CN107236747B

CN107236747B - Foot-and-mouth disease virus recombinant virus-like particle and preparation method and application thereof

Info

Publication number: CN107236747B
Application number: CN201710646938.4A
Authority: CN
Inventors: 张晓战; 张国栋; 王楠; 王飞; 巴利民; 李玲; 肖进; 齐鹏
Original assignee: China Animal Husbandry Industry Co Ltd
Current assignee: China Animal Husbandry Industry Co Ltd
Priority date: 2017-08-01
Filing date: 2017-08-01
Publication date: 2020-11-20
Anticipated expiration: 2037-08-01
Also published as: CN107236747A

Abstract

The invention discloses a foot-and-mouth disease virus recombinant virus-like particle, a preparation method and application thereof. The recombinant foot-and-mouth disease virus-like particle is jointly assembled and expressed by the components in the DNA molecular composition. The DNA molecular composition comprises an O-type foot-and-mouth disease VP0 gene, an O-type foot-and-mouth disease VP1 gene and an O-type foot-and-mouth disease VP3 gene. Still further, the gene of green fluorescent protein is included. The FMDV VLPs are successfully prepared by a pFBDM Bac-to-Bac system by adding a green fluorescent protein marker into the vector based on the characteristic that VP0, VP3 and VP1 are self-assembled into FMDV VLPs, thereby laying a theoretical foundation for further developing safe and effective O-type FMDV genetic engineering vaccines.

Description

Foot-and-mouth disease virus recombinant virus-like particle and preparation method and application thereof

Technical Field

The invention relates to a foot-and-mouth disease virus recombinant virus-like particle, a preparation method and application thereof, belonging to the field of genetic engineering vaccines.

Background

Foot-and-mouth Disease (FMD) is an acute and virulent infectious Disease mainly characterized by blisters on hooves, mouths, noses and other parts of artiodactyls caused by FMDV (Foot-and-mouth Disease viruses) of the genus Foot-and-mouth Disease Virus of the family picornaviridae. The disease is particularly serious in harm to main livestock species such as cattle, pigs, sheep and the like, can cause death of infected animals, and greatly reduces the production performance of infected livestock; but also has certain negative effects on international animal and product trade in epidemic countries, and causes huge economic loss. The international animal health Organization (OIE) lists FMD as the first animal epidemic disease reported by law, and also lists FMD as an animal infectious disease in China. China is an FMD epidemic area, and the disease becomes one of the most serious animal epidemic diseases harming the breeding industry in China.

FMDV consists of seven serotypes, A, O, C, Asia 1, SAT1, SAT2 and SAT3 respectively. The biological characteristics and the pathogenesis characteristics of each serotype FMDV are similar, but no cross immune reaction exists among the serotypes. FMDV belongs to a single-stranded negative-strand RNA virus, has a genome with a total length of about 8.5kb, contains an ORF coding frame, and encodes a polyprotein. The structural protein of the P1 region is split into VP0, VP3 and VP1 under the action of virus self-protease 3C, the three protein monomers are combined with each other to form 5S monomer, 14S pentamer is automatically assembled, and 12 pentamers are further assembled to form virus capsid. The interaction of the genomic RNA with the viral capsid facilitates autocatalytic cleavage of VP0 into VP4 and VP2 proteins, forming a complete mature virion.

Vaccine immunization is an important means of FMD, wherein traditional vaccine inactivated vaccines play an important role in FMD epidemic prevention at the present stage. With the continuous development of the fields of vaccinology, virus structure biology and the like, the development and research of novel vaccines are the hot field of consistent concern at home and abroad. Virus Like Particle (VLPs) vaccines are empty capsid structures assembled from one or more viral structural proteins and are morphologically similar to authentic virions. VLPs do not contain viral genomes, are incapable of replication in a host, and are not infectious. The VLPs have the characteristic of being similar to the structure of natural virus particles, so that the VLPs retain the specific epitope of most viruses, can simulate the infection process of the viruses to hosts, effectively stimulate organisms to generate high-level immune response, and are potential safe candidate vaccines. Currently, a variety of commercial VLPs vaccines are in use in the marketplace, such as PCV-2, EV-71, and the like.

Disclosure of Invention

The invention aims to provide a method for constructing foot-and-mouth disease virus-like particles and application of the foot-and-mouth disease virus-like particles in preparation of vaccines.

Based on the above object, the present invention provides a DNA molecule composition for preparing recombinant foot-and-mouth disease virus-like particles, comprising a type O foot-and-mouth disease VP0 gene, a type O foot-and-mouth disease VP1 gene and a type O foot-and-mouth disease VP3 gene; wherein, the nucleotide sequence of the O-type foot-and-mouth disease VP0 gene is shown as a sequence 1 in a sequence table; the nucleotide sequence of the O type foot-and-mouth disease VP1 gene is shown as sequence 2 in the sequence table; the nucleotide sequence of the O type foot-and-mouth disease VP3 gene is shown as sequence 3 in the sequence table.

Further, the DNA molecule composition for preparing the recombinant foot-and-mouth disease virus-like particle consists of the O-type foot-and-mouth disease VP0 gene, the O-type foot-and-mouth disease VP1 gene, the O-type foot-and-mouth disease VP3 gene and a green fluorescent protein EGFP gene, wherein the nucleotide sequence of the green fluorescent protein EGFP gene is shown as a sequence 4 in a sequence table.

The expression cassette, the recombinant vector, the transgenic cell line, the recombinant bacterium or the recombinant virus containing the DNA molecule composition also belong to the protection scope of the invention.

The recombinant vector is constructed according to the following steps:

1) inserting the O-type foot-and-mouth disease VP0 gene between EcoR I and Xba I enzyme recognition sites of a pFBDM vector to obtain a recombinant vector inserted with the O-type foot-and-mouth disease VP0 gene, which is named as pFBDM-VP 0; inserting the O-type foot-and-mouth disease VP1 gene between Sma I and Kpn I enzyme recognition sites of pFDDM-VP 0 to obtain a recombinant vector inserted with the O-type foot-and-mouth disease VP0 gene and the O-type foot-and-mouth disease VP1 gene, which is named as pFDDM-VP 0/VP 1;

2) inserting a green fluorescent protein EGFP gene between EcoR I and Xba I enzyme recognition sites of a pFDDM vector to obtain a recombinant vector inserted with the green fluorescent protein EGFP gene, and naming the recombinant vector as pFDDM-EGFP; inserting the O-type foot-and-mouth disease VP3 gene between Sma I and Kpn I enzyme recognition sites of pFDDM-EGFP to obtain a recombinant vector inserted with a green fluorescent protein EGFP gene and an O-type foot-and-mouth disease VP3 gene, and naming the recombinant vector as pFDDM-EGFP/VP 1;

3) the large fragment obtained by cutting the pFBDM-VP0/VP1 plasmid by Spe I/Nru I is connected with the small fragment generated by cutting the pFBDM-EGFP/VP3 plasmid by Avr II/Pme I to obtain the recombinant plasmid inserted with the O-type foot-and-mouth disease VP0, VP1 gene, VP3 gene and EGFP gene, which is named as pFBDM-VP0/VP1/VP3/EGFP, namely the recombinant vector containing the DNA molecular composition.

In the construction process of the recombinant vector, primers for amplifying FMDV structural protein genes VP0, VP1, VP3 and EGFP are designed according to the O/Mya98P1 segment sequence and the green fluorescent protein EGFP gene sequence, and the designed primers are also in the protection scope of the invention.

The O-type foot-and-mouth disease VP0 gene is obtained by taking O-type foot-and-mouth disease O/Mya98 strain genome cDNA as a template and amplifying primers VP0F and VP 0R; the O type foot-and-mouth disease VP1 gene is obtained by taking O type foot-and-mouth disease O/Mya98 strain genome cDNA as a template and amplifying primers VP1F and VP 1R; the O type foot-and-mouth disease VP3 gene is obtained by taking O type foot-and-mouth disease O/Mya98 strain genome cDNA as a template and amplifying primers VP3F and VP 3R; the green fluorescent protein EGFP gene is obtained by taking pEGFP-N1 as a template and amplifying primers EGFP F and EGFP R; the primer sequences are shown below:

VP0F：CGGAATTCATGGGAGCCGGACAATCCAGTCC

VP0R：CGACAAGCTTACTCTTTGGAAGGGAACTCACC

VP1F：TCCCCCGGGATGACCACTTCGACAGGCGAGTC

VP1R：GGGGTACCTTACAAGGACTGCTTTACAGGTG

VP3F：TCCCCCGGGATGGGGATTTTCCCTGTGGCCTG

VP3R：GGGGTACCTTACTGTTGCCGTGCGTCCACAG

EGFP F：CGGAATTCATGGTGAGCAAGGGCGAGGAG

EGFP R：CGACAAGCTTTTACTTGTACAGCTCGTCCATG

still another object of the present invention is to provide a method for preparing recombinant foot-and-mouth disease virus-like particles, comprising the steps of:

1) transforming the DNA molecular composition into DH10Bac competent cells through a recombinant vector, and obtaining a recombinant baculovirus expression plasmid through screening and identification;

2) transfecting sf9 cells with the recombinant baculovirus expression plasmid obtained in the step 1), culturing and passaging for 3 times, performing cell culture freeze-thawing treatment for 3 times, centrifuging, and filtering and sterilizing to obtain the recombinant baculovirus.

The recombinant vector is preferably the recombinant vector described above.

The recombinant virus-like particles prepared by the method are provided.

The invention also aims to protect the recombinant foot-and-mouth disease virus-like particle which is jointly assembled and expressed by the components in the DNA molecular composition.

Further, the recombinant foot-and-mouth disease virus-like particle is a recombinant baculovirus-like particle prepared by the method.

The invention also claims a vaccine for preventing and/or treating foot-and-mouth disease infection, and the active component of the vaccine is the recombinant foot-and-mouth disease virus-like particle.

The application of the recombinant foot-and-mouth disease virus-like particle in the preparation of vaccines for preventing and/or treating foot-and-mouth disease infection also belongs to the protection scope of the invention.

In research on FMDV VLPs, researchers have attempted to model FMDV VLPs using poxvirus, adenovirus, baculovirus, and escherichia coli vectors. Among them, baculovirus systems have incomparable advantages over other vector systems in the development and application of FMDV VLPs.

Based on the technical scheme, the FMDV recombinant virus-like particle improves the construction method of FMDV VLPs baculovirus recombinant vectors by utilizing the characteristic that FMDV structural proteins VP0, VP3 and VP1 are self-assembled into the FMDV recombinant virus-like particle (FMDV VLPs), green fluorescent protein markers are added into the vectors, FMDV VLPs are successfully prepared through a pFBDM Bac-to-Bac system, and an excellent genetic engineering vaccine is provided.

Another advancement of the present invention is to solve the problem of cytotoxicity of 3C protein and the problem of inefficient assembly of VLPs. Due to the cytotoxicity of 3C protease and incomplete cleavage of P1 protein, the efficiency of assembly and yield of these recombinant proteins expressed in insect cells is generally low. The recombinant baculovirus capable of expressing three capsid proteins of VP0, VP1 and VP3 simultaneously is constructed, so that the problem of cytotoxicity of 3C protease in the research of FMDV VLPs expressed by a baculovirus system and the problem of low VLPs assembly efficiency caused by incomplete cutting of P1 gene are effectively avoided.

The present invention also addresses the problem of poor observability of cytopathic effects. The determination of parameters such as the infection titer, the infection complex number, the infection time and the like of the baculovirus is a main factor for restricting the large-scale production of the baculovirus system. Among them, the determination of the titer of baculovirus is the basis for its expanded use. The laboratory typically passes plaque testing and TCID₅₀The test determines the titer of the virus, and the observability of cytopathic effect during baculovirus infection has certain requirements on operators, so that the method has greater uncontrollable property. According to the invention, the green fluorescence label EGFP protein is added when the recombinant FMDV capsid protein baculovirus is constructed, whether the virus infection exists can be determined by whether the cell can express EGFP under a fluorescence microscope, and the problem of poor observability of cytopathic effect can be well solved. In addition, EGFP protein does not participate in the biological process of self-assembly VLPs of three capsid proteins of FMDVVP0, VP1 and VP3, and can be effectively removed by a corresponding strategy in the subsequent purification process of VLPs, so that the EGFP protein has no influence on the subsequent application.

Experiments prove that capsid proteins VP0, VP1 and VP3 of FMDV can be expressed in the process that sf9 cells are infected by the virus-like particles rBAC-fluoroFMDV, and transmission electron microscope observation is carried out after a primarily purified virus-like particle rBAC-fluoroFMDV sample is negatively stained, so that virus-like particles with the diameter of 25-30 nm can be seen, and the virus-like particles are brightened in the middle, which indicates that VP0, VP1 and VP3 capsid proteins expressed in the process that sf9 cells are infected by the rBAC-fluoroFMDV can be assembled into VLPs. With TCID₅₀Method for detecting rBAC-fluoFMDV P3 generation virus titer to be 10^-7.5/0.1mL。

Drawings

FIG. 1: cloning of O-type FMDV VP0, VP1, VP3 and EGFP genes; 1, DL 5000DNA marker; EGFP gene; 3: the VP0 gene; 4: the VP1 gene; 5: VP3 gene.

FIG. 2A: the cloning process of VP0, VP1 and VP3 fragments is schematically shown.

FIG. 2B: cloning scheme of EGFP fragment.

FIG. 3: schematic diagram of recombinant plasmid construction.

FIG. 4: observation of green fluorescence of rf-fluoFMDV P3 infected sf9 cells.

FIG. 5: western blot detection of expression of recombinant protein of rf 9 cell infected by rBAC-fluoroFMDV;

1 sf9 normal cell group; 2. culture of rf 9 cells infected with rBAC-fluoroFMDV P2 generation; 3: rf 9 cell cultures infected with rbca-fluorofmdv P3 generation; 4: and (3) protein Maker.

FIG. 6: sf9 cells were infected with electron microscopy images expressing rBAC-fluoroFMDV VLPs.

Detailed Description

The invention is illustrated below with reference to specific examples. It will be understood by those skilled in the art that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention in any way.

The experimental procedures in the following examples are conventional unless otherwise specified. The raw materials and reagents used in the following examples are all commercially available products unless otherwise specified.

Example 1 construction of recombinant vector pFBDM-VP0/VP1/VP3/EGFP

The genomic cDNA of O/Mya98/XJ/2010 strain is used as a template (the genomic cDNA of O/Mya98/XJ/2010 strain can be obtained by extracting RNA from a commercial O-type inactivated vaccine for foot and mouth disease containing O/Mya98/XJ/2010 strain and carrying out reverse transcription), and corresponding primers are respectively designed (see Table 1). The primers VP0F and VP0R are used for amplification to obtain the O-type foot-and-mouth disease VP0 gene, the length of the fragment is 909bp, and the sequencing shows that the nucleotide sequence is shown as sequence 1 in the sequence table. The primers VP1F and VP1R are used for amplification to obtain the O-type foot-and-mouth disease VP1 gene, the length of the fragment is 639bp, and the sequencing shows that the nucleotide sequence is shown as sequence 2 in the sequence table. The primer VP3F and VP3R are used for amplification to obtain the O-type foot-and-mouth disease VP3 gene, the length of the fragment is 660bp, and the sequencing shows that the nucleotide sequence is shown as sequence 3 in the sequence table. FIG. 2A shows the schematic diagram of the above amplification, and FIG. 1 shows the electrophoresis diagram of the amplification product.

pEGFP-N1 plasmid is preserved in the laboratory, pEGFP-N1 is used as a template, corresponding primers (shown in table 1) are designed according to an EGFP gene sequence, the green fluorescent protein EGFP gene is obtained by amplification of primers EGFP F and EGFP R, the fragment length is 720bp, and the nucleotide sequence is shown as sequence 4 in the sequence table. FIG. 2B shows the schematic diagram of the above amplification, and FIG. 1 shows the electrophoresis diagram of the amplification product.

TABLE 1 amplification primers for each fragment

Respectively carrying out enzyme digestion on the amplified O-type foot-and-mouth disease VP0 gene and green fluorescent protein EGFP gene fragment by EcoR I/Xba I to obtain fragments, connecting the fragments with a pFBDM vector (Pubaetin biotechnology (Beijing) Co., Ltd.) subjected to enzyme digestion by the same restriction enzyme, transforming the connection product into E.coli DH10B competent cells, coating LB plates containing ampicillin, and carrying out overnight culture at 37 ℃. And (3) picking single colonies on the plate, culturing the single colonies in a liquid LB culture medium containing ampicillin for 6h, respectively carrying out PCR identification on bacterial liquid by using clone primers of VP0 and EGFP in the table 1, and sequencing positive bacterial colonies. Adding the bacterial liquid with the correct sequencing into a fresh LB culture medium containing ampicillin at a ratio of 1:500, culturing overnight, extracting plasmids to obtain a recombinant plasmid positive clone inserted with an O-type foot-and-mouth disease VP0 gene and a recombinant plasmid positive clone inserted with a green fluorescent protein EGFP gene, naming the recombinant plasmid inserted with the O-type foot-and-mouth disease VP0 gene as pFBDM-VP0 by sequencing, and naming the recombinant plasmid inserted with the green fluorescent protein EGFP gene as pFBDM-EGFP by sequencing. And (5) storing for later use. The above recombinant plasmid construction is schematically shown in FIG. 3.

Further, the amplified VP1 gene and VP3 gene fragments are digested by Sma I/Kpn I enzyme, and the obtained fragments are respectively connected with pFBDM-VP0 and pFBDM-EGFP recombinant vectors which are digested by the same restriction enzyme, the connection products are transformed into E.coli DH10B competent cells, and are coated with LB plates containing ampicillin and cultured overnight at 37 ℃. Single colonies on the plate are picked, cultured in a liquid LB culture medium containing ampicillin for 6h, and subjected to bacterial liquid PCR identification by using cloning primers of VP1 and VP3 in Table 1 respectively, and positive colonies are subjected to biological sequencing. Adding the bacterial liquid with the correct sequencing into a fresh LB culture medium containing ampicillin at a ratio of 1:500, culturing overnight, and extracting plasmids to obtain recombinant plasmid positive clones inserted with O-type foot-and-mouth disease VP0 and VP1 genes and recombinant plasmid positive clones inserted with VP3 genes and EGFP genes. The recombinant plasmid inserted with the O-type foot-and-mouth disease VP0 and VP1 genes shown by sequencing is named as pFBDM-VP0/VP 1; the recombinant plasmid inserted with VP3 gene and EGFP gene by sequencing was named pFBDM-EGFP/VP 3. The recombinant plasmid is preserved for later use, and the schematic construction of the recombinant plasmid is shown in FIG. 3.

The large fragment obtained by digesting the extracted pFDDM-VP 0/VP1 plasmid by Spe I/Nru I is connected with the small fragment generated by the pFDDM-EGFP/VP 3 plasmid digested by Avr II/Pme I, the connection product is transformed into E.coli DH10B competent cells, and LB plate containing ampicillin is coated for overnight culture at 37 ℃. Single colonies on the plate are picked, cultured in a liquid LB culture medium containing ampicillin for 6h, and subjected to bacterial liquid PCR identification by using cloning primers of VP1 and VP2 in Table 1 respectively, and positive colonies are subjected to biological sequencing. Adding the bacterial liquid with the correct sequencing into a fresh LB culture medium containing the ampicillin at a ratio of 1:500, culturing overnight, extracting plasmids to obtain recombinant plasmid positive clones inserted with O-type foot-and-mouth disease VP0, VP1 gene, VP3 gene and EGFP gene, and naming the recombinant plasmids inserted with the correct sequencing into O-type foot-and-mouth disease VP0, VP1 gene, VP3 gene and EGFP gene as pFBDM-VP0/VP1/VP 3/EGFP. The recombinant plasmid was stored for use, and its construction is schematically shown in FIG. 3.

Example 2 preparation of recombinant baculovirus rBAC-fluoroFMDV

The method comprises the steps of transforming DH10Bac competent cells by pFBDM-VP0/VP1/VP3/EGFP recombinant plasmids, culturing for 4h in a liquid LB culture medium containing tetracycline and kanamycin, coating LB plates containing gentamicin, tetracycline and kanamycin, selecting white colonies through two-round blue-white screening, carrying out PCR bacterial liquid detection and identification by using M13F/VP1F and VP0F/M13R primer pairs (M13F/R primers are synthesized according to the sequence provided by Bac-to-Bac specifications of Invitrogen company), expanding and culturing correct strains, extracting recombinant baculovirus expression plasmids, naming the recombinant baculovirus expression plasmids as Bacmid-VP0/VP1/VP3/EGFP, and storing for later use.

The sf9 cells in the logarithmic growth phase are paved on a six-well plate, and the recombinant baculovirus expression plasmid Bacmid-VP0/VP1/VP3/EGFP DNA is diluted according to the transfection method requirement of a transfection reagent Lipofectamine3000, mixed with the transfection reagent, and transfected into sf9 cells. Culturing for 96h in a constant temperature incubator at 27 ℃, collecting cell culture supernatant, centrifuging for 5min at 8000rpm, collecting supernatant, filtering and sterilizing to obtain recombinant baculovirus P0 generation virus, and storing for later use, wherein the recombinant baculovirus is named as rBAC-fluoroFMDV.

Example 3 amplification and determination of the toxic valence of recombinant baculovirus rBAC-fluoroFMDV

Inoculating rf 9 cells in a logarithmic growth phase to rBAC-fluoroFMDV P0 generation virus according to the ratio of the virus to a culture medium 1/10(v/v), culturing for 96h in a 27-DEG C constant-temperature incubator, collecting cell culture supernatant, centrifuging for 5min at 8000rpm, and collecting supernatant to obtain P1 generation virus. The P2 generation was amplified with the P1 generation virus and the P3 generation was amplified with the P2 virus. With TCID₅₀Method for detecting rBAC-fluoFMDV P3 generation virus titer to be 10^-7.5/0.1mL。

Example 4 expression and characterization of recombinant proteins in insect cells sf9

And (3) paving sf9 cells in a logarithmic growth phase in a six-well plate, inoculating rBAC-fluoroFMDV viruses of generations and P3 generations, and observing the expression condition of green fluorescent protein EGFP by using a fluorescence microscope 60 hours after infection. The results are shown in fig. 4, the recombinant baculovirus can express the green fluorescent protein in a large amount, while the sf9 cell control group which is not infected with the recombinant virus has no green fluorescence, which indicates that the green fluorescent protein is successfully expressed.

In order to further identify the expression condition of each structural protein of FMDV, Western blot analysis is carried out on cell samples of P2 generation and P3 generation, O type FMDV pig multi-antiserum is used as a primary antibody, and HRP labeled goat anti-pig IgG is a product of Shanghai bio-engineering company. Color development was performed with an ECL color development kit and color development was performed using chemiluminescence exposure. As shown in FIG. 5, the bands specifically reacting with swine anti-type O FMDV hyperimmune serum are consistent with the molecular weights of FMDV capsid proteins VP0 (about 33kD), VP1 and VP3 (about 24kD), indicating that capsid proteins VP0, VP1 and VP3 of FMDV can be expressed during infection of sf9 cells by rBAC-fluoroFMDV.

EXAMPLE 5 Large Scale preparation of Virus-like particles

Inoculating sf9 cells with proper density into a shake flask, and carrying out shake culture in an incubator with the constant temperature of 27 ℃ and 110rpm until the density reaches 2 x 10⁶cells/mL, inoculating P3 generation recombinant baculovirus rBAC-fluoroFMDV with MOI of 5, carrying out shake culture in a constant temperature incubator with the temperature of 27 ℃ and the rpm of 110 for 72h, centrifuging to collect cell precipitates, resuspending cells by 1/20 volume of PBS with the pH of 8.0, repeatedly freezing and thawing at the temperature of-80 ℃ and room temperature for 3 times, centrifuging at 12000g for 10min, and collecting supernatant, namely the initial virus-like particle solution.

EXAMPLE 6 preliminary purification of Virus-like particles

The virus-like particle solution obtained in example 5 was filtered through a 0.22 μm filter, and the supernatant solution was subjected to 30% sucrose cushion treatment, centrifuged at 35000g for 3.5 hours, resuspended in 1/10 vol of PBS, and stored for later use.

Example 7 identification of Virus-like particles

Example 6 the primary purified sample of virus-like particles was negatively stained and then observed by transmission electron microscopy, as shown in fig. 6, it can be seen that the virus-like particles with diameters of 25-30 nm and the middle part is bright, indicating that the VP0, VP1 and VP3 capsid proteins expressed during the infection of sf9 cells by the rBAC-fluorofmdv can assemble into VLPs.

The above description of the specific embodiments of the present invention is not intended to limit the present invention, and those skilled in the art may make various changes and modifications according to the present invention without departing from the spirit of the present invention, which is defined by the scope of the appended claims.

Sequence listing

<110> Zhongmu industries GmbH

<120> foot-and-mouth disease virus recombinant virus-like particle, preparation method and application thereof

<130> WHOI170046

<160> 4

<210> 1

<211> 909

<212> DNA

<213>

<400> 1

ggagccggac aatccagtcc ggctactggg tcacagaacc aatcaggcaa caccgggagt 60

atcatcaaca attactacat gcagcagtac cagaactcca tggacaccca acttggtgac 120

aatgccatca gcggaggctc caacgaggga tccacagaca caacttccac ccacacaacc 180

aacactcaga acaatgactg gttttcaaag ttggccagct ctgccttcag tggtcttttc 240

ggcgccctcc tcgccgataa gaaaaccgag gagaccactc ttctcgagga ccgcatcctc 300

accacccgaa acggacacac cacctcgaca acccagtcga gtgttggcat aacgcacggg 360

tacgcaacag ctgaggattt tgtgagcggg ccaaacacct ctggtcttga gaccagagtt 420

gtccaggcgg aacggttctt taaaacccac ctgttcgact gggtcaccag tgatccgttc 480

ggacggtact acttgttgga gctcccgact gaccacaaag gtgtctacgg cagcctgacc 540

gactcatatg cctacatgag aaacggttgg gatgttgaag tcaccgctgt ggggaatcag 600

ttcaacggag gctgcctact ggtggccatg gtgcctgaac tttgttccat cgagcggaga 660

gagctgttcc agcttacgct cttcccccac cagttcatca acccccggac gaacatgaca 720

gcccacatca aggtgccctt tgttggcgtc aaccgttacg atcagtacaa ggtacacaag 780

ccgtggaccc ttgtggttat ggtcgtagcc ccactgactg tcaacaccga aggcgctccg 840

cagatcaagg tgtatgccaa catcgcaccc accaacgtgc acgtcgcggg tgagttccct 900

tccaaagag 909

<210> 2

<211> 639

<212> DNA

<213>

<400> 2

accacttcga caggcgagtc ggctgacccc gtgactgcca ccgttgagaa ttacggcggc 60

gagacacagg tccagaggcg ccaccacaca gatgtctcat tcatattgga cagatttgtg 120

aaagtcacac caaaagaatc aataaatgta ttggacctga tgcagactcc cccccacacc 180

ctagtagggg cgctcctccg cactgccact tactatttcg ctgatctaga ggtggcagtg 240

aaacacgagg gagaccttac ctgggtgcca aatggagcac ctgaagcagc cttggacaac 300

accaccaacc caacggcgta ccataaggcg ccgcttaccc ggcttgcatt gccatacacg 360

gcaccacacc gtgttttggc caccgtttac aacgggaact gcaaatacgc cgggggctca 420

ctgctcaacg tgagaggcga tctccaagcg ctggctccga aggcagcgag gccgctgcct 480

acttctttca actacggtgc catcaaagcc actcgggtga cagaactgct gtaccgcatg 540

aagagggccg agacgtactg tcctcggccc ctcttggcta ttcacccgag tgcggccaga 600

cacaaacaga aaatagtggc acctgtaaag cagtccttg 639

<210> 3

<211> 660

<212> DNA

<213>

<400> 3

gggattttcc ctgtggcctg tagcgacggt tatggcggct tggtgacaac tgacccaaag 60

acggctgacc ccgtttacgg caaagtgttc aacccccccc gcaacatgtt gccggggcgg 120

ttcaccaacc tcttggacgt ggctgaggct tgccccacgt ttctgcactt cgatggtgac 180

gtaccgtacg tgaccactaa gacggattcg gacagggtgc tcgcacaatt tgacttgtct 240

ttggcagcaa aacacatgtc aaacaccttc cttgcaggtc ttgcccagta ctacacgcag 300

tacagcggca ccgtcaacct gcacttcatg ttcacaggtc ccactgacgc gaaagcgcgt 360

tacatgattg cgtatgcccc tccgggcatg gagccgccca aaacacctga ggctgctgct 420

cactgcattc acgcagagtg ggacacgggt ctgaactcaa agtttacctt ttccatcccc 480

tacctctcgg cggctgatta cgcgtacacc gcgtctgacg ctgctgagac cacaaatgtt 540

cagggatggg tctgcttatt tcaaataaca cacgggaaag ctgagggtga cgctcttgtc 600

gtgctggcca gtgctggcaa agactttgag ctgcgcctgc ctgtggacgc acggcaacag 660

<210> 4

<211> 720

<212> DNA

<213>

<400> 4

atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480

ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540

gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660

ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa 720

Claims

1. A method for preparing recombinant foot-and-mouth disease virus-like particles comprises the following steps:

1) constructing a recombinant vector for preparing the recombinant foot-and-mouth disease virus-like particle, which comprises the following steps:

a, inserting an O-type foot-and-mouth disease VP0 gene between EcoR I and Xba I enzyme recognition sites of a pFDDM vector to obtain a recombinant vector inserted with the O-type foot-and-mouth disease VP0 gene, which is named as pFDDM-VP 0; inserting the O-type foot-and-mouth disease VP1 gene between Sma I and Kpn I enzyme recognition sites of pFDDM-VP 0 to obtain a recombinant vector inserted with the O-type foot-and-mouth disease VP0 gene and the O-type foot-and-mouth disease VP1 gene, which is named as pFDDM-VP 0/VP 1;

b. inserting a green fluorescent protein EGFP gene between EcoR I and Xba I enzyme recognition sites of a pFDDM vector to obtain a recombinant vector inserted with the green fluorescent protein EGFP gene, and naming the recombinant vector as pFDDM-EGFP; inserting the O-type foot-and-mouth disease VP3 gene between Sma I and Kpn I enzyme recognition sites of pFDDM-EGFP to obtain a recombinant vector inserted with a green fluorescent protein EGFP gene and an O-type foot-and-mouth disease VP3 gene, and naming the recombinant vector as pFDDM-EGFP/VP 3;

c. connecting a large fragment obtained by enzyme digestion of a pFBDM-VP0/VP1 plasmid through Spe I/Nru I with a small fragment generated by enzyme digestion of a pFBDM-EGFP/VP3 plasmid through Avr II/Pme I to obtain a recombinant plasmid inserted with an O-type foot-and-mouth disease VP0 gene, a VP1 gene, a VP3 gene and an EGFP gene; wherein, the nucleotide sequence of the O-type foot-and-mouth disease VP0 gene is shown as a sequence 1 in a sequence table; the nucleotide sequence of the O type foot-and-mouth disease VP1 gene is shown as sequence 2 in the sequence table; the nucleotide sequence of the O type foot-and-mouth disease VP3 gene is shown as a sequence 3 in the sequence table; the nucleotide sequence of the green fluorescent protein EGFP gene is shown as a sequence 4 in a sequence table;

2) transforming the recombinant vector constructed in the step 1) into a DH10Bac competent cell, and obtaining a recombinant baculovirus expression plasmid through screening and identification;

3) transfecting sf9 cells with the recombinant baculovirus expression plasmid obtained in the step 1), culturing and passaging for 3 times, performing cell culture freeze-thawing treatment for 3 times, centrifuging, filtering and sterilizing to obtain recombinant baculovirus-like particles.

2. Use of the method for preparing recombinant foot-and-mouth disease virus-like particles according to claim 1 for the preparation of vaccines for the prevention and/or treatment of foot-and-mouth disease infections.