Foot and mouth disease virus recombinant virus like-particles and its preparation method and application

Technical field

The present invention relates to foot and mouth disease virus recombinant virus like-particles and its preparation method and application, belong to recombinant vaccine Field.

Background technology

Aftosa (Foot-and-mouth Disease, FMD) is by the aftosa of microRNA Viraceae Hostis With positions such as hoof, mouth, noses blister occurs for artiodactyl caused by viral (Foot-and-mouth Disease Virus, FMDV) For a kind of acute, deadly infectious disease of principal character.To ox, pig, sheep etc., mainly poultry kind harm is particularly acute the disease, can not only Cause the death of infection animal, substantially reduce the production performance of infection drove；Can also be to occurring the national international animal of epidemic situation And its product trade produces certain negative effect, causes huge economic loss.International Animal Health tissue (OIE) is by FMD The legal animal epidemic first place reported is classified as, China is also listed in a class zoonosis.China is FMD epidemic-stricken areas, and the disease is One of animal epidemic as harm China aquaculture most serious.

FMDV is containing seven kinds of serotypes, respectively A, O, C, Asia 1, SAT1, SAT2 and SAT3.Each serotype FMDV biological characteristicses and pathogeneticing characteristic are similar, but various without cross-immune reaction.FMDV belongs to sub-thread minus-stranded rna virus, Full-length genome about 8.5kb, containing an ORF encoder block, encodes a polyprotein.P1 plot structures albumen is in itself viral egg VP0, VP3 and VP1 are cracked into the presence of white enzyme 3C, three kinds of albumen single phases mutually combine to form 5S monomers, and assemble automatically 14S pentamers, further assembling forms viral capsid to 12 pentamers.Geneome RNA promotes VP0 to urge certainly with viral capsid effect Change is cracked into VP4 and VP2 albumen, forms the virion of complete mature.

Vaccine immunity is FMD important means, wherein, traditional vaccine inactivated vaccine plays weight in the epidemic prevention of FMD at this stage The effect wanted.With continuing to develop for the field such as vaccinology and virus structure biology, new generation vaccine developmental research is domestic and international The hot fields unanimously paid close attention to.Virus-like particle (Virus Like Particles, VLPs) vaccine is by one or more diseases It is similar to real virion in the hollow capsid structure that malicious structural proteins are assembled into, form.VLPs does not contain viral genome, It can not be replicated in host, without infectivity.The characteristic of the similar natural viral particle structures of VLPs, remains it The specific antigen epitope of most of virus, also can simulated virus to host infection process, it is effective that to stimulate body to produce high The immune response of level, is potential safe candidate vaccine.At present, a variety of commercialization VLPs vaccines are applied to market, such as PCV- 2, EV-71 etc..

The content of the invention

It is an object of the present invention to provide the construction method of a kind of foot and mouth disease virus like-particles and its in vaccine is prepared Using.

Based on foregoing invention purpose, the invention provides a kind of DNA for Prepare restructuring foot and mouth disease virus like-particles points Subgroup compound, including O-shaped aftosa VP0 genes, O-shaped aftosa VP1 genes and O-shaped aftosa VP3 genes；Wherein, O-shaped mouth hoof The nucleotide sequence of epidemic disease VP0 genes is as shown in sequence 1 in sequence table；The nucleotide sequence such as sequence table of O-shaped aftosa VP1 genes Shown in middle sequence 2；The nucleotide sequence of O-shaped aftosa VP3 genes is as shown in sequence 3 in sequence table.

Further, the described DNA molecular composition for Prepare restructuring foot and mouth disease virus like-particles, by described O-shaped Aftosa VP0 genes, the O-shaped aftosa VP1 genes and the O-shaped aftosa VP3 genes and green fluorescent protein EGFP bases Because of composition, wherein, the nucleotide sequence of green fluorescent protein EGFP gene is as shown in sequence 4 in sequence table.

Above-mentioned expression cassette, recombinant vector, transgenic cell line, recombinant bacterium or restructuring containing the DNA molecular composition Virus falls within protection scope of the present invention.

The recombinant vector is built as steps described below：

1) O-shaped aftosa VP0 genes are inserted between EcoR I and Xba the I enzyme recognition sites of pFBDM carriers, obtained The recombinant vector of O-shaped aftosa VP0 genes is inserted, pFBDM-VP0 is named as；O-shaped aftosa VP1 genes are inserted into Between pFBDM-VP0 Sma I and Kpn I enzyme recognition sites, obtain inserting O-shaped aftosa VP0 genes and O-shaped aftosa The recombinant vector of VP1 genes, is named as pFBDM-VP0/VP1；

2) green fluorescent protein EGFP gene is inserted between EcoR I and Xba the I enzyme recognition sites of pFBDM carriers, Obtain inserting the recombinant vector of green fluorescent protein EGFP gene, be named as pFBDM-EGFP；By O-shaped aftosa VP3 genes Be inserted between pFBDM-EGFP Sma I and Kpn I enzyme recognition sites, obtain inserting green fluorescent protein EGFP gene and The recombinant vector of O-shaped aftosa VP3 genes, is named as pFBDM-EGFP/VP1；

3) large fragment for obtaining pFBDM-VP0/VP1 plasmids through Spe I/Nru I digestions, with passing through Avr II/Pme I The small fragment connection that the pFBDM-EGFP/VP3 plasmids of digestion are produced, obtains inserting O-shaped aftosa VP0, VP1 gene, VP3 genes With the recombinant plasmid of EGFP gene, pFBDM-VP0/VP1/VP3/EGFP is named as, i.e., above-mentioned contains DNA molecular combination The recombinant vector of thing.

In the building process of above-mentioned recombinant vector, according to O/Mya98P1 sections of sequences and green fluorescent protein EGFP gene sequence Row, the primer designed for expanding FMDV structural protein genes VP0, VP1, VP3 and EGFP, the primer of design is also in present invention guarantor In the range of shield.

The O-shaped aftosa VP0 genes are using O-shaped aftosa O/Mya98 pnca gene group cDNA as template, with primer VP0F Expand and obtain with VP0R；O-shaped aftosa VP1 genes are using O-shaped aftosa O/Mya98 pnca gene group cDNA as template, with primer VP1F and VP1R amplifications are obtained；O-shaped aftosa VP3 genes be using O-shaped aftosa O/Mya98 pnca gene group cDNA as template, with Primer VP3F and VP3R amplification are obtained；Green fluorescent protein EGFP gene be using pEGFP-N1 as template, with primer EGFP F and EGFP R amplifications are obtained；Primer sequence is as follows：

VP0F：CGGAATTCATGGGAGCCGGACAATCCAGTCC

VP0R：CGACAAGCTTACTCTTTGGAAGGGAACTCACC

VP1F：TCCCCCGGGATGACCACTTCGACAGGCGAGTC

VP1R：GGGGTACCTTACAAGGACTGCTTTACAGGTG

VP3F：TCCCCCGGGATGGGGATTTTCCCTGTGGCCTG

VP3R：GGGGTACCTTACTGTTGCCGTGCGTCCACAG

EGFP F：CGGAATTCATGGTGAGCAAGGGCGAGGAG

EGFP R：CGACAAGCTTTTACTTGTACAGCTCGTCCATG

A further object of the present invention is to provide a kind of method of Prepare restructuring foot and mouth disease virus like-particles, including following step Suddenly：

1) described DNA molecular composition is converted into DH10Bac competent cells by recombinant vector, reflected by screening It is fixed, obtain recombinant baculovirus expression plasmid；

2) step 1) the recombinant baculovirus expression plasmid transfection sf9 cells that obtain, through subculture 3 times, cell culture Freeze thawing treatment 3 times, centrifugation after filtration sterilization, obtains recombinant baculovirus.

The recombinant vector is preferably above-mentioned recombinant vector.

The recombinant virus sample particle that above-mentioned method is prepared.

Another object of the present invention is a kind of recombined foot-and-mouth disease virus like-particles of protection, the recombined foot-and-mouth disease virus sample grain Son is to assemble expression jointly by the component in described DNA molecular composition.

Further, the recombined foot-and-mouth disease virus like-particles are that the restructuring prepared according to above-mentioned method is shaft-like Virus-like particle.

A kind of vaccine for preventing and/or treating infection of foot-and-mouth disease is also claimed in the present invention, and its active component is described Recombined foot-and-mouth disease virus like-particles.

Application of the described recombined foot-and-mouth disease virus like-particles in the vaccine for preparing prevention and/or treatment infection of foot-and-mouth disease Fall within protection scope of the present invention.

In terms of FMDV VLPs researchs, researcher attempts to pass through poxvirus vector, adenovirus vector, baculoviral The system such as carrier and escherichia coli vector sets up FMDV VLPs model.Wherein, rhabdovirus system opening in FMDV VLPs There is the unrivaled advantage of other carrier systems in hair and application.

Based on above-mentioned technical scheme, foot and mouth disease virus recombinant virus like-particles of the invention utilize FMDV structural proteins VP0, VP3 and VP1 are self-assembled into foot and mouth disease virus recombinant virus like-particles (FMDV VLPs) characteristic, improve FMDV VLPs bars The construction method of shape virus recombinant vector, and Green Fluorescent Protein is added in the carrier, pass through pFBDM Bac-to- Bac systems successfully prepare FMDV VLPs, and there is provided a kind of excellent recombinant vaccine.

The cytotoxicity and VLPs packaging efficiencies that another progress of the present invention is to solve the problems, such as 3C albumen asking lowly Topic.Because the cytotoxicity and P1 albumen of HRV 3CP can not be cut completely, these recombinant protein groups in insect cell expression Fill efficiency and yield is generally relatively low.Structure can express the recombinant baculovirus of tri- kinds of capsid proteins of VP0, VP1 and VP3 simultaneously, The cytotoxicity problem and P1 genes of HRV 3CP during rhabdovirus system expression FMDV VLPs are studied before effectively avoiding Cutting not exclusively causes the problem of VLPs packaging efficiencies are low.

The problem of in terms of the observability of the present invention also solution cytopathy is not strong.The infection titer of baculoviral, infection The determination of the parameters such as plural number, infection time is the principal element for restricting rhabdovirus system large-scale production.Wherein, baculoviral Titre determination be its expand application basis.Laboratory generally passes through plaque assay and TCID₅₀Experiment determines the drop of virus Degree, cytopathy observability has certain requirement to operating personnel during due to baculovirus infection, can not with larger Control property.The present invention adds green fluorescence label E GFP albumen when building restructuring FMDV capsid protein baculovirals, can pass through Whether cell can express EGFP to determine whether there is the infection of virus under fluorescence microscope, can be good at solving cell The problem of in terms of the observability of lesion is not strong.In addition, EGFP albumen is not involved in tri- kinds of capsid proteins of FMDVVP0, VP1 and VP3 Self assembly VLPs bioprocess, can be removed in follow-up VLPs purge processes by the way that corresponding strategy is effective, should to follow-up With without influence.

Experiment is proved, can express FMDV's in virus-like particle rBAC-fluoFMDV infection sf9 cell processes of the present invention Transmission electron microscope is carried out after capsid protein VP0, VP1 and VP3, the virus-like particle rBAC-fluoFMDV sample negative staining of preliminary purification Observation, it is seen that its diameter is 25~30nm virus-like particles, and centre is shinny, shows that rBAC-fluoFMDV infects sf9 VP0, VP1 and VP3 capsid protein expressed in cell processes can be assembled into VLPs.With TCID₅₀Method detects rBAC- FluoFMDV P3 are 10 for virus titer^-7.5/0.1mL。

Brief description of the drawings

Fig. 1：O-shaped FMDV VP0, VP1, VP3 and EGFP gene clone；1:DL 5000DNA maker；2:EGFP bases Cause；3：VP0 genes；4：VP1 genes；5：VP3 genes.

Fig. 2A：VP0, VP 1, the fragments of VP 3 clone's schematic flow sheet.

Fig. 2 B：Clone's schematic flow sheet of EGFP fragments.

Fig. 3：Construction of recombinant plasmid schematic diagram.

Fig. 4：RBAC-fluoFMDV P3 infect the observation of sf9 cell green fluorescences.

Fig. 5：The Western blot detections of the expression of rBAC-fluoFMDV infection sf9 cell recombinant proteins；

1:Sf9 cell normal groups；2:The sf9 cell cultures of rBAC-fluoFMDV P2 generation infection；3：rBAC- The sf9 cell cultures of fluoFMDV P3 generation infection；4：Albumen Maker.

Fig. 6：Sf9 cell infections express rBAC-fluoFMDV VLPs electron microscopic pictures.

Embodiment

Illustrate the present invention referring to specific embodiment.It will be appreciated by those skilled in the art that these embodiments are only For illustrating the present invention, it does not limit the scope of the present invention in any way.

Experimental method in following embodiments, is conventional method unless otherwise specified.Medicine used in following embodiments Material raw material, reagent material etc., unless otherwise specified, are commercially available products.

The recombinant vector pFBDM-VP0/VP1/VP3/EGFP of embodiment 1 structure

By template of O/Mya98/XJ/2010 pnca gene group cDNA, (O/Mya98/XJ/2010 pnca gene groups cDNA can be by city RNA is extracted in the O-shaped inactivated vaccine of aftosa containing O/Mya98/XJ/2010 plants sold to obtain through reverse transcription), separately design phase The primer (being shown in Table 1) answered.O-shaped aftosa VP0 genes are obtained with primer VP0F and VP0R amplification, table is sequenced in piece segment length 909bp Bright, its nucleotides sequence is classified as in sequence table shown in sequence 1.O-shaped aftosa VP1 genes are obtained with primer VP1F and VP1R amplification, Piece segment length 639bp, sequencing shows that its nucleotides sequence is classified as in sequence table shown in sequence 2.Obtained with primer VP3F and VP3R amplification O-shaped aftosa VP3 genes are obtained, piece segment length 660bp, sequencing shows that its nucleotides sequence is classified as in sequence table shown in sequence 3.On The schematic diagram of amplification is stated see Fig. 2A, the electrophoretogram of amplified production is see Fig. 1.

This laboratory of pEGFP-N1 plasmids is preserved, using pEGFP-N1 as template, and according to EGFP gene sequence, design is corresponding Primer (is shown in Table 1), obtains green fluorescent protein EGFP gene with primer EGFP F and EGFP R amplifications, fragment length is 720bp, Sequencing shows that its nucleotides sequence is classified as in sequence table shown in sequence 4.The schematic diagram of above-mentioned amplification see Fig. 2 B, amplified production Electrophoretogram is see Fig. 1.

The amplimer of each fragment of table 1.

Obtained O-shaped aftosa VP0 genes and green fluorescent protein EGFP gene fragment will be expanded respectively through EcoR I/ The fragment obtained after Xba I digestions, (general such as spit of fland is biological with the pFBDM carriers by identical digestion with restriction enzyme Technology (Beijing) Co., Ltd) connection, by connection product Transformed E .coli DH10B competent cells, coating contains ammonia benzyl mould The LB flat boards of element, 37 DEG C of incubated overnights.Single bacterium colony on picking flat board, is trained in the LB liquid medium containing ampicillin 6h is supported, the cloning primer for being utilized respectively VP0 and EGFP in table 1 carries out bacterium solution PCR identifications, and positive bacterium colony send raw work to be sequenced.It will survey The correct bacterium solution of sequence is with 1:500 are added in the fresh LB culture mediums containing ammonia benzyl antibiotic, overnight incubation, extract plasmid, Obtain inserting the restructuring of the recombinant plasmid positive colony and insertion green fluorescent protein EGFP gene of O-shaped aftosa VP0 genes Plasmid positive is cloned, and sequencing is shown into the recombinant plasmid for inserting O-shaped aftosa VP0 genes is named as pFBDM-VP0, will be sequenced Show that the recombinant plasmid for inserting green fluorescent protein EGFP gene is named as pFBDM-EGFP.Save backup.Above-mentioned recombinant plasmid Build schematic diagram and see Fig. 3.

To further the piece obtained after obtained VP1 genes and VP3 genetic fragments are digested through Sma I/Kpn I be expanded Section, is connected with by pFBDM-VP0 the and pFBDM-EGFP recombinant vectors of identical digestion with restriction enzyme, will connect respectively Product Transformed E .coli DH10B competent cells, are coated with the LB flat boards containing ampicillin, 37 DEG C of incubated overnights.Picking is put down Single bacterium colony on plate, cultivates 6h in the LB liquid medium containing ampicillin, is utilized respectively gram of VP1 and VP3 in table 1 Grand primer carries out bacterium solution PCR identifications, and positive bacterium colony send raw work to be sequenced.Correct bacterium solution will be sequenced with 1:500 be added to it is fresh In LB culture mediums containing ammonia benzyl antibiotic, overnight incubation extracts plasmid, that is, respectively obtains the O-shaped aftosa VP0 and VP1 of insertion The recombinant plasmid positive colony of gene and the recombinant plasmid positive colony of insertion VP3 genes and EGFP gene.Sequencing is shown to insert The recombinant plasmid for entering O-shaped aftosa VP0 and VP1 genes is named as pFBDM-VP0/VP1；By sequencing show insertion VP3 genes and The recombinant plasmid of EGFP gene is named as pFBDM-EGFP/VP3.Recombinant plasmid is saved backup, above-mentioned construction of recombinant plasmid shows Intention is shown in Fig. 3.

The large fragment obtained after the pFBDM-VP0/VP1 plasmids of extraction are digested through Spe I/Nru I, with process The small fragment connection that the pFBDM-EGFP/VP3 plasmids of Avr II/Pme I digestions are produced, by connection product Transformed E .coli DH10B competent cells, are coated with the LB flat boards containing ampicillin, 37 DEG C of incubated overnights.Single bacterium colony on picking flat board, 6h is cultivated in LB liquid medium containing ampicillin, the cloning primer for being utilized respectively VP1 and VP2 in table 1 carries out bacterium solution PCR identifies that positive bacterium colony send raw work to be sequenced.Correct bacterium solution will be sequenced with 1:500 are added to and fresh contain ammonia benzyl antibiotic LB culture mediums in, overnight incubation, extract plasmid, that is, obtain inserting O-shaped aftosa VP0, VP1 gene, VP3 genes and EGFP bases The recombinant plasmid positive colony of cause, O-shaped aftosa VP0, VP1 gene, VP3 genes and EGFP gene are properly inserted by the sequencing Recombinant plasmid be named as pFBDM-VP0/VP1/VP3/EGFP.Recombinant plasmid is saved backup, it builds schematic diagram and sees Fig. 3.

The recombinant baculovirus rBAC-fluoFMDV of embodiment 2 preparation

By pFBDM-VP0/VP1/VP3/EGFP recombinant plasmid transformed DH10Bac competent cells, containing tetracycline With cultivate 4h in the LB liquid medium of kanamycins, be coated with the LB flat boards containing gentamicin, tetracycline and kanamycins, Screened by the blue hickie of two-wheeled, picking white colony, with M13F/VP1F and VP0F/M13R primer pairs, (M13F/R primers are bases The sequent synthesis that Invitrogen companies Bac-to-Bac specifications are provided), bacterium solution PCR Testing and appraisals are carried out, are expanding culture just True bacterial strain, extracts recombinant baculovirus expression plasmid, is named as Bacmid-VP0/VP1/VP3/EGFP, saved backup.

The sf9 cells of exponential phase are laid on six orifice plates, recombinant baculovirus expression plasmid Bacmid-VP0/VP1/ VP3/EGFP DNA are diluted according to transfection reagent Lipofectamine3000 transfection method requirement, mixed with transfection reagent Close, transfect sf9 cells.96h is cultivated in 27 DEG C of constant incubators, cells and supernatant is collected, 5min is centrifuged through 8000rpm, is received Collect supernatant, after filtration sterilization, obtain recombinant baculovirus P0 generation viruses, save backup, the recombinant baculovirus is named as rBAC-fluoFMDV。

The recombinant baculovirus rBAC-fluoFMDV of embodiment 3 amplification and poison valency measures

RBAC-fluoFMDV P0 generations virus is in logarithmic growth according to virus with the inoculation of culture medium 1/10 (v/v) ratio 96h is cultivated in the sf9 cells of phase, 27 DEG C of constant incubators, cells and supernatant is collected, centrifuged through 8000rpm in 5min, collection Clearly, P1 generation viruses are obtained.Expanded with P1 generation virus progress and obtain P2 generations, expand obtaining P3 generations with P2 viruses.With TCID₅₀Side Method detects that rBAC-fluoFMDV P3 are 10 for virus titer^-7.5/0.1mL。

Expression and identification of the recombinant protein of embodiment 4 in insect cell sf 9

The sf9 cells of exponential phase are laid on six orifice plates, inoculation generation and P3 are for rBAC-fluoFMDV viruses, after infection 60h, situation about being expressed using fluorescence microscope green fluorescent protein EGFP.As a result as shown in figure 4, recombinant baculovirus energy Enough great expression green fluorescent proteins, and the sf9 cell controls group redgreen fluorescence of recombinant virus is uninfected by, illustrate green fluorescence Albumen obtains successful expression.

For the expression of further identification each structural proteins of FMDV, in P2 generations and P3, are subjected to Western for cell sample Blot is analyzed, using O-shaped FMDV pigs polyvalent antibody as primary antibody, and HRP mark goat-anti pig IgGs are that work Products are given birth in Shanghai.Use ECL Colour reagent box develops the color, and is exposed and developed the color using chemiluminescence.As a result as shown in figure 5, occurring with pig resisting O-type FMDV hyper-immune serums special The band of opposite sex reaction is consistent, shown with FMDV capsid proteins VP0 (about 33kD), VP1 and VP3 (about 24kD) molecular size range FMDV capsid protein VP0, VP1 and VP3 can be expressed in rBAC-fluoFMDV infection sf9 cell processes.

A large amount of preparations of the virus-like particle of embodiment 5

The sf9 cells of proper density are inoculated in shaking flask, shaken cultivation in 27 DEG C of 110rpm constant incubators treats that its is close Degree reaches 2 × 10⁶Cells/mL, using MOI be 5 inoculation P3 for recombinant baculovirus rBAC-fluoFMDV, 27 DEG C of 110rpm constant temperature Shaken cultivation 72h in incubator, is collected by centrifugation cell precipitation, cell is resuspended with the pH 8.0 of 1/20 volume PBS, with -80 DEG C With room temperature multigelation 3 times, 12000g centrifugation 10min collect supernatant, as original viral sample particle solution.

The preliminary purification of the virus-like particle of embodiment 6

By the virus-like particle solution obtained in embodiment 5 with 0.22 μm of membrane filtration, supernatant solution is taken to do 30% sugarcane Sugared bed course processing, 35000g is centrifuged 3.5 hours, is resuspended, saved backup with the PBS of 1/10 volume.

The identification of the virus-like particle of embodiment 7

Carry out transmission electron microscope observing after the virus-like particle sample negative staining of the preliminary purification of embodiment 6, as a result as shown in fig. 6, It can be seen that its diameter is 25~30nm virus-like particles, and it is middle shinny, show that rBAC-fluoFMDV infects sf9 cells During VP0, VP1 and VP3 capsid protein for expressing can be assembled into VLPs.

Specific description of embodiments of the present invention above is not intended to limit the present invention, and those skilled in the art can be according to this Invention is variously modified or deformed, and without departing from the spirit of the present invention, all should belong to the model of appended claims of the present invention Enclose.

Sequence table

<110>Zhongmu Industry Co., Ltd

<120>Foot and mouth disease virus recombinant virus like-particles and its preparation method and application

<130> WHOI170046

<160> 4

<210> 1

<211> 909

<212> DNA

<213>

<400> 1

ggagccggac aatccagtcc ggctactggg tcacagaacc aatcaggcaa caccgggagt 60

atcatcaaca attactacat gcagcagtac cagaactcca tggacaccca acttggtgac 120

aatgccatca gcggaggctc caacgaggga tccacagaca caacttccac ccacacaacc 180

aacactcaga acaatgactg gttttcaaag ttggccagct ctgccttcag tggtcttttc 240

ggcgccctcc tcgccgataa gaaaaccgag gagaccactc ttctcgagga ccgcatcctc 300

accacccgaa acggacacac cacctcgaca acccagtcga gtgttggcat aacgcacggg 360

tacgcaacag ctgaggattt tgtgagcggg ccaaacacct ctggtcttga gaccagagtt 420

gtccaggcgg aacggttctt taaaacccac ctgttcgact gggtcaccag tgatccgttc 480

ggacggtact acttgttgga gctcccgact gaccacaaag gtgtctacgg cagcctgacc 540

gactcatatg cctacatgag aaacggttgg gatgttgaag tcaccgctgt ggggaatcag 600

ttcaacggag gctgcctact ggtggccatg gtgcctgaac tttgttccat cgagcggaga 660

gagctgttcc agcttacgct cttcccccac cagttcatca acccccggac gaacatgaca 720

gcccacatca aggtgccctt tgttggcgtc aaccgttacg atcagtacaa ggtacacaag 780

ccgtggaccc ttgtggttat ggtcgtagcc ccactgactg tcaacaccga aggcgctccg 840

cagatcaagg tgtatgccaa catcgcaccc accaacgtgc acgtcgcggg tgagttccct 900

tccaaagag 909

<210> 2

<211> 639

<212> DNA

<213>

<400> 2

accacttcga caggcgagtc ggctgacccc gtgactgcca ccgttgagaa ttacggcggc 60

gagacacagg tccagaggcg ccaccacaca gatgtctcat tcatattgga cagatttgtg 120

aaagtcacac caaaagaatc aataaatgta ttggacctga tgcagactcc cccccacacc 180

ctagtagggg cgctcctccg cactgccact tactatttcg ctgatctaga ggtggcagtg 240

aaacacgagg gagaccttac ctgggtgcca aatggagcac ctgaagcagc cttggacaac 300

accaccaacc caacggcgta ccataaggcg ccgcttaccc ggcttgcatt gccatacacg 360

gcaccacacc gtgttttggc caccgtttac aacgggaact gcaaatacgc cgggggctca 420

ctgctcaacg tgagaggcga tctccaagcg ctggctccga aggcagcgag gccgctgcct 480

acttctttca actacggtgc catcaaagcc actcgggtga cagaactgct gtaccgcatg 540

aagagggccg agacgtactg tcctcggccc ctcttggcta ttcacccgag tgcggccaga 600

cacaaacaga aaatagtggc acctgtaaag cagtccttg 639

<210> 3

<211> 660

<212> DNA

<213>

<400> 3

gggattttcc ctgtggcctg tagcgacggt tatggcggct tggtgacaac tgacccaaag 60

acggctgacc ccgtttacgg caaagtgttc aacccccccc gcaacatgtt gccggggcgg 120

ttcaccaacc tcttggacgt ggctgaggct tgccccacgt ttctgcactt cgatggtgac 180

gtaccgtacg tgaccactaa gacggattcg gacagggtgc tcgcacaatt tgacttgtct 240

ttggcagcaa aacacatgtc aaacaccttc cttgcaggtc ttgcccagta ctacacgcag 300

tacagcggca ccgtcaacct gcacttcatg ttcacaggtc ccactgacgc gaaagcgcgt 360

tacatgattg cgtatgcccc tccgggcatg gagccgccca aaacacctga ggctgctgct 420

cactgcattc acgcagagtg ggacacgggt ctgaactcaa agtttacctt ttccatcccc 480

tacctctcgg cggctgatta cgcgtacacc gcgtctgacg ctgctgagac cacaaatgtt 540

cagggatggg tctgcttatt tcaaataaca cacgggaaag ctgagggtga cgctcttgtc 600

gtgctggcca gtgctggcaa agactttgag ctgcgcctgc ctgtggacgc acggcaacag 660

<210> 4

<211> 720

<212> DNA

<213>

<400> 4

atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480

ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540

gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660

ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa 720

Claims

1. a kind of DNA molecular composition for Prepare restructuring foot and mouth disease virus like-particles, including O-shaped aftosa VP0 genes, O Type aftosa VP1 genes and O-shaped aftosa VP3 genes；Wherein, in the nucleotide sequence of O-shaped aftosa VP0 genes such as sequence table Shown in sequence 1；The nucleotide sequence of O-shaped aftosa VP1 genes is as shown in sequence 2 in sequence table；O-shaped aftosa VP3 genes Nucleotide sequence is as shown in sequence 3 in sequence table.

2. the DNA molecular composition according to claim 1 for Prepare restructuring foot and mouth disease virus like-particles, by the O Type aftosa VP0 genes, the O-shaped aftosa VP1 genes and the O-shaped aftosa VP3 genes and green fluorescent protein EGFP Genomic constitution, wherein, the nucleotide sequence of green fluorescent protein EGFP gene is as shown in sequence 4 in sequence table.

3. contain the expression cassette of DNA molecular composition, recombinant vector, transgenic cell line, recombinant bacterium described in claim 1 or 2 Or recombinant virus.

4. recombinant vector according to claim 3, it is characterised in that：The recombinant vector is built as steps described below：

1) O-shaped aftosa VP0 genes are inserted between EcoR I and Xba the I enzyme recognition sites of pFBDM carriers, inserted The recombinant vectors of O-shaped aftosa VP0 genes, is named as pFBDM-VP0；O-shaped aftosa VP1 genes are inserted into pFBDM- Between VP0 Sma I and Kpn I enzyme recognition sites, obtain inserting O-shaped aftosa VP0 genes and O-shaped aftosa VP1 genes Recombinant vector, be named as pFBDM-VP0/VP1；

2) green fluorescent protein EGFP gene is inserted between EcoR I and Xba the I enzyme recognition sites of pFBDM carriers, obtained The recombinant vector of green fluorescent protein EGFP gene is inserted, pFBDM-EGFP is named as；By the insertion of O-shaped aftosa VP3 genes To between pFBDM-EGFP Sma I and Kpn I enzyme recognition sites, obtain inserting green fluorescent protein EGFP gene and O-shaped The recombinant vector of aftosa VP3 genes, is named as pFBDM-EGFP/VP1；

3) large fragment for obtaining pFBDM-VP0/VP1 plasmids through Spe I/Nru I digestions, with passing through Avr II/Pme I digestions The small fragment connection that produces of pFBDM-EGFP/VP3 plasmids, obtain inserting O-shaped aftosa VP0, VP1 gene, VP3 genes and The recombinant plasmid of EGFP gene, is the recombinant vector containing DNA molecular composition described in claim 1 or 2.

5. a kind of method of Prepare restructuring foot and mouth disease virus like-particles, comprises the following steps：

1) the DNA molecular composition described in claim 1 or 2 is converted into DH10Bac competent cells by recombinant vector, passed through Screening and Identification, obtains recombinant baculovirus expression plasmid；

2) step 1) the recombinant baculovirus expression plasmid transfection sf9 cells that obtain, through subculture 3 times, cell culture freeze thawing Processing 3 times, centrifugation after filtration sterilization, obtains recombinant baculovirus sample particle.

6. method according to claim 5, it is characterised in that：The recombinant vector is the restructuring described in claim 3 or 4 Carrier.

7. a kind of recombined foot-and-mouth disease virus like-particles, it is characterised in that：The recombined foot-and-mouth disease virus like-particles are will by right The component in the DNA molecular composition described in 1 or 2 is asked to assemble expression jointly.

8. recombined foot-and-mouth disease virus like-particles according to claim 7, it is characterised in that：The recombined foot-and-mouth disease virus sample Particle is the recombinant baculovirus sample particle prepared according to the method described in claim 5 or 6.

9. a kind of vaccine for preventing and/or treating infection of foot-and-mouth disease, its active component is the restructuring mouthful described in claim 7 or 8 Aphtovirus like-particles.

10. the recombined foot-and-mouth disease virus like-particles described in claim 7 or 8 are preparing prevention and/or are treating infection of foot-and-mouth disease Application in vaccine.