CN111548394A

CN111548394A - Fowl bursa virus gene engineering vaccine and its preparation method and use

Info

Publication number: CN111548394A
Application number: CN201911340057.5A
Authority: CN
Inventors: 岳建新; 袁野; 王飞; 孙灵睿; 周蕾蕾; 陈秋阁; 向王震; 张秀美; 李浩鹏; 李浩哲; 朱昊旻; 魏杰; 安铁军
Original assignee: Qyh Biotech Co ltd
Current assignee: Qyh Biotech Co ltd
Priority date: 2019-12-23
Filing date: 2019-12-23
Publication date: 2020-08-18

Abstract

The invention provides an avian bursal disease virus genetic engineering vaccine and a preparation method and application thereof. The invention expresses the avian bursal protective antigen VP2 protein through an insect cell-baculovirus expression system, so that avian bursal virus-like particles are formed on spatial conformation, and the gene engineering vaccine of the avian bursal virus is prepared by adding an adjuvant and emulsifying. The vaccine provided by the invention has the advantages of simple preparation method, short time consumption, high expression level, contribution to large-scale production and favorable immune effect of the obtained genetic engineering vaccine, and can be used for preparing a large amount of avian bursal disease virus antigen protein and effectively preventing the infection of the avian bursal disease virus.

Description

Fowl bursa virus gene engineering vaccine and its preparation method and use

Technical Field

The invention belongs to the field of biological products for livestock, and particularly relates to a gene engineering vaccine for a bursal disease virus of fowl, a preparation method and an application thereof.

Background

Infectious Bursal Disease (IBD) is an acute and highly-contact Infectious disease caused by IBDV (Infectious bursal disease virus), which mainly attacks lymphoid tissues of chicks and young chickens, especially central immune organs such as bursa of Fabricius and the like, can cause severe pathological damage to bursa of Fabricius tissues, further causes severe immunosuppression of organisms, is very easy to cause secondary infection or fails in immunization of various vaccines, and causes huge loss to the chicken industry.

IBDV belongs to the genus Bidservavirus of the family Bidservaviridae, the genome of which consists of two double-stranded RNA segments, respectively an A-segment and a B-segment, the A-segment consisting of about 3.3kb of nucleotides and containing 2 open reading frames, encoding respectively a precursor polyprotein (N-VP2-VP4-VP3-C) with a molecular weight of about 110ku and VP5, wherein the precursor proteins are modified by post-translational processing into mature VP2, VP3, VP4 proteins; the B fragment is about 2.9kb in length and encodes VP 1. The main structural protein VP2 is also the main component of the virus nucleocapsid, it has conformation dependent (discontinuous) neutralization antigenic determinant, the induced neutralizing antibody can passively protect the host from IBDV infection, it is the host protective antigen of IBDV, it is found that it has a large relationship with virus virulence variation, induction and recognition of protective antibody, antigen variation, induction of cell apoptosis, etc. Sequence analysis also found that the region with the largest difference in amino acid sequence between different strains of IBDV was found in VP2, where the amino acid changes in the region at position 206-350 were the largest, and was designated as the hypervariable region of IBDV; meanwhile, the reverse genetics technology finds that VP2 determines the cell tropism of IBDV, and the VP2 has important roles in the genetic variation, immune control and the like of IBDV as an important structural protein, an antigen hypervariable region, a virulence protein and a protective antigen of IBDV.

At present, IBD is prevented mainly by traditional attenuated and inactivated vaccines, and the occurrence of variant strains and ultra-virulent strains often causes immune failure. At present, related researchers develop genetic engineering vaccines based on expression systems such as escherichia coli, recombinant turkey herpesvirus, yeast, fowlpox virus, and the like. However, the VP2 protein expressed by Escherichia coli mostly exists in the form of inclusion bodies and needs to be denatured and renatured, but the epitope of IBDV has conformation dependency, the denatured and renatured VP2 protein loses the ability of inducing chicken neutralizing antibodies, and in addition, the VP2 antigen expressed by Escherichia coli often has the problem of high endotoxin, which causes the chicken to easily generate large side reaction. The recombinant live vector vaccine not only has safety problems in laboratories and production processes, but also has higher probability of gene mutation and recombination as common live vaccines.

Therefore, the production method for developing the gene engineering vaccine of the avian bursal disease virus with low production cost, high production efficiency and good immunogenicity has important practical significance.

Disclosure of Invention

The invention aims to provide an avian bursal disease virus genetic engineering vaccine, a preparation method and application thereof.

To achieve the object of the present invention, in a first aspect, the present invention provides an isolated polypeptide comprising or consisting of an amino acid sequence as follows:

i) an amino acid sequence shown as SEQ ID NO. 1 of the protein VP2 from the avian bursal disease virus; or

ii) an amino acid sequence obtained by connecting a label at the N end and/or the C end of the i); or

iii) the amino acid sequence of i) or ii) is substituted, deleted and/or added with one or more amino acids to obtain the polypeptide with the same function.

In a second aspect, the invention provides a nucleic acid molecule encoding said polypeptide. The nucleotide sequence is shown in SEQ ID NO. 2.

In a third aspect, the present invention provides biological materials containing the nucleic acid molecules, including but not limited to recombinant DNA, expression cassettes, transposons, plasmid vectors, phage vectors, viral vectors, engineered bacteria, transgenic cell lines, or the like.

In a fourth aspect, the invention provides a composition comprising said polypeptide and a pharmaceutically acceptable carrier.

In a fifth aspect, the present invention provides an immunogenic composition comprising the above composition.

In a sixth aspect, the invention provides an engineered vaccine for avian bursal disease virus comprising the immunogenic composition, optionally comprising an adjuvant.

Preferably, the adjuvant is a veterinary acceptable oily adjuvant, including white oil, Span-80, tween.

In a seventh aspect, the invention provides a method for preparing an avian bursal disease virus genetic engineering vaccine, which comprises the steps of preparing a recombinant baculovirus containing a nucleic acid molecule encoding the avian bursal disease virus VP2 protein shown as SEQ ID NO. 1 by using an insect cell-baculovirus expression system, inoculating the harvested recombinant baculovirus into an insect cell, culturing the transfected cell, collecting cell culture supernatant after the cell is diseased, inactivating and purifying the supernatant, and mixing the supernatant with an adjuvant.

In one embodiment of the present invention, the aforementioned method comprises the steps of:

(1) after synthesizing a target gene fragment shown as SEQ ID NO. 2, carrying out double enzyme digestion on a pMD19-T carrier containing the target gene fragment and a pFastBac 1 carrier respectively, and carrying out gel recovery; connecting the target gene fragment with a pFastBac 1 vector overnight by using T4 DNA ligase, transforming into DH5 alpha competent cells, and extracting the pFastBac 1 vector containing the target gene after the sequencing is correct; transforming a pFastBac 1 vector containing a target gene into DH10Bac, and selecting white spots by a blue-white spot screening method; inoculating the white spots into a liquid culture medium containing kanamycin, gentamicin and tetracycline for overnight culture; collecting bacterial liquid, extracting DNA of the recombinant shuttle plasmid bacmid and carrying out sequencing identification on the recombinant shuttle plasmid bacmid;

(2) taking Sf9 cells cultured in serum-free suspension, wherein the cell density is 2.0 × 10⁶～3.0×10⁶cells/ml (preferably 2.5 × 10)⁶cells/ml), transfecting by a recombinant shuttle plasmid bacmid, harvesting culture supernatant when the cell viability is reduced to 60-80% within 72-96h after transfection, namely P0 generation recombinant baculovirus, and culturing Sf9 cells to 4.0 × 10 by using Sf9 serum-free suspension medium⁶～8.0×10⁶cells/ml (preferably 5.0 × 10)⁶cells/ml), cell density was diluted to 2.0 × 10 with fresh serum-free medium⁶～3.0×10⁶cells/ml (preferably 2.5 × 10)⁶cells/ml) is inoculated with recombinant baculovirus according to the proportion of 1 per thousand-1 percent, the culture is carried out until 168-192h is added, and supernatant is obtained, and the titer is detected to be not lower than 1:32, a first step of removing the first layer;

(3) inactivating and purifying the supernatant, taking 94-96 parts of the supernatant, adding tween-804-6 parts of the supernatant, stirring for dissolving, taking the supernatant as a water phase, taking 94-96 parts of white oil and Span-804-6 parts of the white oil, uniformly mixing, taking 2 parts of an oil phase as an oil phase, adding 1 part of the water phase, and emulsifying for 20-40 min (preferably, 96 parts of the supernatant, adding tween-804 parts of the white oil, stirring for dissolving, taking the water phase, taking 94 parts of the white oil and Span-806 parts of the white oil, uniformly mixing, taking 2 parts of the oil phase, adding 1 part of the water phase, and emulsifying for 30 min).

In the invention, the parts are parts by weight.

In step (3), ethyleneimine may be used as the inactivation supernatant.

In the present invention, the culture medium for Sf9 cells was purchased from Shanghai culture Biotech GmbH, InsectProSF9/SF21 insect cell serum-free medium, Cat H810 KJ.

In an eighth aspect, the invention provides an application of the polypeptide, or a composition containing the polypeptide, or the genetic engineering vaccine prepared according to the method in preparing a medicament for treating or preventing the infection of the poultry bursal disease virus.

In a ninth aspect, the invention provides the application of the polypeptide, or a composition containing the polypeptide, or the genetic engineering vaccine prepared according to the method in treating or preventing the bursal disease virus infection of the poultry.

By the technical scheme, the invention at least has the following advantages and beneficial effects:

the genetic engineering vaccine provided by the invention is used for immunizing SPF (specific pathogen free) chickens of 14 days, and serum antibodies which meet the regulation standard can be generated after immunization for 28 days through serum antibody detection, and can resist the virulent attack of the poultry bursal disease virus. The invention expresses the fowl bursal disease virus VP2 protein by using an insect cell-baculovirus expression system, has high protein yield and high purity, and has stronger antigen immunity and higher safety when being used for preparing vaccines.

Drawings

FIG. 1 shows healthy Sf9 cells (left) compared with diseased cells (right) in example 2 of the present invention.

FIG. 2 shows the result of SDS-PAGE electrophoresis of the target protein in example 2 of the present invention.

FIG. 3 is a virus-like particle (VLP) observed under an electron microscope in example 2 of the present invention.

FIG. 4 shows the result of the detection of the antigen agar titer in example 2 of the present invention.

Detailed Description

The invention provides a genetic engineering vaccine for preventing poultry bursal disease, and the used antigen is inactivated recombinant antigen protein VP 2.

The specific scheme is as follows:

the invention firstly provides an avian bursal disease virus protective antigen and a coding gene thereof, wherein the amino acid sequence of the protective antigen is shown as SEQ ID NO. 1, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 2.

Researches show that the baculovirus with the protective antigen coding gene is constructed to infect Sf9 cells, so that the Sf9 cells can efficiently express the protective antigen, the protective antigen generated by expression is collected and purified to prepare the genetic engineering subunit vaccine, the defects of the conventional bursal disease virus antigen production aspect can be effectively overcome, and the obtained vaccine has good immunogenicity.

Furthermore, the invention provides the application of the protective antigen and the coding gene thereof in preparing the vaccine for the bursal disease virus of fowl; the vaccine is preferably a genetically engineered subunit vaccine.

The preparation method of the vaccine can adopt the preparation method of the genetic engineering subunit vaccine which is conventional in the field.

Preferably, the preparation method comprises:

the pMD19-T vector containing the target gene is subjected to double enzyme digestion by Bam HI and Hind III to obtain a target fragment, and the target fragment is recovered and purified by glue. And simultaneously carrying out double enzyme digestion on the pFastBac 1 carrier and recovering glue. The gene fragment of interest was ligated to the pFastBac 1 vector overnight using T4 DNA ligase. Then transformed into DH5 alpha competent cells, cultured by a strain and then sequenced. After the sequencing is correct, the pFastBac 1 vector containing the target gene is extracted.

The pFastBac 1 vector containing the target gene is transformed into DH10Bac, the transformed product is cultured in SOC culture medium at 37 ℃ for 5h, diluted and inoculated with a blue-white spot screening plate, cultured at 37 ℃ for 48h, and then white spots are selected. Inoculating white spots into liquid culture medium containing kanamycin, gentamicin and tetracycline for overnight culture. Collecting bacterial liquid, extracting recombinant shuttle plasmid bacmid DNA, and sequencing and identifying the recombinant bacmid by using pUC/M13 forward and reverse primers (M13F: GTTTTCCCAGTCACGAC, M13R: CAGGAAACAGCTATGAC). The sequencing results are completely correct in alignment.

Serum-free suspension cultured sf9 cells are taken, and the cell density is 2.5 × 10⁶cells/ml inThe suspension transfection was carried out in a 125ml shake flask with a culture volume of 25ml, and 12.5. mu.g of recombinant Bacmid and 30ul of insect cell line cell transfection reagent were diluted with Opti-MEM, mixed well, added to sf9 cell suspension, and cultured in a shaker at 27 ℃ and 120 rpm. And (3) harvesting culture supernatant 72-96h after transfection when the cell viability is reduced to 60-80%, namely P0 generation baculovirus.

Sf9 cells were cultured to 5 × 10 using Sf9 serum-free suspension medium⁶cells/ml, cell density diluted to 2.5 × 10 with fresh serum-free medium⁶cells/ml, inoculating baculovirus according to the proportion of 1 per thousand-1%, culturing until 168-192h, and harvesting culture supernatant. And (3) carrying out SDS electrophoresis to identify the molecular weight of the protein, observing whether virus-like particles are formed or not by using an electron microscope, and detecting the amplification potency of the protein. And then the inactivated vaccine can be used for preparing subunit inactivated vaccines for the avian bursal disease virus and preventing the avian bursal disease virus by process purification treatment and addition of corresponding adjuvants.

It is understood that the avian bursal disease virus vaccine prepared by using the coding gene of the invention or the avian bursal disease virus vaccine containing the protective antigen of the invention belongs to the protection scope of the invention.

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise indicated, the examples follow conventional experimental conditions, such as the Molecular Cloning handbook, Sambrook et al (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual,2001), or the conditions as recommended by the manufacturer's instructions. EXAMPLE 1 preparation of Gene engineering vaccine for avian bursal disease Virus

1. Screening and cloning of target genes

Searching the coding gene sequence and the protein sequence of the avian bursal disease virus VP2 protein, and carrying out sequencing comparison on the RNA extracted from the existing virus.

Checking and optimizing restriction enzyme cutting sites in the obtained sequence to ensure that the restriction enzyme cutting sites do not contain BamHI and Hind III cutting sites.

A pair of primers for amplifying the gene fragment VP2 of the avian bursa virus is designed by Primer5.0 software, and protective bases and enzyme cutting sites are added at the 5 'end of an upstream primer and the 5' end of a downstream primer. The primer sequence is as follows:

VP2-BamH Ⅰ-F：CGCGGATCCATGACAAACCTGCAAGATCA

VP2-Hind III-R：CCCAAGCTTTTAGCGCCTTAGGGCCCGGA

the synthesized sequence was PCR-amplified using pfu enzyme in a system of 50. mu.L 10 × PCR Buffer 5. mu.L, dNTP (10 mM each) 1. mu.L, upstream and downstream primers (10nM) 1. mu.L each, synthetic DNA 1. mu.L, pfu enzyme 1. mu.L, ddH₂O40μL。

PCR reaction parameters: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 58 ℃ for 30s, 72 ℃ for 120 s; 7min at 72 ℃.

The product was detected by agarose gel electrophoresis and had a single bright band at a position slightly less than 1400 bp. The products were recovered and sequenced using a DNA product recovery kit and the alignment found to be in full agreement with the expectations.

2. Construction and expression of VP2 recombinant protein

And carrying out double enzyme digestion on the recovered target sequence and the pFastBac 1 vector respectively, and recovering fragments. The concentration of the fragment of interest with the pFastBac 1 vector was estimated and was calculated as 1: 4, and adding T4 Buffer and T4 ligase, and carrying out enzyme reaction at 16 ℃ overnight. And transforming the ligation product into escherichia coli DH5 alpha competence, extracting a pFastBac 1 vector containing a target gene and transforming the pFastBac 1 vector into DH10Bac after the plasmid is completely verified, and screening out positive clones by a blue-white spot screening method.

Taking Sf9 cells cultured in serum-free suspension, wherein the cell density is 2.5 × 10⁶cells/ml, suspension transfection in 125ml shake flask, culture volume 25ml, using Opti-MEM to dilute 12.5. mu.g recombinant Bacmid and 30ul insect cell line cell transfection reagent, mixing, adding Sf9 cell suspension, culturing at 27 deg.C, 120rpm shaking table. And (5) harvesting culture supernatant 96h after transfection when the cell viability is reduced to 60%, namely P0 generation baculovirus.

Sf9 cells were cultured to 5 × 10 using Sf9 serum-free suspension medium⁶cells/ml, cell density diluted to 2.5 × 10 with fresh serum-free medium⁶cells/ml, inoculating baculovirus according to the proportion of 1 per thousand, culturing for 168h, and harvesting culture supernatant. SDS electrophoresis is carried out to identify the molecular weight and the electron of the proteinAnd (5) observing whether virus-like particles are formed or not by using a microscope, and detecting the protein agar amplification titer.

3. Emulsification and preparation of genetic engineering vaccine

Harvesting culture supernatant with agar expansion titer not less than 1:32, adding 3mM final concentration of ethyleneimine, inactivating at 30 ℃ for 28h, taking 96 parts of supernatant, adding 4 parts of Tween-80, stirring to dissolve, taking as water phase, taking 94 parts of white oil and 806 parts of Span, uniformly mixing, taking as oil phase, taking 2 parts of oil phase, slowly adding 1 part of water phase, emulsifying at 3000rpm for 30 minutes, preparing the avian bursa virus genetic engineering vaccine (subunit vaccine), and storing at 4 ℃.

Example 2 expression characteristics and immunogenicity of avian bursal disease Virus genetically engineered vaccines

1. Expression characteristics

Sf9 cells were cultured to 5 × 10 using Sf9 serum-free suspension medium⁶cells/ml, cell density diluted to 2.5 × 10 with fresh serum-free medium⁶cells/ml, inoculating recombinant baculovirus according to the proportion of 1 per mill, culturing for 96h, and harvesting supernatant. Cells at 96h post-infection showed a marked expansion compared to healthy cells (FIG. 1). The virus titer is determined by the plaque method, and the virus titer of the recombinant baculovirus P1 generation is 10^8.5TCID₅₀/ml。

Sf9 cells were cultured to 5 × 10 using Sf9 serum-free suspension medium⁶cells/ml, cell density diluted to 2.5 × 10 with fresh serum-free medium⁶cells/ml, inoculating recombinant baculovirus according to the proportion of 1 per thousand, culturing for 168h, and harvesting culture supernatant. SDS-PAGE electrophoresis is carried out to identify the molecular weight of the VP2 protein to be about 48KD (figure 2), the virus-like particles are formed by observation and confirmation of an electron microscope (figure 3), and the protein agarose titer is detected to be 1:32 (fig. 4).

2. Immunogenicity

Immunization of 14-day-old SPF chickens with the subunit vaccine prepared in example 1, 28 days after immunization, as measured by serum antibodies, produced serum antibodies meeting the regulatory standards and were able to resist challenge by the avian bursa virus virulent T2/CH strain (H.J.Liu, Molecular characterization of viral infection in viral disease Taiwan [ J ]. Research in scientific Science,2001(70):139-147) (Table 1).

TABLE 1 results of antibody detection by immunization for 28 days

The inactivated vaccine is prepared by inactivating virus liquid of chicken infectious bursal disease T2/CH strain with formaldehyde to obtain virus titer 1.5 × 10⁸PFU/ml, final concentration of formaldehyde is 0.1%, inactivating at 37 deg.C for 18h, and subsequent preparing seedling process isogenetic engineering seedling.

The toxin counteracting method comprises the following steps: selecting good SPF (specific pathogen free) chickens, 10 SPF chickens in a control group, immune poultry bursa genetic engineering vaccine and 28 days after the commercial inactivated vaccine of the immune poultry bursa, inoculating and detoxifying the vaccine on nose drops and bursa cavities, observing and recording morbidity and death conditions day by day, observing to 96-120 h, killing and storing live chickens, dissecting all chickens, and observing bursal disease, wherein the chickens used in the control group test should have at least 8/10 morbidity, and have obvious infectious bursal disease (at least one disease such as bursal swelling, bleeding, yellowing and containing jelly secretion and the like), the immune chickens are at least 8/10 normal, the relative protection rate is not less than 80%, and the test results are shown in table 2:

TABLE 2 post-immunization 28-day challenge results

Note: dead chickens are marked as "Dn" where n represents the number of days of death.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> Qianyuan Haoyao organism GmbH

<120> avian bursal disease virus genetic engineering vaccine and preparation method and application thereof

<130>KHP191116879.3

<160>2

<170>SIPOSequenceListing 1.0

<210>1

<211>573

<212>PRT

<213> Infectious bursal disease virus (Infectious bursal disease virus)

<400>1

Met Thr Asn Leu Gln Asp Gln Thr Gln Gln Ile Val Pro Phe Ile Arg

1 5 10 15

Ser Leu Leu Met Pro Thr Thr Gly Pro Ala Ser Ile Pro Asp Asp Thr

20 25 30

Leu Glu Lys His Thr Leu Arg Ser Glu Thr Ser Thr Tyr Asn Leu Thr

35 40 45

Val Gly Asp Thr Gly Ser Gly Leu Ile Val Phe Phe Pro Gly Phe Pro

50 55 60

Gly Ser Ile Val Gly Ala His Tyr Ile Leu Gln Ser Asn Gly Asn Tyr

65 70 75 80

Lys Phe Asp Gln Met Leu Leu Thr Ala Gln Asn Leu Pro Ala Ser Tyr

85 90 95

Asn Tyr Cys Arg Leu Val Ser Arg Ser Leu Thr Val Arg Ser Ser Thr

100 105 110

Leu Pro Gly Gly Val Tyr Ala Leu Met Thr Asn Leu Gln Asp Gln Thr

115 120 125

Gln Gln Ile Val Pro Phe Ile Arg Ser Leu Leu Met Pro Thr Thr Gly

130 135 140

Pro Ala Ser Ile Pro Asp Asp Thr Leu Glu Lys His Thr Leu Arg Ser

145 150 155 160

Glu Thr Ser Thr Tyr Asn Leu Thr Val Gly Asp Thr Gly Ser Gly Leu

165 170 175

Ile Val Phe Phe Pro Gly Phe Pro Gly Ser Ile Val Gly Ala His Tyr

180 185 190

Ile Leu Gln Ser Asn Gly Asn Tyr Lys Phe Asp Gln Met Leu Leu Thr

195 200 205

Ala Gln Asn Leu Pro Ala Ser Tyr Asn Tyr Cys Arg Leu Val Ser Arg

210 215 220

Ser Leu Thr Val Arg Ser Ser Thr Leu Pro Gly Gly Val Tyr Ala Leu

225 230 235 240

Asn Gly Thr Ile Asn Ala Val Thr Phe Gln Gly Ser Leu Ser Glu Leu

245 250 255

Thr Asp Val Ser Tyr Asn Gly Leu Met Ser Ala Thr Ala Asn Ile Asn

260 265 270

Asp Lys Ile Gly Asn Val Leu Ile Gly Glu Gly Val Thr Val Leu Ser

275 280 285

Leu Pro Thr Ser Tyr Asp Leu Gly Tyr Val Arg Leu Gly Asp Pro Ile

290 295 300

Pro Ala Ile Gly Leu Asp Pro Lys Met Val Ala Thr Cys Asp Ser Ser

305 310 315 320

Asp Arg Pro Arg Val Tyr Thr Ile Thr Ala Ala Asn Asp Tyr Gln Phe

325 330 335

Ser Ser Gln Tyr Gln Ala Gly Gly Val Thr Ile Thr Leu Phe Ser Ala

340 345 350

Asn Ile Asp Ala Ile Thr Ser Leu Ser Ile Gly Gly Glu Leu Val Phe

355 360 365

Gln Thr Ser Val Gln Gly Leu Ile Leu Gly Ala Thr Ile Tyr Leu Ile

370 375 380

Gly Phe Asp Gly Thr Ala Val Ile Thr Arg Ala Val Ala Ala Asp Asn

385 390 395 400

Gly Leu Thr Ala Gly Thr Asp Asn Leu Met Pro Phe Asn Ile Val Ile

405 410 415

Pro Thr Ser Glu Ile Thr Gln Pro Ile Thr Ser Ile Lys Leu Glu Ile

420 425 430

Val Thr Ser Lys Ser Gly Gly Gln Ala Gly Asp Gln Met Ser Trp Ser

435 440 445

Ala Ser Gly Ser Leu Ala Val Thr Ile His Gly Gly Asn Tyr Pro Gly

450 455 460

Ala Leu Arg Pro Val Thr Leu Val Ala Tyr Glu Arg Val Ala Thr Gly

465 470 475 480

Ser Val Val Thr Val Ala Gly Val Ser Asn Phe Glu Leu Ile Pro Asn

485 490 495

Pro Glu Leu Ala Lys Asn Leu Ile Thr Glu Tyr Gly Arg Phe Asp Pro

500 505 510

Gly Ala Met Asn Tyr Thr Lys Leu Ile Leu Ser Glu Arg Asp Arg Leu

515 520 525

Gly Ile Lys Thr Val Trp Pro Thr Arg Glu Tyr Thr Asp Phe Arg Glu

530 535 540

Tyr Phe Met Glu Val Ala Asp Leu Asn Ser Pro Leu Lys Ile Ala Gly

545 550 555 560

Ala Phe Gly Phe Lys Asp Leu Ile Arg Ala Leu Arg Arg

565 570

<210>2

<211>1362

<212>DNA

<213> Infectious bursal disease virus (Infectious bursal disease virus)

<400>2

atgacaaacc tgcaagatca aacccaacag attgttccgt tcatacggag ccttctgatg 60

ccaacaaccg gaccggcgtc cattccggac gacaccctag agaagcacac tctcaggtca 120

gagacctcga cctacaattt gactgtgggg gacacagggt cagggctaat tgtctttttc 180

cctggtttcc ctggctcaat tgtgggtgct cactacatac tgcagagcaa tgggaactac 240

aagttcgatc agatgctcct gacggcccag aaccttccgg ccagctacaa ctactgcagg 300

ctagtgagtc ggagtctcac agtgaggtca agcacacttc ctggtggcgt atatgcacta 360

aacggaacca taaacgccgt gaccttccaa ggaagcctga gtgaactgac agatgttagc 420

tacaatgggt tgatgtctgc aacagccaac atcaacgaca aaatcgggaa cgtcctaata 480

ggggaaggag tgactgttct cagcttaccc acatcatatg accttgggta tgtgagactc 540

ggtgacccta ttcccgctat agggctcgac ccaaaaatgg tagcaacatg tgacagcagt 600

gacaggccca gagtctacac cataactgca gccaatgatt accagttctc atcacagtac 660

caagcaggtg gagtaacaat cacactgttc tcagctaaca tcgatgccat cacaagcctc 720

agcatcgggg gagaacttgt gttccaaaca agcgtccaag gcctcatact gggtgctacc 780

atctacctta taggctttga tgggactgca gtaatcacta gagctgtggc tgcggacaac 840

gggctaacgg ccggcactga caaccttatg ccattcaata tcgtgattcc gaccagcgag 900

ataacccagc caatcacatc cattaaactg gagatagtga cctccaaaag tggtggtcag 960

gcgggtgacc agatgtcatg gtcagcaagt gggagcctag cagtgacgat ccacggtggc 1020

aactatccag gagccctccg tcccgtcaca ctagtagcct acgaaagagt ggcaacagga 1080

tctgtcgtta cggtcgccgg ggtgagtaac ttcgagctga tcccgaatcc tgaactagca 1140

aagaacctga tcacagaata tggccgattt gacccaggag ctatgaacta cacaaaattg 1200

atattgagtg agagggaccg tcttggtatc aagactgtat ggccaacaag ggagtacact 1260

gactttcgcg agtacttcat ggaggtggcc gacctcaact ctcccctgaa gattgcagga 1320

gcatttgggt ttaaagacct aatccgggcc ctaaggcgct aa 1362

Claims

1. An isolated polypeptide comprising or consisting of an amino acid sequence as follows:

2. A nucleic acid molecule encoding the polypeptide of claim 1.

3. The nucleic acid molecule of claim 2, wherein the nucleotide sequence is set forth in SEQ ID NO 2.

4. Biological material comprising a nucleic acid molecule according to claim 2 or 3, said biological material being a recombinant DNA, an expression cassette, a transposon, a plasmid vector, a phage vector, a viral vector, an engineered bacterium or a transgenic cell line.

5. A composition comprising the polypeptide of claim 1 and a pharmaceutically acceptable carrier.

6. An immunogenic composition comprising the composition of claim 5.

7. An engineered vaccine of avian bursal virus comprising the immunogenic composition of claim 6, optionally comprising an adjuvant;

8. A method for preparing a genetically engineered vaccine against avian bursal disease virus, characterized in that a recombinant baculovirus containing the nucleic acid molecule of claim 2 or 3 is prepared using an insect cell-baculovirus expression system, the harvested recombinant baculovirus is inoculated to insect cells, transfected cells are cultured, after cytopathic effect, cell culture supernatant is collected, and the supernatant is inactivated and purified, and then mixed with an adjuvant.

9. The method of claim 8, comprising the steps of:

(1) after synthesizing a target gene fragment shown as SEQ ID NO. 2, carrying out double enzyme digestion on a pMD19-T carrier containing the target gene fragment and a pFastBac 1 carrier respectively, and carrying out gel recovery; connecting the target gene fragment with a pFastBac 1 vector overnight by using T4 DNA ligase, transforming into DH5 alpha competent cells, and extracting the pFastBac 1 vector containing the target gene fragment after correct sequencing; transforming a pFastBac 1 vector containing a target gene fragment into DH10Bac, and selecting white spots by a blue-white spot screening method; inoculating the white spots into a liquid culture medium containing kanamycin, gentamicin and tetracycline for overnight culture; collecting bacterial liquid, extracting DNA of the recombinant shuttle plasmid bacmid and carrying out sequencing identification on the recombinant shuttle plasmid bacmid;

(2) taking Sf9 cells cultured in serum-free suspension, wherein the cell density is 2.0 × 10⁶～3.0×10⁶cells/ml, transfecting by using a recombinant shuttle plasmid bacmid, harvesting culture supernatant after 72-96h after transfection when the cell viability is reduced to 60-80%, namely P0 generation recombinant baculovirus, and culturing Sf9 cells to 4.0-8.0 × 10 by using Sf9 serum-free suspension medium⁶cells/ml, cell density diluted to 2.0 × 10 with fresh serum-free medium⁶～3.0×10⁶cells/ml, inoculating recombinant baculovirus according to the proportion of 1 per thousand-1%, culturing until 168-192h, harvesting supernatant, and detecting that the titer is not lower than 1:32, a first step of removing the first layer;

(3) inactivating and purifying the supernatant, taking 94-96 parts of the supernatant, adding tween-804-6 parts of the supernatant, stirring and dissolving the mixture to obtain a water phase, taking 94-96 parts of white oil and Span-804-6 parts of the white oil, uniformly mixing the white oil and Span-804-6 parts of the white oil to obtain an oil phase, taking 2 parts of the oil phase, adding 1 part of the water phase, and emulsifying the mixture for 20-40 min to obtain the oil-in-water emulsion; wherein the parts are parts by weight.

10. Use of a polypeptide according to claim 1, or a composition according to claim 5 or 6, or a genetically engineered vaccine according to claim 7, or a genetically engineered vaccine prepared according to the method of claim 8 or 9, for the manufacture of a medicament for the treatment or prevention of an infection by an avian bursal disease virus.