CN106497893A

CN106497893A - The recombinant herpesvirus of turkeys strain rHMW and construction method of expression H7N9 subtype avian influenza virus mosaic type hemagglutinins

Info

Publication number: CN106497893A
Application number: CN201610968279.1A
Authority: CN
Inventors: 刘秀梵; 何东昌; 郝小利; 顾敏; 胡娇; 王晓泉; 刘晓文; 胡顺林
Original assignee: Yangzhou University
Current assignee: Yangzhou University
Priority date: 2016-10-28
Filing date: 2016-10-28
Publication date: 2017-03-15

Abstract

The invention belongs to the recombinant viral vector vaccine of molecular biology and biological technical field, specifically related to a kind of recombinant herpesvirus of turkeys strain rHMW of expression H7N9 subtype avian influenza virus mosaic type hemagglutinins and construction method, recombinant herpesvirus of turkeys strain rHMW, its preserving number CGMCC NO.12984.The recombinant virus can be used for the vaccine for preparing prevention H7N9 subtype avian influenza virus.The present invention serves remarkable effect for the infectious disease prevention and control of poultry, while having played huge Social benefit and economic benefit.

Description

The recombinant turkey bleb of expression H7N9 subtype avian influenza virus mosaic type hemagglutinins Strain rHMW and construction method

Technical field

The invention belongs to the recombinant viral vector vaccine of molecular biology and biological technical field, and in particular to one kind can The recombinant herpesvirus of turkeys rHMW of expression tool H7N9 subtype avian influenza virus mosaic type hemagglutinins, the recombinant virus can use Prevent the purposes in H7N9 subtype avian influenza virus in immune poultry.

Background technology

Yangtze River Delta Area of the H7N9 subtype avian influenzas of infection people in 2013 first in China East China is broken out, and is one plant three The new avian influenza virus of source restructuring, or low pathogenicity not pathogenic to poultry.The whole nation has been diffused to up to now except Tibet and All regions outside Inner Mongolia Autonomous Region, Zhujiang River trigonum are the another new outburst plague areas behind Yangtze River Delta Area.According to The statistics of WHO shows, by the end of on June 13rd, 2016, one had a case that 781 people infect H7N9, wherein dead 313 people, The death rate is 40% or so.According to the follow-up report of flutracters, by the end of in July, 2016, the case of H7N9 infection people is Through breaking through 800.Its growth rate is pressed on towards and has been up to 851 since 2003 with messenger's infection H5 subtype avian influenza quantity, by The quantity growth of this visible people's infection H7N9 is swift and violent, and sanitarian harm should not be underestimated.As poultry infection is not sent out Disease, has the popular medical history contacted with current the case of infection more, and therefore, the H7N9 epidemic situations state of live-bird market poultry has directly Affect public health security.According to epidemiology survey, the peak season of people infection H7N9 is also ceased with the regularty of epidemic breath of poultry Related.Therefore need the vaccine of development of new badly to protect poultry, reduce epidemic situation to public harm.But clinic there is no pin at present The such disease of prevention and control is used for the poultry vaccine of H7N9.

Herpes turkey virus (Herpesvirus of Turkey, HVT) is a kind of α herpesvirals of typical no pathogenicity. Because HVT has correlation on science of heredity and serology with Marek's disease poison (Marek's disease virus, MDV), from Since 1970, HVT Fc-126 strains are widely used as MD vaccines.The vaccine have will not cause tumorigenesis occur, protection effect Fruit persistently exists well, in vivo, can be lyophilized, be easy to many advantages, such as storing and transport, and plays during the prevention and control of MD Important effect.In recent years, the research in terms of HVT is as viral vectors achieves many progress, because of HVT and other avian viruseses Carrier is compared with many unique advantages, including：, to chicken and other animal no pathogenicities, security is good for HVT；Can be in animal body Inside persistently there is, be conducive to the continuous expression of foreign gene, stimulate body to produce higher antibody horizontal；HVT can cause high-strength The cell-mediated immune response of degree, immunity appearance morning, duration length, inoculation once can reach semelincident immunization；HVT restructuring epidemic diseases Seedling has low production cost, can be lyophilized, be easy to store and transport；HVT has very strong cell binding characteristics, virus in cell Between propagate, therefore as recombinant vaccine, [Bublot, M., et al., the Use of a such as interference of maternal antibody can be broken through vectored vaccine against infectious bursal disease of chickens in the face of high-titred maternally derived antibody.J Comp Pathol,2007.137Suppl 1:p.S81- 4.].At present, multiple poultry diease protective antigens such as infectious bursa of Fabricius virus successful expression in HVT carriers [Tsukamoto,K., et al.,Complete,Long-Lasting Protection against Lethal Infectious Bursal Disease Virus Challenge by a Single Vaccination with an Avian Herpesvirus Vector Expressing VP2Antigens.Journal of Virology,2002.76 (11):p.5637-5645.].The VaxxitexRHVT+IBD recombinant vaccines for applying above-mentioned level to prepare have obtained production and have been permitted Can, become the animal derived vaccine with herpesviral as carrier of commercialization, make HVT become the virus load of most DEVELOPMENT PROSPECT Body.Its technological core utilizes homologous recombination principle：Relative with HVT genomes by the nonessential region homology arm of foreign gene both sides Section is answered to carry out Homo~logous exchange, so as to by foreign gene quiding gene group.Morgan in 1992 et al. is first using homologous heavy Group method constructs the recombinant hvt of expression NDV (F) gene, and the recombinant virus can resist the attack of lethal MDV, and can be pre- Anti- ewcastle disease, its protective rate are close to protected effect [Morgan, R.W., et al., the Protection of of traditional vaccine chickens from Newcastle and Marek's diseases with a recombinant herpesvirus of turkeys vaccine expressing the Newcastle disease virus fusion protein.Avian Dis,1992.36(4):p.858-70.].Later, Gao et al. used said method by AIV H5N1 (HA) gene is inserted in the different position of HVT genomes, constructs two plants of rHVT recombinant viruses, and vaccine test shows this two plants Recombinant virus can resist AI and MD [Gao, H., et al., Expression of HA of HPAI H5N1Virus simultaneously at US2Gene Insertion Site of Turkey Herpesvirus Induced Better Protection than That at US10Gene Insertion Site.PLoS ONE,2011.6(7):p.e22549.].

Internal promoter has the maternal antibody interference effect overcome for antigen.The transcription and translation of MDV genes, be Strictly regulated and controled.Such as when virus infected cell, the expression of viral gene is divided into 3 periods：Immediately early stage, sooner or later the phase and Late period.But, during with MDV construction of recombinant virus, heterologous strong promoter is subject to the regulation and control of virus less, in recombinant virus immunity Early stage, the promoter protects antigen gene great expression controllyyed, with body in occur for the maternal antibody of the antigen Reaction so that the maternal antibody for the antigen declines, so as to reduce early protection of the body to certain disease.Sonoda etc. (Sonoda,Kengo,et al."Development of an effective polyvalent vaccine against both Marek's and Newcastle diseases based on recombinant Marek's disease virus type 1in commercial chickens with maternal antibodies."Journal of virology 74.7(2000):3217-3226.) using the gB promoter construction of recombinant virus of MDVI types itself, express NDV's F genes, immune commercial chicken, it is provided that 100% protection, meanwhile, have no effect on the stability of recombinant virus.Therefore, enter one Step confirms that the gB promoters of MDV I types itself are strictly regulated and controled, and can avoid the interference of maternal antibody, it is ensured that immunity Protection.

Affect the factor of foreign gene expression levels a lot, and the selection of codon is one of wherein important parameter, base Because there is strong correlation between usage degree of the expression with hobby codon.Each amino acid averagely have three corresponding close Numeral, this allow different nucleotide sequences to encode out identical amino acid sequence, and encode the difference with monoamino-acid Usage frequency of the codon in different biologies and different genes have significant difference, this is corresponding with cell The concentration of tRNA is proportionate.What usage frequency was extremely low is exactly the rare codon of the species or gene, rare codon Use it is verified that for hinder gene expression a key factor, therefore remove rare codon can significantly improve The translation speed of one gene.Each species has corresponding partially thermophilic codon, therefore in order to improve foreign gene in a thing Internal translation and expression is planted, usually external source gene codon is transformed, the codon for being allowed to meet the species is inclined Thermophilic distribution.Jiang(Jiang,Yongping,et al."Enhanced protective efficacy of H5subtype avian influenza DNA vaccine with codon optimized HA gene in a pCAGGS plasmid vector."Antiviral research 75.3(2007):234-241.) et al. the HA codon optimizations (optiHA) to H5 Immunity SPF chickens on eukaryon expression plasmid pCAGGS are inserted into, the optiHA after optimization can significantly improve H5 subtype avian influenza DNA Vaccine-induced protection antibody immune response level, strengthens immune protective effect.

The histocompatibility complex (major histocompatibility complex, MHC) of chicken is also called B and is combined Body (Bcomplex), mainly by B-F, the gene loci composition of B-L and each office's functions of B-G tri-.Antigen coded by wherein B-F Being structurally and functionally analogous respectively to the mhc class i antigen of mammal, and it is present in all of intracellular.Mhc class i point Son is combined with intracellular antigen protein, and epitope is by submission to cell surface, while can also stimulate the pathogen recognition of II molecules of MHC Reaction.According to document report, the N-terminal in exogenous antigen adds I ss of MHC (I sectionsignal of MHC) and C-terminal is added respectively MITD (I trafficking domain of MHC) can imitate the process of the pathogen recognition of MHC molecule, so as to not only enhancement antigen Submission efficiency, while the diversity of CD8+ and CD4+T cells can also be stimulated to react, the antigen presentation mode of this mosaic type strengthens The efficiency of antigen presentation and effect (Kreiter, Sebastian, et al. " Increased antigen presentation efficiency by coupling antigens to MHC class I trafficking signals."The Journal of Immunology 180.1(2008):309-318.).HVT is a kind of typical strict Cell combine herpesviral, it is difficult to being separated to free acellular combines poison, mainly infected by way of cytodesma and closed on Cell.Therefore we attempt, after the cross-film and intracellular region for removing HA itself, adding I ss/MITD of MHC of Gallus Gallus (Guillemot,Franpois,et al."A molecular map of the chicken major histocompatibility complex:the class II beta genes are closely linked to the class I genes and the nucleolar organizer."The EMBO journal 7.9(1988):2775.) To strengthen the intracellular pathogen recognition reaction efficiency that HA is infected in HVT, and then promote the antibody rate of climb and rise level.

Except the power of promoter is a key factor of impact gene expression, increasing appropriate controlling element can also have Effect improves the expression of foreign gene.Appropriate controlling element can also effectively improve the expression of foreign gene.In purpose Add marmot posttranscriptional regulatory element (Wood chuck hepatitis virus in the 3' ends of gene Posttranscriptional regulatory element, WPRE), foreign antigen genes expression can be increased (Zufferey,Romain,et al."Woodchuck hepatitis virus posttranscriptional regulatory element enhances expression of transgenes delivered by retroviral vectors."Journal of virology 73.4(1999):2886-2892.).

Additionally, Duo Jia trans-corporations have now been developed the commercialized vaccine with HVT as carrier.Wherein, French Cimmeria is public DepartmentHVT is used for the VP2 genes for expressing gumboro disease (IBD), you can for pre- IBD, and can prevent Marek's disease (MD), is used in more than 70 country's sale at present.Shi Hua companiesHVT series of products In,The F genes of ND expression NDV (NDV), for preventing ND and MD；AI tables Up to the HA albumen of clade2.2 (A/swan/Hungary/4999/2006) H5N1, the H5 for preventing different subtype is highly pathogenic Bird flu and MD, protective rate is in 80%-100%.At present in the poultry farming of multiple countries such as Egypt, Mongolia, Vietnam In come into operation, played huge economic benefit.

Content of the invention

Present invention aim at a kind of recombinant hvt carrier bacterin of the chimeric hemagglutinin HA of expression bird flu of restructuring, is Instantly popular and with huge public health security meaning H7N9 viruses provide a kind of epidemic disease for protecting susceptible animal from source Seedling immunoprotection strategy.

A kind of recombinant herpesvirus of turkeys strain rHMW of expression H7N9 subtype avian influenza virus mosaic type hemagglutinin HA, It is herpes turkey virus Serotype-3 FC126 strain recombinant strains, its preserving number CGMCC NO.12984.

A kind of method for building the recombinant herpesvirus of turkeys strain rHMW, including following step：(1) codon optimization Later and delete HA cross-film and intracellular region chimeric with MHCIss and MITD into MOHA, the pCMGFP with homology arm (CN105002146A) plasmid is through EcoRV and Kpn2I double digestions, MOHA through EcoRV and NheI double digestions, HgB through NheI with Three fragments are carried out three molecule links by Kpn2I double digestions, and the positive plasmid after conversion is named as pMOHA；In plasmid pMOHA MCS MSC insertion WPRE plasmid components, the plasmid after having connected is transformed into the JM109 competent cells of Takala Interior 37 degree of overnight incubations, choose spot upgrading grain double digestion and sequencing identification, and positive plasmid is named as pHMW.(Fig. 6)

(2) DNA of intermediate transfer positive plasmid pHMW and rHVT-GFP is carried out calcium phosphate cotransfection-homologous recombination, weight The strain that group is obtained is named as rHMW (Fig. 7).

In the present invention, it is H7N9 that exogenous antigen is avian influenza subtypes, and hemagglutinin HA is from H7N9 subtype avian influenza strains JX148 (A/chicken/Zhejiang/JX148/2014), and delete the nucleotides of transmembrane region and intracellular region；And add at 5' ends Plus signal peptide (I ss of MHC) sequence and the transmembrane region in 3' ends interpolation MHC I and the intracellular region of the MHC I (B complex) of Gallus The nucleotide sequence of MITD, the nucleotides sequence after being fitted together to are listed in SEQIDNO:Show in 2；MCS after exogenous antigen (MCS) WPRE genes are inserted.

RHMW construction methods of the present invention are as follows

Sequence (GISAID according to existing JX148HA:EPI_ISL_235293；genebank:KY005878), and Gallus gallus(http://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgi？Species= 9031) the partially thermophilic frequency of codon, transfers to company to carry out codon optimization synthesis JX148-OHA (SEQ ID NO:1).Codon In optimization process, the G/C content of the restriction enzyme site and balance full length sequence at two ends is avoided.

The forecast analysis of HVT endogenous gB promoters and clone.Using Gene promoter miner (http:// Gpminer.mbc.nctu.edu.tw/index.php) the gB promoters of forecast analysis HVT, it is characterized by containing TATABox and The reading frame of the eukaryotic promoters such as CAATBox.And according to the design of the result of forecast analysis with restriction enzyme site and protectiveness base Primer PCR amplification HgB promoters.

The structure of chimeric antigen.By OHA according to SMART MODE (http://smart.embl-heidelberg.de/ smart/set_mode.cgi？NORMAL=1) after transmembrane region analysis, cross-film and intracellular region (TM) is deleted, OHA-TM is named as. I ss/MITD of MHC of chicken by way of over-lapPCR and are deleted the OHA-TM fusion connections after TM, fused antigen is formed MOHA(SEQ ID NO:2).

The structure of intermediate transfer plasmid pHMW.By the HgB of the MOHA of the codon optimization of synthesis and clone using corresponding Digestion after glue reclaim, and be attached replacement HgB promoters on the basis of the pCMGFP with homology arm successively and expression is outer Positive plasmid is named as pMOHA (pHgB-MOHA) by the MOHA genes in source.And the MCS (MSC) in the plasmid is inserted WPRE(SEQ ID NO:4) plasmid component.Plasmid after having connected, is transformed into 37 degree in the JM109 competent cells of Takala Overnight incubation.Spot upgrading grain double digestion and sequencing identification is chosen, positive plasmid is named as pHMW (pHgB-MOHA-WPRE)；(such as Shown in Fig. 6).

DNA of the intermediate transfer positive plasmid with rHVT-GFP is carried out calcium phosphate cotransfection-homologous recombination.Using traditional Phenol chloroform method extracts the complete genome DNA of pathology 80%-90%CEF after rHVT-GFP infection, with intermediate transfer plasmid calcium phosphate Cotransfection second generation CEF cell (Morgan, 1990), after occurring pathology plaque after 4-7 days, screen under fluorescence microscope without The plaque of green fluorescence is simultaneously marked, and digests the plaque without fluorescence, be inoculated into the 96 of second generation CEF after drawing a small amount of pancreatin with pipette tips On orifice plate.Through the plaque being purified into completely with out fluorescence after purification of 3-5 time, IFA identifications are carried out, and extracts DNA, PCR expands Sequencing identification after increasing.The strain that restructuring is obtained is named as rHMW；(as shown in Figure 7).

The invention also discloses described recombinant herpesvirus of turkeys strain rHMW is preparing prevention H7N9 subtype avian influenza diseases Purposes in the vaccine of poison.

Description of the drawings

Fig. 1 plasmid construction strategies

Fig. 2 intermediate transfer plasmid pHMW collection of illustrative plates

Fig. 3 pHMW double digestions identify, (markers of the M for 1000bp, 1 for digestion plasmid, 2 be through EcoRV and The result of Kpn2I double digestions).

The PCR identifications of Fig. 4 recombinant strains, (Markers of the M for 1000bp, 1 is PCR results).

The IFA results (B) of Fig. 5 rHMW and negative control (A)

The structure flow chart of interstitial granules in Fig. 6

Fig. 7 transfections, restructuring and screening and identification schematic diagram

It is commonly micro- that strain rHMW of the present invention is preserved in China Committee for Culture Collection of Microorganisms on 5th in September in 2016 Bio-Centers (address：Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, Institute of Microorganism, Academia Sinica), Classification And Nomenclature is Herpes turkey virus Serotype-3 FC126 strain recombinant strains；Preserving number CGMCC NO.12984.

Specific embodiment

Material

RHVT-GFP and pCMGFP builds preservation (referring to special by by livestock and poultry infectious disease key lab of the Ministry of Agriculture of Yangzhou University Sharp application publication number：CN105002146A).H7N9 subtype avian influenza JX148 (A/chicken/Zhejiang/JX148/2014) (GISAID：EPI_ISL_235293), separated by livestock and poultry infectious disease key lab of the Ministry of Agriculture of Yangzhou University and preserved, chicken embryo potency For 10, hemagglutination inhibition reaction proves that the polyvalent antibody of JX148 has higher cross reactivity with the H7N9 of other hypotypes.

High fidelity DNA polymerase, T4DNA ligases, Agarose Gel DNA Extraction Kit is purchased from Roche companies；Plasmid extraction kit (QIAprep Spin MiniPrep Kit) is QIAGEN Products；Its Remaining conventional reagent is domestic pure analysis pure.

Step one, codon optimization and synthesis

According to the sequence (EPI_ISL_235293) of JX148HA, Nanjing Jin Sirui companies are transferred to reference to chicken (Gallus Gallus the partially thermophilic (http of codon)://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgi？ Species=9031) carry out codon optimization with synthesis optiHA (OHA), add restriction enzyme site rear clone on UC57 carriers, It is named as UC57-OHA.

Step 2, the endogenous gB promoters of amplification HVT

FC126 (GenBank are extracted using DNeasy Blood tissue kit:AF291866 genomic DNA).Make With Gene promoter miner (http://gpminer.mbc.nctu.edu.tw/index.php) on-line prediction analysis open Mover contains the cis-acting elements of the promoter in eukaryote such as TAAT and CAAT.And synthetic primer, using gB-F/R gram of primer GB promoters (HgB, the SEQ ID NO of grand FC126:3), to add EcoRv and NheI in the first end restricted interior for promoter Enzyme cutting site and protectiveness base.Primer sequence is as follows

gB-F:gatatcATTGTTCAATCATGATGTCCA(SEQ ID NO:5)

gB-R:gctagcGAGTTCCACCGACCGTATGA(SEQ ID NO:6)

PCR expands (50 μ L reaction systems)：As template, to be drawn to 0.5mL PCR reactions containing genomic gene in advance Guan Zhong, expands gB promoter genes with primer gB-F and gB-R, and concrete operation method is as follows：

PCR reaction cycle parameters：94 DEG C of denaturations 3min；94 DEG C of 30s, 56 DEG C of 45s, 72 DEG C of extension 2min, 20 circulations 72 DEG C extend 10min, 4 DEG C of preservations afterwards.PCR primer is cut after electrophoresis the gel of the fragment of size containing purpose, uses Agrose It is connected with pCR-2.1T carriers after Gel DNA Extraction Kit recovery purifyings, converts to e. coli jm109 competence Cell, extracts plasmid, identifies correct Hou Song Nanjing Genscript Biotechnology Co., Ltd. sequencing through EcoR I digestions, sequence is surveyed Fixed correct positive plasmid name HgB (Fig. 2).

Step 3, the synthesis of I ss/MITD of MHC

The sequence of I ss/MITD of MHC with reference to delivered document (Guillemot, Franpois etc., 1988) on the basis of, Add I restriction enzyme sites of Nhe and kozak sequences (GCCACC) at the 5 ' ends of I ss of MHC, while adding Kpn II at the 3 ' ends of MITD Restriction enzyme site, transfers to Nanjing Jin Sirui companies to synthesize, and is connected respectively on UC57.

Step 4, the transmembrane region prediction of OHA and deletion

Using SMART MODE (http://smart.embl-heidelberg.de/smart/set_mode.cgi？ NORMAL=1) forecast analysis cross-film and intracellular region (TM), delete the transmembrane region of OHA and the 525th to the 561st ammonia of intracellular region Base acid, only retains the extracellular antigenic region of the 1st to the 524th.The OHA for deleting cross-film intracellular region is named as OHA-TM.

Step 5, Over-lapPCR connection MHC I ss/MITD and OHA-TM

I ss/MITD of MHC and OHA-TM will be coupled together one inosculating antibody of composition using over-lapPCR by design primer Former.Glue reclaim sequence verification, the chimeric antigen sequence such as SEQIDNO after connection after PCR:Shown in 2.It is named as MOHA.

Design of primers is as follows

MHCⅠss-F：GCTAGCGCCACCATGGGGCCGTGCG(SEQ ID NO:7)

MHCⅠss-R：CTGTGTGTTCATGGGGGCCGCCGC(SEQ ID NO:8)

OHA-TM-F：GCGGCGGCCCCCATGAACACACAGATCCTGGT(SEQ ID NO:9)

OHA-TM-R：GTGGCGGCTCCACATCTTTGTACCCGGAGC(SEQ ID NO:10)

MITD-F：TACAAAGATGTGGAGCCGCCACAGCCCAAC(SEQ ID NO:11)

MITD-R：TCCGGATTAGATGGCGGGGTTGCTC(SEQ ID NO:12)

PCR reaction systems are ibid.

Step 6, the structure of intermediate transfer plasmid

MOH is used Nhe I and Kpn II double digestions, glue reclaim is standby after electrophoresis.PCMGFP is used EcoRv and Nhe After I double digestions, electrophoresis glue reclaim is standby.The constructed middle interstitial granules pCMGFP with homology arm in patent CN105002146A On the basis of (Fig. 1), just MOHA and HgB is substituted into above-mentioned plasmid respectively, and the good positive plasmid of sequencing identification is renamed For pHgB-MOHA.

Step 7, the insertion of WPRE elements

Be inserted in WPRE that foreign antigen genes fragment 3 ' holds (regulatory factor after WCHV transcription, SEQIDNO:4) being capable of the species specific enhancing gene expression dose of empty and antigenic expression.WPRE elements are amplified from Bac- HAMW(Chen,Chi-Yuan,et al."Baculovirus vector as an avian influenza vaccine: hemagglutinin expression and presentation augment thevaccineimmunogenicity." Journal of biotechnology 164.1(2013):143-150.), presented by Taiwan Tsing-Hua University professor Chen Yucheng. The primer of design amplification WPRE, and the restriction enzyme site for adding that KnpI is added at XhoI restriction enzyme sites and the end of downstream 3 ' is held in upstream 5 '. Primer sequence is as follows

WPRE-F：ccgctcgagCGATAATCAACCTCTGGATTAC(SEQ ID NO:13)

WPRE-R：ttaggtaccCAAAGGGAGATCCGACTCGT(SEQ ID NO:14)

Glue reclaim after WPRE element electrophoresis after amplification, and use XhoI and KnpI double digestion intermediate transfer plasmid pHMOH WPRE elements with amplification.After glue reclaim, the 16 DEG C of connections of T4 ligases are overnight.Spot identification is chosen after conversion, and positive plasmid is ordered Entitled pHMW (Fig. 2).Positive plasmid is through double digestion (Fig. 3) and sequencing identification.

Step 8, the structure of recombinant herpesvirus of turkeys and purifying

(1) preparation of rHVT-GFP infection cells DNA

Primary and second generation CEF cell is prepared according to a conventional method, is inoculated with 105 in second generation CEF of every bottle of T75 Tissue Culture Flask The restructuring rHVT-GFP Strain of plaque forming unit (PFU), culture 3-5 days, etc. 80% cell produce typical cytopathy Afterwards harvesting, extract HVT genomes according to traditional phenol chloroform method.

(2) transfer vector pHMW and rHVT-GFP genomic DNA cotransfection CEF cells

Transfer vector pHMW DNAs are extracted with QIAprep Spin MiniPrep Kit (QIAGEN).CEF is routinely Prepared by method, before transfection assay 1h is started prepare second generation CEF, each 60mm culture dish paving 3x10⁶Cell, in 37 DEG C, 5% Cultivate under the conditions of CO2.

Following reagent is sequentially added in aseptic dactylethrae：

The HVT control groups for being not added with transfer vector pCMGFP plasmids need to be set simultaneously, system is as follows：

194 μ L of aseptic ultra-pure water

rHVT-GFP DNA 5μg

TE complements to 25 μ L

After mixing above-mentioned system, 31 μ L 2mol/L CaCl2 solution and 250 μ L 2xHBSP solution are slowly added to from ttom of pipe (42mmol/L HEPES, 1.4mmol/L Na2HP04,274mmol/L NaCl, 5mmol/L KCI, the 6mmol/L of pH7.05 Glucose), gently several bubbles are blown out from ttom of pipe with suction pipe, be stored at room temperature 30min, form CaP04-DNA mixtures.To each 500 μ L CaP04-DNA compounds are added in the 60mm culture dishes for being covered with second generation CEF cell, is gently shaken up, continue culture 4h.Abandon Fall culture medium, in each Tissue Culture Dish, add the glycerol shock of 2mL.

The system of 2.5ml glycerol shock liquid is by as follows：

Aseptic ultra-pure water 0.9mL

Glycerine 0.35mL

2xHBSP 1.25mL

Shock liquid is discarded after effect 1min after mixing above-mentioned system, with maintaining liquid (V) culture medium washed cell, washing is discarded Liquid, adds growth-promoting media (G) culture medium containing 4% hyclone, is observed with inverted fluorescence microscope after continuing culture 5-7d.

(3) screening of recombinant virus rHMW and purifying

CEF after by transfection is observed with inverted fluorescence microscope, marks the virus plaque without green fluorescence.Discard Culture medium, with the suction pipe scraping virus plaque with a little pancreatin, is transferred in 10mL growth-promoting medias (G) culture medium and is diluted, Each virus plaque is inoculated with one piece of 96 orifice plate for having spread second generation CEF cell, is inoculated with the virus plaque of l00 μ L dilutions per hole, puts Cultivate under the conditions of 37 DEG C, 5%CO2.Repeat the above steps, in 96 porocyte culture plates all of virus plaque all without There is green fluorescence, and the cell of each virus plaque being constituted without fluorescence, recombinant virus purifying is described completely, this is heavy Group viral nomenclature is rHMW.The site being inserted on HVT of foreign gene MOHA is with patent CN105002146A.

Step 9, the identification of recombinant herpesvirus of turkeys

Indirect immunofluorescence assay (IFA) detects expression of the rHMW to exogenous antigen：Second generation CEF cell is infected with rHMW, Form virus plaque within 3-5 days.

(1) cell being collected, being extracted after DNA using kit, primer is designed on homology arm, PCR is identified, and mirror is sequenced Fixed.Ibid, PCR results are as shown in Figure 4 for PCR reaction conditions.Design of primers is as follows：

A-F：GCCGATAATTTGATATACGCAC(SEQ ID NO:15)

B-R：ATCTTCCACAGCTCCAGTTATT(SEQ ID NO:16)

(2) cell is fixed 30 minutes with cold methanol, PBS is washed 3 times；Plus the anti-AIV HA polyclonal antibodies of working concentration (H7 serum), 37 DEG C act on 1 hour, and PBS is washed 2-3 time；Plus the anti-chicken IgG of working concentration/lgM fluorescence monoclonal antibodies, 37 DEG C of effects 1 Hour, washed 2-3 time with PBS；Viewed under fluoroscopy is put, as a result shows all cells band fluorescence (figure for constituting virus plaque 5).

SEQUENCE LISTING

<110>Yangzhou University

<120>The recombinant herpesvirus of turkeys strain rHMW and structure of expression H7N9 subtype avian influenza virus mosaic type hemagglutinins

Construction method

<130>

<160> 16

<170> PatentIn version 3.3

<210> 1

<211> 1683

<212> DNA

<213>Artificial sequence

<400> 1

atgaacacac agatcctggt gttcgccctg attgctatca ttcccactaa tgctgacaag 60

atctgcctgg ggcaccacgc agtgagcaac ggcaccaaag tgaataccct gacagagaga 120

ggagtggaag tggtgaacgc aactgagacc gtggaaagga ctaatatccc tcgcatttgc 180

agcaagggga agaaaaccgt ggatctgggc cagtgcggac tgctggggac aatcactggc 240

ccccctcagt gcgaccagtt cctggagttt agcgctgatc tgatcattga gagaagggaa 300

ggatccgacg tgtgctaccc tgggaagttc gtgaacgagg aagcactgcg gcagatcctg 360

agagagagcg gcggaattga taaagaagcc atggggttta cttactccgg catcagaacc 420

aatggagcaa ccagcgcatg caggaggtcc gggagctcct tctacgccga gatgaagtgg 480

ctgctgagca acaccgacaa tgccgctttt ccccagatga ctaagagcta caaaaacacc 540

agaaaatccc ctgccctgat cgtgtggggc attcaccaca gcgtgtccac agctgaacag 600

actaagctgt acggaagcgg gaacaaactg gtgacagtgg gaagctccaa ttaccagcag 660

agcttcgtgc catccccagg agcaaggcca caggtgaacg gactgagcgg ccgcatcgac 720

tttcactggc tgatgctgaa ccctaatgat accgtgacat tcagctttaa tggcgctttc 780

atcgcaccag accgggcttc ctttctgaga ggcaagagca tgggaattca gtccggggtg 840

caggtggacg caaactgcga gggagattgc taccacagcg ggggcacaat catttccaac 900

ctgccattcc agaatatcga tagcagggca gtgggaaagt gcccaagata cgtgaaacag 960

cgctccctgc tgctggctac tggaatgaag aacgtgcctg agatcccaaa aggccgggga 1020

ctgttcggcg ctatcgcagg atttattgag aacgggtggg aaggcctgat tgacggatgg 1080

tacgggttta gacaccagaa tgctcagggg gagggcacag cagccgacta caagagcact 1140

cagtccgcaa tcgatcagat taccggaaag ctgaacaggc tgatcgaaaa aacaaatcag 1200

cagttcgagc tgattgacaa cgaatttaat gaggtggaaa aacagatcgg gaacgtgatt 1260

aattggaccc gcgatagcat cacagaagtg tggtcctaca acgccgagct gctggtggct 1320

atggaaaatc agcacaccat tgacctggcc gatagcgaga tggacaagct gtacgaaaga 1380

gtgaaaaggc agctgcgcga gaacgctgag gaagatggaa ccgggtgctt cgaaatcttt 1440

cacaagtgcg atgacgattg catggcaagc attaggaaca atacatacga tcactccaaa 1500

taccgggagg aagccatgca gaacagaatc cagattgacc ctgtgaagct gagctccggg 1560

tacaaagatg tgatcctgtg gttcagcttt ggcgcatcct gcttcatcct gctggccatt 1620

gtgatgggcc tggtgtttat ttgcgtgaag aacggaaata tgcgctgcac aatctgcatt 1680

taa 1683

<210> 2

<211> 1800

<212> DNA

<213>Artificial sequence

<400> 2

atggggccgt gcggggcgct gggcctgggg ctgctgctcg ccgccgtgtg cggggcggcg 60

gcccccatga acacacagat cctggtgttc gccctgattg ctatcattcc cactaatgct 120

gacaagatct gcctggggca ccacgcagtg agcaacggca ccaaagtgaa taccctgaca 180

gagagaggag tggaagtggt gaacgcaact gagaccgtgg aaaggactaa tatccctcgc 240

atttgcagca aggggaagaa aaccgtggat ctgggccagt gcggactgct ggggacaatc 300

actggccccc ctcagtgcga ccagttcctg gagtttagcg ctgatctgat cattgagaga 360

agggaaggat ccgacgtgtg ctaccctggg aagttcgtga acgaggaagc actgcggcag 420

atcctgagag agagcggcgg aattgataaa gaagccatgg ggtttactta ctccggcatc 480

agaaccaatg gagcaaccag cgcatgcagg aggtccggga gctccttcta cgccgagatg 540

aagtggctgc tgagcaacac cgacaatgcc gcttttcccc agatgactaa gagctacaaa 600

aacaccagaa aatcccctgc cctgatcgtg tggggcattc accacagcgt gtccacagct 660

gaacagacta agctgtacgg aagcgggaac aaactggtga cagtgggaag ctccaattac 720

cagcagagct tcgtgccatc cccaggagca aggccacagg tgaacggact gagcggccgc 780

atcgactttc actggctgat gctgaaccct aatgataccg tgacattcag ctttaatggc 840

gctttcatcg caccagaccg ggcttccttt ctgagaggca agagcatggg aattcagtcc 900

ggggtgcagg tggacgcaaa ctgcgaggga gattgctacc acagcggggg cacaatcatt 960

tccaacctgc cattccagaa tatcgatagc agggcagtgg gaaagtgccc aagatacgtg 1020

aaacagcgct ccctgctgct ggctactgga atgaagaacg tgcctgagat cccaaaaggc 1080

cggggactgt tcggcgctat cgcaggattt attgagaacg ggtgggaagg cctgattgac 1140

ggatggtacg ggtttagaca ccagaatgct cagggggagg gcacagcagc cgactacaag 1200

agcactcagt ccgcaatcga tcagattacc ggaaagctga acaggctgat cgaaaaaaca 1260

aatcagcagt tcgagctgat tgacaacgaa tttaatgagg tggaaaaaca gatcgggaac 1320

gtgattaatt ggacccgcga tagcatcaca gaagtgtggt cctacaacgc cgagctgctg 1380

gtggctatgg aaaatcagca caccattgac ctggccgata gcgagatgga caagctgtac 1440

gaaagagtga aaaggcagct gcgcgagaac gctgaggaag atggaaccgg gtgcttcgaa 1500

atctttcaca agtgcgatga cgattgcatg gcaagcatta ggaacaatac atacgatcac 1560

tccaaatacc gggaggaagc catgcagaac agaatccaga ttgaccctgt gaagctgagc 1620

tccgggtaca aagatgtgga gccgccacag cccaacctgg tgcccatcgt ggcgggggtg 1680

gccgtcgcca ttgtggccat tgccatcatg gttggtgttg gattcatcat ctacagacgc 1740

catgcaggga agaaggggaa gggctacaac atcgcgcccg ggagcaaccc cgccatctaa 1800

<210> 3

<211> 742

<212> DNA

<213>Artificial sequence

<400> 3

atcgttttgc ccaaccctcg aatacggctt tatatttcag tgtggaaaat gtaggcctcc 60

tgcctcactt gaaggaagaa atggcacgat ttatgttaca gtgcaacaac acatcaagtt 120

ggataataag taaatttagg gggttttacg attttggtgg agtggataat ataaccaccg 180

cacatagaat ggcatggaaa tatatacgag agttgatttt ggcgactgcc ctttttgcat 240

ccgtgttcaa atgtggcgat ttgcaggtgt gtcgtgccga tggcttacag ctaacattgg 300

ggggggagta catttgggag gatggagtat atctgacata cgagaccgat tgtcctctcg 360

tagcacttat cgggtgtagg gcttatctaa cccacaatca atccccgacc gttctcgttg 420

acacggatgt tttttccttg ctttattcta ttttgcagtt tatggctccc gctacggcgg 480

atcagttacg atcggatcgg tttagtaata gccacaccca caattgacct aggtcaatat 540

cgttaggact ttagtatttt gattcatacg gtcggtggaa ctcatgctta tgactcctac 600

aatgaagtac tttaatcggt ctttatttat ttttctcacc ccaatcttat ccatcgcgac 660

ctcagaaatt aaattaccaa atgtgacagc gcgagaaatt gtttcgggca tacagctatc 720

cgaagacgag acgacatttt ac 742

<210> 4

<211> 579

<212> DNA

<213>Artificial sequence

<400> 4

cgataatcaa cctctggatt acaaaatttg tgaaagattg actggtattc ttaactatgt 60

tgctcctttt acgctatgtg gatacgctgc tttaatgcct ttgtatcatg ctattgcttc 120

ccgtatggct ttcattttct cctccttgta taaatcctgg ttgctgtctc tttatgagga 180

gttgtggccc gttgtcaggc aacgtggcgt ggtgtgcact gtgtttgctg acgcaacccc 240

cactggttgg ggcattgcca ccacctgtca gctcctttcc gggactttcg ctttccccct 300

ccctattgcc acggcggaac tcatcgccgc ctgccttgcc cgctgctgga caggggctcg 360

gctgttgggc actgacaatt ccgtggtgtt gtcggggaag ctgacgtcct ttccatggct 420

gctcgcctgt gttgccacct ggattctgcg cgggacgtcc ttctgctacg tcccttcggc 480

cctcaatcca gcggaccttc cttcccgcgg cctgctgccg gctctgcggc ctcttccgcg 540

tcttcgcctt cgccctcaga cgagtcggat ctccctttg 579

<210> 5

<211> 27

<212> DNA

<213>Artificial sequence

<400> 5

gatatcattg ttcaatcatg atgtcca 27

<210> 6

<211> 26

<212> DNA

<213>Artificial sequence

<400> 6

gctagcgagt tccaccgacc gtatga 26

<210> 7

<211> 25

<212> DNA

<213>Artificial sequence

<400> 7

gctagcgcca ccatggggcc gtgcg 25

<210> 8

<211> 24

<212> DNA

<213>Artificial sequence

<400> 8

ctgtgtgttc atgggggccg ccgc 24

<210> 9

<211> 32

<212> DNA

<213>Artificial sequence

<400> 9

gcggcggccc ccatgaacac acagatcctg gt 32

<210> 10

<211> 30

<212> DNA

<213>Artificial sequence

<400> 10

gtggcggctc cacatctttg tacccggagc 30

<210> 11

<211> 30

<212> DNA

<213>Artificial sequence

<400> 11

tacaaagatg tggagccgcc acagcccaac 30

<210> 12

<211> 25

<212> DNA

<213>Artificial sequence

<400> 12

tccggattag atggcggggt tgctc 25

<210> 13

<211> 31

<212> DNA

<213>Artificial sequence

<400> 13

ccgctcgagc gataatcaac ctctggatta c 31

<210> 14

<211> 29

<212> DNA

<213>Artificial sequence

<400> 14

ttaggtaccc aaagggagat ccgactcgt 29

<210> 15

<211> 22

<212> DNA

<213>Artificial sequence

<400> 15

gccgataatt tgatatacgc ac 22

<210> 16

<211> 22

<212> DNA

<213>Artificial sequence

<400> 16

atcttccaca gctccagtta tt 22

Claims

1. a kind of recombinant herpesvirus of turkeys strain rHMW of expression H7N9 subtype avian influenza virus mosaic type hemagglutinins, its are protected Tibetan CGMCC NO.12984.

2. recombinant herpesvirus of turkeys strain rHMW according to claim 1, it is characterised in that expression H7N9 is sub- in the strain The gene of type avian influenza virus mosaic type external source hemagglutinin, its nucleotide sequence such as SEQIDNO:2；After external source hemagglutinin gene MCS (MCS) is inserted with WPRE genes.

3. a kind of structure of the recombinant herpesvirus of turkeys strain rHMW of expression H7N9 subtype avian influenza virus mosaic type hemagglutinins Construction method, it is characterised in that comprise the following steps：

(1) after codon optimization and cross-film and the intracellular region of hemagglutinin are deleted, then chimeric with MHCIss and MITD into MOHA, the pCMGFP plasmids with homology arm are passed through through EcoRV and NheI double digestions, HgB through EcoRV and Kpn2I double digestions, MOHA Three fragments are carried out three molecule connections by NheI and Kpn2I double digestions, and the positive plasmid after conversion is named as pMOHA；In plasmid The MCS MSC insertion WPRE plasmid components of pMOHA, are transformed into after connection in JM109 competent cells, incubated overnight, Choose spot and extract plasmid, and double digestion and sequencing identification, positive plasmid is named as pHMW；

(2) intermediate transfer plasmid pHMW is carried out with the DNA of the recombinant herpesvirus of turkeys rHVT-GFP of expression GFP fluorescins Calcium phosphate cotransfection, after filtering out the virus plaques without fluorescence, and through indirect immunofluorescence and sequencing identification, should be without glimmering The plaque of light is the recombinant herpesvirus of turkeys rHMW of the HA for expressing H7N9.

4. the recombinant herpesvirus of turkeys strain rHMW described in claim 1 is preparing the vaccine of prevention H7N9 subtype avian influenza virus In purposes.