CN111040024A

CN111040024A - Type 4 avian adenovirus gene engineering vaccine and preparation method and application thereof

Info

Publication number: CN111040024A
Application number: CN201911359301.2A
Authority: CN
Inventors: 袁野; 岳建新; 王飞; 孙灵睿; 周蕾蕾; 陈秋阁; 向王震; 张秀美; 李浩鹏; 李浩哲; 朱昊敏; 魏杰; 安铁军
Original assignee: Qyh Biotech Co ltd
Current assignee: Qyh Biotech Co ltd
Priority date: 2019-12-25
Filing date: 2019-12-25
Publication date: 2020-04-21

Abstract

The invention provides a gene engineering vaccine of avian adenovirus type 4, a preparation method and application thereof. The invention connects the protective antigen penton and hexon protein of the avian adenovirus serotype 4 with a linker, expresses the protective antigen by an insect cell-baculovirus expression system to form avian adenovirus serotype 4 particles on spatial conformation, adds an adjuvant, emulsifies the particles and prepares the gene engineering vaccine of the avian adenovirus serotype 4. The vaccine provided by the invention has the advantages of simple preparation method, capability of preparing a large amount of avian adenovirus type 4 antigen protein, short time consumption, high expression level, contribution to large-scale production, good immune effect of the obtained genetic engineering vaccine and capability of effectively preventing infection of avian adenovirus type 4.

Description

Type 4 avian adenovirus gene engineering vaccine and preparation method and application thereof

Technical Field

The invention belongs to the field of biological products for livestock, and particularly relates to a gene engineering vaccine for avian adenovirus type 4, and a preparation method and application thereof.

Background

In 1987, Pakistani Angora first reported a major outbreak of Hydropericardium Hepatitis Syndrome (HHS) caused by group I adenovirus serotype 4 (Fowledenvirosum type, FAdV-4), followed by successive outbreaks in Ecuador, Chile, Iraq, Mexico, India, Monema, etc., and caused a huge economic loss, and FAdV-4 was the most pathogenic to chicks, spreading horizontally and vertically by contact. The main pathological changes are clear or light yellow water sample or jelly-like liquid accumulated in the pericardial cavity, focal necrosis or fading of liver occasionally, basophilic inclusion bodies of liver cells and high lethality.

FAdV-4 belongs to adenovirus group A, the virion is spherical, the diameter is 70-90nm, the virion has no envelope, the virion is symmetrical in 20 planes, 12 vertexes are provided, and the virion is a regular 20 plane body consisting of 20 regular triangles. The surface consists of 252 hollow particles with the length of 11-11nm and the width of 5-6nm, and the middle part is provided withA core with a diameter of 60-65 nm. The nucleic acid is double-stranded DNA, can replicate in cell nucleus, and has molecular weight of 3 × 10⁷Da, which accounts for 11.2% -13.5% of the total virion, with the remainder being proteins, and the penton and hexon being the major structural proteins of FAdV-4, which together constitute the viral nucleocapsid.

At present, no commercial FAdV-4 vaccine exists in China, and the prevention and control of the avian adenovirus are still weak. The development of the full virus inactivated vaccine needs to use a sensitive cell line chicken liver cancer cell, the cell is not firmly attached to the wall, large-scale culture is difficult, the culture condition is harsh, fetal bovine serum is needed, and the production cost is high. The chicken liver cancer cell belongs to cancer cells, and the injection of the chicken liver cancer cell into chicken bodies has safety risks. The baculovirus expression system has the characteristics of high-efficiency expression, safety, easy operation and the like, insect cells can be completely cultured in a serum-free suspension manner, the production is easy to amplify, and the baculovirus expression system is very suitable for being used as a genetic engineering subunit vaccine for development.

Therefore, the production method for developing the gene engineering vaccine of the serum type 4 avian adenovirus with low production cost, high production efficiency and good immune effect has important practical significance.

Disclosure of Invention

The invention aims to provide a gene engineering vaccine of avian adenovirus type 4, a preparation method and application thereof.

To achieve the object of the present invention, in a first aspect, the present invention provides an isolated polypeptide comprising or consisting of an amino acid sequence as follows:

i) amino acid sequences of the proteins from the penton and hexon of the avian adenovirus type 4 as shown in SEQ ID NO 1; or

ii) an amino acid sequence obtained by connecting a label at the N end and/or the C end of the i); or

iii) the amino acid sequence of i) or ii) is substituted, deleted and/or added with one or more amino acids to obtain the polypeptide with the same function.

Wherein, the penton and hexon proteins are connected through a Linker.

In a second aspect, the invention provides a nucleic acid molecule encoding said polypeptide. The nucleotide sequence is shown in SEQ ID NO. 2.

In a third aspect, the present invention provides biological materials containing the nucleic acid molecules, including but not limited to recombinant DNA, expression cassettes, transposons, plasmid vectors, phage vectors, viral vectors, engineered bacteria, transgenic cell lines, or the like.

In a fourth aspect, the invention provides a composition comprising said polypeptide and a pharmaceutically acceptable carrier.

In a fifth aspect, the present invention provides an immunogenic composition comprising the above composition.

In a sixth aspect, the invention provides an avian adenovirus type 4 genetically engineered vaccine comprising the immunogenic composition, optionally comprising an adjuvant.

Preferably, the adjuvant is a veterinary acceptable oily adjuvant, including white oil, Span-80, tween.

In a seventh aspect, the invention provides a method for preparing a type 4 avian adenovirus genetic engineering vaccine, which comprises preparing a recombinant baculovirus comprising nucleic acid molecules encoding type 4 avian adenovirus penton and hexon proteins shown as SEQ ID NO:1 by using an insect cell-baculovirus expression system, inoculating the harvested recombinant baculovirus into an insect cell, culturing the transfected cell, collecting cell culture supernatant after cytopathic effect, inactivating and purifying the supernatant, and mixing the supernatant with an adjuvant.

In one embodiment of the present invention, the aforementioned method comprises the steps of:

(1) synthesizing a target gene segment shown as SEQ ID NO. 2, respectively carrying out double enzyme digestion on a pMD19-T vector containing the target gene segment and a pFastBac 1 vector, carrying out gel recovery, connecting the target gene segment and the pFastBac 1 vector overnight by using T4 DNA ligase, transforming into a DH5 α competent cell, extracting the pFastBac 1 vector containing the target gene segment after correct sequencing, transforming the pFastBac 1 vector containing the target gene segment into DH10Bac, selecting white spots by a blue-white spot screening method, inoculating the white spots into a liquid culture medium containing kanamycin, gentamicin and tetracycline for overnight culture, collecting bacterial liquid, extracting recombinant plasmid shuttle plasmid DNA, sequencing and identifying the recombinant plasmid shuttle plasmid;

(2) serum-free Sf9 cells cultured in suspension with a cell density of 2.0 × 10⁶～3.0×10⁶cells/ml (preferably 2.5X 10)⁶cells/ml), transfecting by using a recombinant shuttle plasmid bacmid, and harvesting culture supernatant after 72-96h after transfection when the cell viability is reduced to 60-80%, namely P0 generation recombinant baculovirus; sf9 cells were cultured to 4.0X 10 with Sf9 serum-free suspension medium⁶～8.0×10⁶cells/ml (preferably 5.0X 10)⁶cells/ml), cell density was diluted to 2.0X 10 with fresh serum-free medium⁶～3.0×10⁶cells/ml (preferably 2.5X 10)⁶cells/ml) is inoculated with recombinant baculovirus according to the proportion of 1 per thousand-1 percent, the culture is carried out until 168-192h is added, and supernatant is obtained, and the titer is detected to be not lower than 1:32, a first step of removing the first layer;

(3) inactivating and purifying the supernatant, taking 94-96 parts of the supernatant, adding tween-804-6 parts of the supernatant, stirring for dissolving, taking 94-96 parts of white oil and Span-804-6 parts of the white oil as a water phase, uniformly mixing, taking 2 parts of an oil phase, adding 1 part of the water phase, and emulsifying for 20-40 min (preferably, taking 96 parts of the supernatant, adding tween-804 parts of the white oil, stirring for dissolving, taking 2 parts of the oil phase, adding 1 part of the water phase, and emulsifying for 30 min).

In the invention, the parts are parts by weight.

In step (3), ethyleneimine may be used as the inactivation supernatant.

In the present invention, the culture medium for Sf9 cells was purchased from Shanghai culture Biotech GmbH, InsectProSF9/SF21 insect cell serum-free medium, Cat H810 KJ.

In an eighth aspect, the invention provides an application of the polypeptide, or a composition containing the polypeptide, or the genetic engineering vaccine prepared according to the method in preparing a medicament for treating or preventing the infection of the avian adenovirus type 4.

In a ninth aspect, the invention provides the application of the polypeptide, or a composition containing the polypeptide, or the genetic engineering vaccine prepared according to the method in treating or preventing the type 4 avian adenovirus infection.

By the technical scheme, the invention at least has the following advantages and beneficial effects:

the genetic engineering vaccine provided by the invention is used for immunizing SPF (specific pathogen free) chickens of 14 days, and serum antibodies which meet the regulation standard can be generated after immunization for 28 days through serum antibody detection, and can resist the attack of avian adenovirus virulent viruses. The invention expresses the protein of the penton and hexon of the avian adenovirus type 4 by using an insect cell-baculovirus expression system, has high protein yield and high purity, and has stronger antigen immunity and higher safety when being used for preparing vaccines.

Drawings

FIG. 1 shows healthy Sf9 cells (left) compared with diseased cells (right) in example 2 of the present invention.

FIG. 2 shows the result of SDS-PAGE electrophoresis of the target protein in example 2 of the present invention.

FIG. 3 shows virus-like particles observed under an electron microscope in example 2 of the present invention.

FIG. 4 shows the result of the detection of the antigen agar titer in example 2 of the present invention.

Figure 5 shows a comparison of the anatomy of healthy SPF chickens (left) and sick SPF chickens (right) according to example 2 of the present invention.

Detailed Description

The invention provides a genetic engineering vaccine for preventing avian adenovirus serotype 4, and antigens used in the vaccine are inactivated recombinant antigen proteins, namely a penton and a hexon, which are connected through a Linker.

The specific scheme is as follows:

the invention firstly provides a protective antigen of avian adenovirus type 4 and a coding gene thereof, wherein the amino acid sequence of the protective antigen is shown as SEQ ID NO. 1, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 2.

Researches show that the baculovirus with the protective antigen coding gene is constructed to infect Sf9 cells, so that the Sf9 cells can efficiently express the protective antigen, the protective antigen generated by expression is collected and purified to prepare the genetic engineering subunit vaccine, the defects in the production aspect of the existing avian adenovirus antigen can be effectively overcome, and the obtained vaccine has good immunogenicity.

Furthermore, the invention provides the application of the protective antigen and the coding gene thereof in preparing the avian adenovirus vaccine; the vaccine is preferably a genetically engineered subunit vaccine.

The preparation method of the vaccine can adopt the preparation method of the genetic engineering subunit vaccine which is conventional in the field.

Preferably, the preparation method comprises:

the method comprises the steps of carrying out double enzyme digestion on a pMD19-T vector containing a target gene by Bam HI and Hind III to obtain a target fragment, carrying out gel recovery and purification on the target fragment, carrying out double enzyme digestion on a pFastBac 1 vector to recover gel, carrying out overnight connection on the target gene fragment and the pFastBac 1 vector by using T4 DNA ligase, then transforming the target gene fragment and the pFastBac 1 vector into DH5 α competent cells, carrying out sequencing after bacteria selection and culture, and extracting the pFastBac 1 vector containing the target gene after the sequencing is correct.

The pFastBac 1 vector containing the target gene is transformed into DH10Bac, the transformed product is cultured in SOC culture medium at 37 ℃ for 5h, diluted and inoculated with a blue-white spot screening plate, cultured at 37 ℃ for 48h, and then white spots are selected. Inoculating white spots into liquid culture medium containing kanamycin, gentamicin and tetracycline for overnight culture. Collecting bacterial liquid, extracting recombinant shuttle plasmid bacmid DNA, and sequencing and identifying the recombinant bacmid by using pUC/M13 forward and reverse primers (M13F: GTTTTCCCAGTCACGAC, M13R: CAGGAAACAGCTATGAC). The sequencing results are completely correct in alignment.

Serum-free suspension cultured sf9 cells are taken, and the cell density is 2.5 multiplied by 10⁶cells/ml, suspension transfection in 125ml shake flask, culture volume 25ml, using Opti-MEM to dilute 12.5. mu.g recombinant Bacmid and 30ul insect cell line cell transfection reagent, mixing, adding to sf9 cell suspension, culturing at 27 ℃, 120rpm shaking table. And (3) harvesting culture supernatant 72-96h after transfection when the cell viability is reduced to 60-80%, namely P0 generation baculovirus.

Sf9 cells were cultured to 5X 10 with Sf9 serum-free suspension medium⁶cells/ml, cell density diluted to 2.5X 10 with fresh serum-free medium⁶cells/ml, according to the proportion of 1 per mill-1 percent, inoculating the rodThe baculovirus is cultured for 168-192h to harvest culture supernatant. And (3) carrying out SDS-PAGE electrophoresis to identify the molecular weight of the protein, observing whether virus-like particles are formed or not by using an electron microscope, and detecting the amplification potency of the protein. And then the vaccine is purified by a process, and corresponding adjuvants are added, so that the vaccine can be used for preparing subunit inactivated vaccines of the avian adenovirus type 4 and preventing the avian adenovirus type 4.

It is understood that the avian adenovirus disease vaccine prepared by using the coding gene of the invention or the avian adenovirus disease vaccine containing the protective antigen of the invention belongs to the protection scope of the invention.

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise indicated, the examples follow conventional experimental conditions, such as the Molecular Cloning handbook, Sambrook et al (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual,2001), or the conditions as recommended by the manufacturer's instructions.

EXAMPLE 14 preparation of avian adenovirus type genetic engineering vaccine

1. Screening and cloning of target genes

Searching coding gene sequences and protein sequences of the proteins of the penton and hexon of the avian adenovirus, and extracting RNA from the existing virus to perform sequencing comparison. According to the previous research result, the region with stronger antigenicity is screened out for splicing, and a Linker (Linker) is added between the penton protein and the hexon protein to ensure the space conformation and the formation of virus-like particles (VLPs).

Checking and optimizing restriction enzyme cutting sites in the obtained sequence to ensure that the sequence does not contain Bam H I and Hind III cutting sites, and sending the spliced sequence to a biological company for synthesis.

A pair of splicing primers for amplifying the gene segments of the avian adenovirus is designed by using Primer5.0 software, and protective bases and enzyme cutting sites are added to the 5 'end of an upstream primer and the 5' end of a downstream primer. The primer sequence is as follows:

FAdV-BamH I-F：CGCGGATCCATGATGGGAAGCTACTTTGA

FAdV-Hind III-R：CCCAAGCTTTCAGCAGAATAACGATGATA

the use of pfu enzyme pairThe synthetic sequence was PCR amplified in 50. mu.L: 10 XPCR Buffer 5. mu.L, dNTP (10 mM each) 1. mu.L, upstream and downstream primers (10nM) 1. mu.L each, synthetic DNA 1. mu.L, pfu enzyme 1. mu.L, ddH₂O40μL。

PCR reaction parameters: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 58 ℃ for 30s, 72 ℃ for 120 s; 7min at 72 ℃.

The product is detected by agarose gel electrophoresis, and a single bright band is arranged at the position of about 1400 bp. The products were recovered and sequenced using a DNA product recovery kit and the alignment found to be in full agreement with the expectations.

2. Construction and expression of FAdV-4 recombinant protein

Estimating the concentration of the target fragment and the pFastBac 1 vector, mixing the target sequence and the pFastBac 1 vector according to the proportion of 1: 4, adding T4 Buffer and T4 ligase, carrying out enzymatic ligation at 16 ℃ overnight, transforming the ligation product into escherichia coli DH5 α competent cells, extracting plasmid, verifying to be completely correct, extracting the pFastBac 1 vector containing the target gene, transforming the vector into DH10Bac, and screening out positive clones by a blue-white spot screening method.

Serum-free Sf9 cells cultured in suspension with a cell density of 2.5X 10 were selected⁶cells/ml, suspension transfection in 125ml shake flask, culture volume 25ml, using Opti-MEM to dilute 12.5. mu.g recombinant Bacmid and 30ul ExpifeactamineSf transfection reagent, mixing, adding Sf9 cell suspension, 27 ℃, 120rpm shaking table culture. And (3) harvesting culture supernatant 72-96h after transfection when the cell viability is reduced to 60-80%, namely P0 generation baculovirus.

Sf9 cells were cultured to 5X 10 with Sf9 serum-free suspension medium⁶cells/ml, cell density diluted to 2.5X 10 with fresh serum-free medium⁶cells/ml, inoculating baculovirus according to the proportion of 1 per thousand, culturing for 168h, and harvesting culture supernatant. And (3) carrying out SDS-PAGE electrophoresis to identify the molecular weight of the protein, observing whether virus-like particles are formed or not by using an electron microscope, and detecting the amplification potency of the protein.

3. Emulsification and preparation of genetic engineering vaccine

Harvesting culture supernatant with agar-agar titer not less than 1:32, adding 3mM final concentration of ethyleneimine, inactivating at 30 deg.C for 28h, collecting 96 parts of supernatant, adding 4 parts of Tween-80, stirring to dissolve, collecting 94 parts of white oil and 806 parts of Span, mixing well, collecting 2 parts of oil phase, slowly adding 1 part of water phase, emulsifying at 3000rpm for 30min, preparing fowl adenovirus gene engineering vaccine (subunit vaccine) of serum 4, and storing at 4 deg.C.

Example expression characteristics and immunogenicity of avian adenovirus type 24 genetic engineering vaccines

1. Expression characteristics

Sf9 cells were cultured to 5X 10 with Sf9 serum-free suspension medium⁶cells/ml, cell density diluted to 2.5X 10 with fresh serum-free medium⁶cells/ml, inoculating recombinant baculovirus according to the proportion of 1 per mill, culturing for 96h, and harvesting supernatant. Cells at 96h after infection showed a marked expansion compared to healthy cells. The virus titer is determined by the plaque method, and the virus titer of the recombinant baculovirus P1 generation is 10^8.25TCID₅₀/ml。

Sf9 cells were cultured to 5X 10 with Sf9 serum-free suspension medium⁶cells/ml, cell density diluted to 2.5X 10 with fresh serum-free medium⁶cells/ml, inoculating recombinant baculovirus in the proportion of 1-1 per mill, culturing until 168-192h and harvesting culture supernatant. SDS-PAGE was performed to identify the protein size of about 54KD (FIG. 2), and electron microscopic observation confirmed the formation of virus-like particles (FIG. 3), and the antigen amplification titer was 1:32 (fig. 4).

2. Immunogenicity

The subunit vaccine prepared in the example 1 is used for immunizing SPF (specific pathogen free) chickens of 14 days, serum antibodies meeting the regulation standard can be generated after immunization for 28 days through serum antibody detection, and the subunit vaccine can resist the virulent attack of the avian bursal disease virus.

The toxin counteracting method comprises the following steps: selecting good SPF chicken, 10 each in control group and 28 days after immunization, injecting FAdV-I group 4 HB1510 strain virus liquid (Lintao Li, Genome sequence of a paw adenovirus serotype 4strain from chicken, and isolated from chicken [ J]Genome Annouce,2016,4(2) e00140-16.doi:10.1128/Genome A.00140-16)0.5ml (containing 10⁶TCID₅₀) One by oneAnd (4) observing and recording the morbidity and the mortality in the day, observing for 72-120 h, killing and storing live chickens, dissecting all chickens, and observing the pathological changes of hearts and livers of the chickens used for the test. The test results show that all the control group of test chickens die in 3 days, obvious symptoms of the avian adenovirus serotype 4 are dissected, all the immunized chickens are normal (figure 5), the relative protection rate is 100%, no specific lesion exists, and the test results are shown in table 1.

TABLE 1 antibody titers and challenge results 28 days after immunization

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> Qianyuan Haoyao organism GmbH

Gene engineering vaccine of <120> type 4 avian adenovirus, preparation method and application thereof

<130>KHP191116883.8

<160>2

<170>SIPOSequenceListing 1.0

<210>1

<211>486

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>1

Met Gly Ser Tyr Phe Asp Leu Lys Asn Lys Phe Arg Gln Thr Val Val

1 5 10 15

Ala Pro Thr Arg Asn Val Thr Thr Glu Lys Ala Gln Arg Leu Gln Ile

20 25 30

Arg Phe Tyr Pro Ile Gln Thr Asp Asp Thr Ser Thr Gly Tyr Arg Val

35 40 45

Arg Tyr Asn Ile Asn Val Gly Asp Gly Trp Val Leu Asp Met Gly Ser

50 55 60

Thr Tyr Phe Asp Ile Lys Gly Ile Leu Asp Arg Gly Pro Ser Phe Lys

65 70 75 80

Pro Tyr Cys Gly Thr Ala Tyr Asn Pro Leu Ala Pro Lys Glu Ser Met

85 90 95

Phe Asn Asn Trp Ser Glu Thr Ala Pro Gly Gln Asn Val Ser Ala Ser

100 105 110

Gly Gln Leu Ser Asn Val Tyr Thr Asn Thr Ser Thr Thr Lys Asp Thr

115 120 125

Thr Ala Ala Gln Val Thr Lys Ile Ser Gly Val Phe Pro Asn Pro Asn

130 135 140

Gln Gly Pro Gly Ile Asn Pro Leu Arg Gln Val Glu Asn Ala Asn Thr

145 150 155 160

Gly Val Leu Gly Arg Phe Ala Lys Ser Gln Tyr Asn Tyr Ala Tyr Gly

165 170 175

Ala Tyr Val Lys Pro Val Ala Ala Asp Gly Ser Gln Ser Leu Thr Gln

180 185 190

Thr Pro Tyr Trp Ile Met Asn Asn Ala Gly Thr Glu Tyr Glu Phe Asn

195 200 205

Thr Phe Tyr Cys Cys Glu Leu Cys Cys Asn Pro Ala Ser Ala Gly Ser

210 215 220

Tyr Asn Thr Gln Ile Tyr Thr Ile Asn Asp Lys Ile Leu Ser Tyr Thr

225 230 235 240

Glu Ser Met Ala Gly Lys Arg Glu Met Val Ile Ile Thr Phe Lys Ser

245 250 255

Gly Glu Thr Phe Gln Val Glu Val Pro Gly Ser Gln His Ile Asp Ser

260 265 270

Gln Lys Lys Ala Ile Glu Arg Met Lys Asp Thr Leu Arg Ile Thr Tyr

275 280 285

Leu Thr Glu Thr Lys Ile Asp Lys Leu Cys Val Trp Asn Asn Lys Thr

290 295 300

Pro Asn Ser Ile Ala Ala Ile Ser Met Lys Asn Thr Ser Ala Asn Gln

305 310 315 320

Thr Thr Leu Leu Thr Val Pro Asp Met Ala Gly Gly Ile Gly Ala Met

325 330 335

Tyr Thr Ser Leu Pro Asp Thr Phe Ile Ala Pro Thr Gly Phe Lys Glu

340 345 350

Asp Asn Thr Thr Asn Leu Cys Pro Val Val Gly Met Asn Leu Phe Pro

355 360 365

Thr Tyr Asn Lys Ile Tyr Tyr Gln Ala Ala Ser Thr Tyr Val Gln Arg

370 375 380

Leu Glu Asn Ser Cys Gln Ser Ala Thr Ala Ala Phe Asn Arg Phe Pro

385 390 395 400

Glu Asn Glu Ile Leu Lys Gln Ala Pro Pro Met Asn Val Ser Ser Val

405 410 415

Cys Asp Asn Gln Pro Ala Val Val Gln Gln Gly Val Leu Pro Val Lys

420 425 430

Ser Ser Leu Pro Gly Leu Gln Arg Val Leu Ile Thr Asp Asp Gln Arg

435 440 445

Arg Pro Ile Pro Tyr Val Tyr Lys Ser Ile Ala Thr Val Gln Pro Thr

450 455 460

Val Leu Ser Ser Ala Thr Leu Gln Ile Thr Thr Ile Ile Ile Val Ile

465 470 475 480

Ile Val Ile Leu Leu Ser

485

<210>2

<211>1461

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

atgggaagct actttgactt gaaaaacaag ttcagacaga cggtcgtggc gcccacccga 60

aatgtcacga cagaaaaggc tcaacggctg caaatccgct tttaccccat ccaaaccgac 120

gacacgtcga cgggctaccg cgtgcggtac aacatcaatg tgggcgacgg ttgggtcctg 180

gacatggggt cgacctattt cgacatcaag ggaatcctag accgagggcc gtccttcaag 240

ccctactgcg gcacggctta caacccgctg gctcccaagg agtccatgtt taacaactgg 300

tcggagacgg cacccgggca gaacgtgtcc gcctccggtc agctgtccaa tgtctatacc 360

aacacgagca ccaccaaaga cacgacggcg gcgcaggtga cgaagatttc cggcgtcttt 420

cccaacccca accagggacc cggaataaat cctctgcggc aggtagaaaa cgccaacacc 480

ggcgtgctcg gtcgcttcgc caagtctcag tacaattacg cttacggtgc ctacgtcaag 540

cccgtcgccg ccgacggttc ccagtccctc acgcagaccc cctactggat catgaataac 600

gcgggcaccg aatacgaatt caacacattt tactgctgtg aactttgttg taatcctgcc 660

agtgctggaa gttataacac acaaatatat acgataaatg acaagatact atcatatacg 720

gaatcgatgg caggcaaaag agaaatggtt atcattacat ttaagagcgg cgaaacattt 780

caggtcgaag tcccgggcag tcaacatata gactcccaga aaaaagccat tgaaaggatg 840

aaggacacat taagaatcac atatctgacc gagaccaaaa ttgataaatt atgtgtatgg 900

aataataaaa cccccaattc aattgcggca atcagtatga aaaacactag tgccaatcag 960

acgaccttgc tgacggtgcc cgatatggcg ggcgggatcg gggcgatgta cacgtccctg 1020

cccgatacct ttatcgcgcc taccgggttc aaggaagata acacgaccaa cctttgcccg 1080

gtcgtcggca tgaacctgtt ccccacctac aataaaattt attaccaggc ggcgtccacg 1140

tacgtgcaac gcctggaaaa ttcctgccag tcggccacag ccgccttcaa ccgctttccc 1200

gaaaacgaga ttctgaagca agcgcccccc atgaatgttt cgtccgtgtg cgataaccaa 1260

cccgccgtcg ttcagcaggg tgtgttgcct gtgaagagct cgctccccgg actgcagcgc 1320

gtgctgatca cagacgacca gcgtcgtccg ataccctacg tgtataagtc tatcgcgacg 1380

gttcagccga ccgttctgag ttccgcgacc ttgcagatca ccaccattat tatcgttatc 1440

atcgttattc tgctgagcta a 1461

Claims

1. An isolated polypeptide comprising or consisting of an amino acid sequence as follows:

2. A nucleic acid molecule encoding the polypeptide of claim 1.

3. The nucleic acid molecule of claim 2, wherein the nucleotide sequence is set forth in SEQ ID NO 2.

4. Biological material comprising a nucleic acid molecule according to claim 2 or 3, said biological material being a recombinant DNA, an expression cassette, a transposon, a plasmid vector, a phage vector, a viral vector, an engineered bacterium or a transgenic cell line.

5. A composition comprising the polypeptide of claim 1 and a pharmaceutically acceptable carrier.

6. An immunogenic composition comprising the composition of claim 5.

A genetically engineered vaccine of avian adenovirus type 4, characterised in that it comprises the immunogenic composition of claim 6, optionally together with an adjuvant;

A process for preparing the genetically engineered vaccine of avian adenovirus type 8.4 includes such steps as preparing the recombinant baculovirus containing nucleic acid molecule as claimed in claim 2 or 3 by insect cell-baculovirus expression system, inoculating the harvested recombinant baculovirus to insect cell, culturing the transfected cell, treating the cell by pathological change, collecting the supernatant of cell culture, deactivating and purifying, and mixing it with adjuvant.

9. The method of claim 8, comprising the steps of:

(2) serum-free Sf9 cells cultured in suspension with a cell density of 2.0 × 10⁶～3.0×10⁶cells/ml, transfecting by using a recombinant shuttle plasmid bacmid, and harvesting culture supernatant after 72-96h after transfection when the cell viability is reduced to 60-80%, namely P0 generation recombinant baculovirus; sf9 cells were cultured to 4.0X 10 with Sf9 serum-free suspension medium⁶～8.0×10⁶cells/ml, cell density diluted to 2.0X 10 with fresh serum-free medium⁶～3.0×10⁶cells/ml, inoculating recombinant baculovirus according to the proportion of 1 per thousand-1%, culturing until 168-192h, harvesting supernatant, and detecting that the titer is not lower than 1:32, a first step of removing the first layer;

(3) inactivating and purifying the supernatant, taking 94-96 parts of the supernatant, adding tween-804-6 parts of the supernatant, stirring and dissolving the mixture to obtain a water phase, taking 94-96 parts of white oil and Span-804-6 parts of the white oil, uniformly mixing the white oil and Span-804-6 parts of the white oil to obtain an oil phase, taking 2 parts of the oil phase, adding 1 part of the water phase, and emulsifying the mixture for 20-40 min to obtain the oil-water emulsion; wherein the parts are parts by weight.

10. Use of a polypeptide according to claim 1, or a composition according to claim 5 or 6, or a genetically engineered vaccine according to claim 7, or a genetically engineered vaccine prepared according to the method of claim 8 or 9, in the manufacture of a medicament for the treatment or prevention of an avian adenovirus type 4 infection.