CN114854698B

CN114854698B - O-type foot-and-mouth disease virus strain with improved replication titer, construction method and application thereof

Info

Publication number: CN114854698B
Application number: CN202210682771.8A
Authority: CN
Inventors: 李平花; 卢曾军; 查晶晶; 马雪青; 孙普; 李冬; 白兴文; 曹轶梅; 李坤; 袁红; 付元芳; 包慧芳; 刘在新; 赵志荀; 王健; 张克强; 陈应理; 张强
Original assignee: Lanzhou Veterinary Research Institute of CAAS
Current assignee: Lanzhou Veterinary Research Institute of CAAS
Priority date: 2022-06-16
Filing date: 2022-06-16
Publication date: 2023-09-15
Anticipated expiration: 2042-06-16
Also published as: CN114854698A

Abstract

The invention provides an O-type foot-and-mouth disease virus strain with improved replication titer, a construction method and application thereof, and belongs to the technical field of biological products. According to the invention, through a reverse genetic operation technology of foot-and-mouth disease virus, on a main immune gene recombinant virus skeleton of a chimeric foot-and-mouth disease virus O/XJ/CHA/2017 strain, the G-H loop gene of the foot-and-mouth disease virus O/NXYCh/CHA/2018 strain is further used for replacing the corresponding gene, the time of 100% infectious cytopathy caused by the constructed recombinant virus rHN/XJ/NXGH is obviously shortened to 12H, and the replication titer of 12H of infected cells is improved by more than 5 times. The recombinant virus is continuously passaged, the genetic stability is good, and the replacement of the G-H ring does not affect the immunogenicity of the vaccine. Therefore, the recombinant foot-and-mouth disease virus strain rHN/XJ/NXGH provided by the invention has potential to be used as a vaccine candidate strain for effectively preventing and controlling O-type foot-and-mouth disease in China.

Description

O-type foot-and-mouth disease virus strain with improved replication titer, construction method and application thereof

Technical Field

The invention belongs to the technical field of biological products, and particularly relates to an O-type foot-and-mouth disease virus strain with improved replication titer, a construction method and application thereof.

Background

Foot-and-Mouth Disease (FMD) is a virulent infectious Disease that causes over 70 artiodactyls such as pigs, cattle and sheep to be infected by Foot-and-Mouth Disease virus (FMDV). The disease is rapidly transmitted, extremely contagious and extremely high in incidence, and is classified as a must-report animal epidemic disease by the world animal health Organization (OIE). The outbreak and the popularity of FMD seriously jeopardize the productivity and the quality of livestock products, affect the international trade of livestock and products thereof, and cause great economic loss for livestock breeding in the affected area. Therefore, effective prevention and control of FMD is of great strategic importance for the continuous and healthy development of the global livestock industry.

Immunization with inactivated vaccines is an important means of preventing and controlling foot-and-mouth disease. Although inactivated vaccines play a very important role in the prevention, control and purification of FMD, FMDV serotypes are numerous, and genes and antigens are highly variable, making FMD difficult to control.

In recent years, the O-type FMDV is still the most serious serotype endangering livestock breeding industry in China. Analysis of genetic relationships that trigger epidemic FMDV has found that the type O FMDV that prevails in recent years is mainly four lineage strains in three topologies (middle east-south asia (ME-SA), southeast asia (SEA), and classical china (cathiay)), namely Mya-98 lineage (SEA), cathiay lineage, panAsia lineage (ME-SA), and Ind-2001 lineage (ME-SA), respectively. The complex situation that the current O-type FMDV exists in a multi-topology mode in China and the common epidemic situation of multiple pedigree virus strains aggravates the variation of foot-and-mouth disease viruses, so that new variant strains continuously appear and frequently cause epidemic situations, the screening of vaccine candidate strains which have excellent immunogenicity and are highly matched with all the current O-type epidemic strains is urgently needed, and the vaccine candidate strains are used for effective prevention and control of the current FMD in China.

Key determinants of FMDV vaccine strain selection: the virus has good replicative performance on susceptible cells, short virus collection time, excellent immunogenicity and broad antigen spectrum. Recent studies have shown that FMDV (O/SKR/Boeun/2017 and O/XJ/CHA/2017) of the currently popular O/ME-SA/Ind-2001 lineage has a good antigen match with other lineages of O-type (O/PanAsia, O/Mya-98 and O/cathiay) and is excellent in immunogenicity, suitable as an FMD vaccine strain for effective control of current FMD. But the isolated O/XJ/CHA/2017 strain in China (even other strains with the same pedigree popular in China) has lower replication titer on BHK-21 susceptible cells (TCID) ₅₀ About 10 ^5.2 Left and right), the toxin-collecting time is too long (more than 40 h), and the method is not suitable for large-scale production of FMD vaccine.

Disclosure of Invention

Accordingly, the present invention is directed to an O-type FMDV strain with improved replication titer and a method for constructing the same, wherein the recombinant FMDV strain obtained by constructing the same has significantly shortened virus-collection time to 12h, and the replication titer in 12h infected susceptible cells is improved by 5 times (10 ^7.5 PFU/mL), and meets the requirement of FMD vaccine mass production.

The invention provides an O-type FMDV with improved replication titer, which is obtained by taking recombinant FMDV rHN/XJ as a framework and embedding G-H ring antigen epitope genes of O/NXYCh/CHA/2018 strains;

the recombinant FMDVrHN/XJ is obtained by taking FMD vaccine strain O/HN/CHA/93 as a skeleton and embedding L+P1 genes of O/XJ/CHA/2017 epidemic strains.

Preferably, the nucleotide sequence of the G-H loop antigen epitope gene of the O/NXYCh/CHA/2018 strain is shown as SEQ ID NO:4.

preferably, the nucleotide sequence of the L+P1 gene of the O/XJ/CHA/2017 strain is as shown in SEQ ID NO:2.

the invention provides a construction method of the O-type FMDV strain with improved replication titer, which comprises the following steps:

1) Taking FMD vaccine strain O/HN/CHA/93 half-length plasmid pSK-Z123 as a skeleton, artificially synthesizing a recombinant vector containing FMDV O/XJ/CHA/2017 strain L+P1 genes to obtain pSK-Z123XJLP1 recombinant plasmid;

2) Taking the pSK-Z123XJLP1 recombinant plasmid in the step 1) as a framework, and embedding G-H loop genes of FMDV O/NXYCh/CHA/2018 strains to obtain pSK-Z123XJLP1/NXGH;

3) Digesting the pSK-Z123XJLP1/NXGH described in step 2) with SpeI and BglII to obtain an enzyme-sectioned fragment;

4) Cloning the enzyme section into a pOFS plasmid to obtain PQSE;

5) Transfecting the PQSE in the step 4) into cells to rescue viruses, thereby obtaining rHN/XJ/NXGH. Preferably, step 3) the SpeI and BglII digested system: 10 XBuffer H10 mu L, bgl II 4 mu L, spe I4 mu L, recombinant plasmid 4 mu g, ddH ₂ O was replenished to 100 μl;

the enzyme digestion system is incubated for 1-2 h at 37 ℃.

Preferably, the cloning site of the pOFS plasmid in step 4) is SpeI/BglII.

Preferably, after the cloning of step 4), further comprising identifying PQSE;

the identification method is that the PstI enzyme is adopted to carry out enzyme digestion on the recombinant plasmid PQSE, three bands of 838bp,4250bp and 6050bp are cut out, the size of the recombinant plasmid PQSE is initially correct, then the enzyme digestion identification is carried out on the correct recombinant plasmid PQSE, and the result shows that the recombinant plasmid PQSE is on the skeleton embedded with FMDV O/XJ/CHA/2017 strain L+P1 gene and replaces FMDV O/NXYCh/CHA/2018 strain G-H loop gene.

The invention provides an application of the O-shaped mouth FMDV strain with improved replication titer or the O-shaped FMDV strain obtained by the construction method in preparing an FMD vaccine.

The invention provides a vaccine for preventing and controlling FMD, which comprises an adjuvant and an O-type FMDV strain with improved replication titer or the O-type FMDV strain obtained by the construction method.

The invention provides an O-type FMDV strain with improved replication titer, which is obtained by taking recombinant FMDV rHN/XJ as a framework and embedding G-H ring antigen epitope genes of O/NXYCh/CHA/2018 epidemic strains; wherein the recombinant FMDV rHN/XJ is obtained by taking FMD vaccine strain O/HN/CHA/93 as a skeleton and embedding L+P1 genes of O/XJ/CHA/2017 epidemic strains. The invention replaces the L+P1 gene of O/XJ/CHA/2017 strain embedded with O/NXYCh/CHA/2018 strain G-H ring on the basis of FMD vaccine strain O/HN/CHA/93, and the result shows that the obtained recombinant virus strain rHN/XJ/NXGH is continuously transmitted to 10 generations, and the G-H ring amino acid is not mutated, thus indicating that the recombinant virus has good genetic stability; the growth curve results show that the influence on the FMDV replication level is different due to the difference of the inserted G-H loop amino acid sequences, compared with the parent virus rHN/XJ, the replication titer of the recombinant FMDV is obviously improved within 4-20H after the recombinant virus of FMD epidemic strain O/NXYCh/CHA/2018 is inserted into cells, and the G-H loop of vaccine strain O1/Manisa/TUR/69 is replaced, so that the replication titer of the recombinant FMDV at different infection times can not be obviously improved. Meanwhile, after the recombinant virus strain is inactivated and mixed with an adjuvant to immunize animals, the recombinant virus strain has good immunogenicity as the parent virus, which indicates that the substitution of the G-H ring does not affect the antigenicity of the virus. Therefore, the O-type FMDV strain provided by the invention not only shortens the time for causing 100% cytopathy obviously and has high replication titer, but also retains the immunogenicity of the original strain, thereby providing an ideal strain material for large-scale production of FMD vaccines.

Drawings

FIG. 1 is a schematic diagram of construction of recombinant plasmids; and (3) injection: the dark grey part indicates the L+P1 gene of FMDV O/XJ/CHA/2017 strain, and the light grey indicates the position of G-H;

FIG. 2 is a diagram showing the restriction enzyme digestion of recombinant plasmid PstI, M is a DNA standard marker;1, the PQSA plasmid is digested with pstI; 2, the PQSE plasmid is digested by pstI; 3, PQTM plasmid is digested with pstI;

FIG. 3 is an alignment of the amino acids encoded by the G-H loop genes of three full-length recombinant plasmids;

FIG. 4 shows BSR/T7 cells 60h after recombinant plasmid transfection, A: normal BSR/T7 cells; B. c and D are BSR/T7 cells transfected with plasmids pQSA, PQTM and pQSE, respectively, for 60 h;

FIG. 5 is an indirect immunofluorescence result;

FIG. 6 is an electron microscopic view of recombinant FMDV, wherein A is rHN/XJ; rHN/XJ/NXGH; rHN/XJ/MSGH;

FIG. 7 shows the results of one-step growth curves of 4 recombinant FMDV produced according to the present invention.

Detailed Description

The invention provides an O-type FMDV strain with improved replication titer, which is obtained by taking recombinant FMDV rHN/XJ as a framework and embedding G-H ring antigen epitope genes of O/NXYCh/CHA/2018 epidemic strains;

the recombinant FMDVrHN/XJ is obtained by taking FMD vaccine strain O/HN/CHA/93 as a framework and embedding L+P1 genes of O/XJ/CHA/2017 epidemic strains.

In the invention, the nucleotide sequence of the L+P1 gene of the FMDV O/XJ/CHA/2017 strain is shown as SEQ ID NO:2. the nucleotide sequence of the G-H loop antigen epitope gene of FMDV O/NXYCh/CHA/2018 is shown as SEQ ID NO:4. the experiment of the invention shows that the G-H loop containing different amino acid compositions can directly influence the 100% cytopathic capacity of FMDV and the replication capacity of strains, the G-H loop derived from O/NXYCh/CHA/2018 strains is beneficial to improving the replication capacity of recombinant FMDV, and the G-H loop derived from O1/Manisa/TUR/69 has no obvious improvement on the replication capacity of recombinant FMDV.

1) Taking FMD vaccine strain O/HN/CHA/93 half-length plasmid pSK-Z123 as a skeleton, artificially synthesizing a recombinant vector containing the L+P1 gene of FMDVO/XJ/CHA/2017 to obtain pSK-Z123XJLP1 recombinant plasmid;

4) Cloning the enzyme section into a pOFS plasmid to obtain PQSE;

5) Transfecting the PQSE in the step 4) into cells to rescue viruses, thereby obtaining rHN/XJ/NXGH.

The invention takes half-length plasmid pSK-Z123 of FMD vaccine strain O/HN/CHA/93 as a framework, artificially synthesizes a recombinant vector containing L+P1 genes of FMDV O/XJ/CHA/2017, and obtains pSK-Z123XJLP1 recombinant plasmid.

In the present invention, the O/HN/CHA/93 strain half-length plasmid pSK-Z123 is reported in the prior art, see in particular prior art 1 (Evaluation of a genetically modified foot-and-mouth disease virus vaccine candidate generated by reverse genetics, li et al BMC Veterinary Research 2012, 8:57)). The method of artificially synthesizing the recombinant vector is not particularly limited, and artificial synthesis methods well known in the art may be employed. In the embodiment of the invention, the artificial synthesis of the recombinant vector is completed by Jin Wei Biotechnology Inc.

After pSK-Z123XJLP1 recombinant plasmid is obtained, the pSK-Z123XJLP1 recombinant plasmid is taken as a framework, and G-H loop genes of O/NXYCh/CHA/2018 strains are embedded, so that pSK-Z123XJLP1/NXGH is obtained.

In the present invention, the O/NXYCh/CHA/2018 strain belongs to the Mya-98 lineage, see in particular GenBank MH791315.1 accession numbers. The G-H loop gene is preferably located at amino acids 130-160 of VP 1. The method of artificially synthesizing the recombinant vector is not particularly limited, and artificial synthesis methods well known in the art may be employed. In the embodiment of the invention, the artificial synthesis of the recombinant vector is completed by Jin Wei Biotechnology Inc.

After obtaining pSK-Z123XJLP1/NXGH, the present invention digested the pSK-Z123XJLP1/NXGH with SpeI and BglII to obtain an enzyme fragment.

In the present invention, the Spe I and BglII digestion system is preferably as follows: 10 XBuffer H10. Mu.L,BglII 4 mu L, spe I4 mu L, recombinant plasmid 4 mu g, ddH ₂ O was replenished to 100. Mu.L. The enzyme digestion system is incubated for 1-2 h at 37 ℃. After the enzyme digestion, the enzyme digestion product is subjected to electrophoresis, and 5400bp bands are recovered as enzyme digestion fragments.

After obtaining the enzyme fragment, the invention clones the enzyme fragment into pOFS plasmid to obtain PQSE.

In the present invention, the cloning method preferably uses restriction enzymes to cleave the pOFS plasmid, and the resulting fragment is ligated with a linear plasmid to obtain PQSE. The pOFS plasmids are reported in the prior art and can be found in particular in prior art 1 (Evaluation of a genetically modified foot-and-mouth disease virus vaccine candidate generated by reverse genetics, li et al BMC Veterinary Research 2012, 8:57). The cloning site of the pOFS plasmid is SpeI/BglII.

In the present invention, the cloning is preferably further followed by the identification of PQSE. The identification method is that the PstI enzyme is adopted to carry out enzyme digestion on the recombinant plasmid PQSE, three bands of 838bp,4250bp and 6050bp are cut out, the size of the recombinant plasmid PQSE is initially correct, then the enzyme digestion identification is carried out on the correct recombinant plasmid PQSE, and the result shows that the recombinant plasmid PQSE is on the framework embedded with FMD O/XJ/CHA/2017 strain L+P1 genes, and O/NXYCh/CHA/2018 strain G-H loop genes are replaced.

The invention provides an application of the O-type FMDV strain with improved replication titer or the O-type FMDV strain obtained by the construction method in preparing a vaccine for preventing and controlling FMD.

In the present invention, the vaccine is preferably an inactivated vaccine. The adjuvant is preferably ISA201 oil adjuvant. The volume ratio of the O-type FMDV strain to the adjuvant is preferably 46:54. The antigen concentration of the type O FMDV strain is preferably 6 mug/mL. The preparation method of the antigen broad-spectrum O-type FMD vaccine is not particularly limited, and the vaccine preparation method well known in the art can be adopted.

In the present invention, the immunization method of the vaccine is preferably as follows: the pig root is intramuscular injected with the dosage of 2 mL/head. The pigs immunized by 28 days are collected, serum is collected, the antibody titer of the immune serum is detected by an O-type foot-and-mouth disease virus liquid phase blocking ELISA (LPB-ELISA) kit (the animal doctor institute of Orchis, china academy of agricultural sciences), the results show that the average LPB-ELISA antibody titer of the pigs immunized by the two FMD vaccines of rHN/XJ/NXGH and rHN/XJ is basically similar after 14 days, 21 days and 28 days, and the liquid phase antibodies produced by the organisms are induced by both vaccines after 28 days of immunization to be more than 1:128, thus the recombinant viruses replaced by the G-H ring have good immunogenicity as the parent viruses, and the replacement of the G-H ring does not influence the antigenicity of the viruses.

The following examples are provided to illustrate in detail an O-type FMDV strain with enhanced replication titer and a method of constructing and using the same, but they should not be construed as limiting the scope of the invention.

FMD vaccine strain O/HN/CHA/93 is disclosed in prior art 1 (Evaluation of a genetically modified foot-and-mouth disease virus vaccine candidate generated by reverse genetics, li et al BMC Veterinary Research 2012, 8:57), FMDV O/XJ/CHA/2017 (MF 461724.1), O/NXYCh/CHA/2018 (MH 791315.1) and vaccine strain O1/Manisa/TUR/69 (Pan sub-pedigree, genBank KY 825719.1) is disclosed in Genebank. rHN is a full length infectious clone of FMDV vaccine strain O/HN/CHA/93 pOFS rescue the resulting genetically engineered virus (Evaluation ofa genetically modified foot-and-mouth disease virus vaccine candidate generated by reverse genetics, li et al BMC Veterinary Research,2012, 8:57) is the parent virus of the present invention.

Example 1

1. Construction method of full-length clone containing FMD epidemic strain O/XJ/CHA/2017L+P1 gene

The recombinant half-length plasmid pSK-Z123XJLP1 (Jin Wei Satsu Biotechnology Co., ltd.) containing the virus L+P1 gene was designed and synthesized based on the L and P1 nucleotide sequences (SEQ ID NO: 2) of the O/XJ/CHA/2017 epidemic strain (Ind-2001 pedigree, genBank MF 461724.1) published in Genebank, using the FMD vaccine strain O/HN/CHA/93 half-length plasmid pSK-Z123 as a backbone. The plasmid was digested with SpeI and BglII restriction enzymes, and the fragment of interest was recovered at about 5400bp, respectively, and inserted into the pOFS plasmid digested with the same enzymes to obtain the full-length plasmid PQSA of the chimeric O/XJ/CHA/2017 virus L+P1 gene (see FIG. 1). Wherein, the nucleotide sequence of the L+P1 gene of the plasmid PQSA is shown as SEQ ID NO. 2, the G-H ring nucleotide sequence is shown as SEQ ID NO. 3, and the G-H ring amino acid sequence is shown as SEQ ID NO. 6. The plasmid was identified by cleavage with PstI, resulting in the excision of the size bands of purpose of 838bp,4250bp and 6050bp, which were consistent with the expected size (see FIG. 2). The recombinant plasmid with correct enzyme digestion identification was sent to Jin Weizhi biotechnology limited company for sequence determination, and the result shows that the constructed recombinant plasmid contains expected substitution.

2. Construction method of FMDV recombinant full-length clone containing different G-H loop genes

The plasmids pSK-Z123XJLP1/NXGH and pSK-Z123XJLP1/MSGH (Jin Wei. Biotechnology Co., ltd.) containing the substitution of the G-H loop gene of the 2 viruses were designed and synthesized based on the G-H loop gene (amino acids 130 to 160 of VP 1) of the national popular FMD O/NXYCh/CHA/2018 strain (Mya-98 pedigree) and the internationally widely used vaccine strain O1/Manisa/TUR/69 (Pan-sub-pedigree) published in Genebank. The synthesized 2 plasmids were digested with SpeI and BglII restriction enzymes, respectively, and about 5400bp of the target fragment was recovered and inserted into the pOFS plasmid digested with the same enzymes, to thereby obtain recombinant full-length plasmids PQSE and PQTM having 2G-H loop substitutions, respectively (see FIG. 1). Wherein pQSE and PQTM are chimeric with G-H loops from different strains based on pQSA, and the nucleotide sequence of the G-H loops in pQSE is shown in SEQ ID NO: the amino acid sequence of the G-H ring is shown in SEQ ID NO:7, preparing a base material; the G-H loop nucleotide sequence in pQTM is shown in SEQ ID NO: the amino acid sequence of the G-H ring is shown in SEQ ID NO:8. the 2 recombinant plasmids were identified by cleavage with PstI, and as a result, the desired bands (838bp, 4250bp and 6050 bp) were excised, which were consistent with the expected sizes (see FIG. 2). The recombinant plasmid with correct restriction enzyme identification was sent to Jin Weizhi Biotechnology Co.Ltd for sequencing.

The results indicated that the constructed recombinant plasmid contained the expected substitution. The amino acid alignment of the 3 recombinant full-length plasmid G-H loop genes is shown in FIG. 3.

Example 2

Rescue of recombinant viruses

QIAGEN Plasmid Midi Kits plasmids pQSA, pQSE and PQTM were prepared, and NotI was linearized and purified using a DNA fragment recovery kit to recover as a transfection template. The routinely cultured monolayer BSR/T7 cells were transfected with Lipofectamine 2000 (see protocol for specific procedures) when grown to 70% -80%. 5h after transfection 2mL of DMEM medium containing 8% fetal bovine serum was added and incubated at 37℃with 5% CO ₂ The incubator continues to culture and the cells are observed for cytopathic effects.

The results show that: typical cytopathic effects (cytopathogenic effect, CPE) were seen in all 3 plasmids 60h after transfection of BSR/T7 cells, i.e.the cells in the fibrous distribution became larger and rounded (FIG. 4). Cells were harvested 72h after transfection, repeatedly frozen and thawed 3 times, serially passaged on BHK-21, -70 stored virus for each generation. The rescued genetically engineered viruses were named rHN/XJ, rHN/XJ/NXGH and rHN/XJ/MSGH, respectively.

Example 3

Identification of recombinant viruses

1. RT-PCR identification

The transfected supernatant was used to extract total RNA of the cell virus by RNAasyMini Kit, and the P1 gene fragment of the transfected supernatant was amplified by RT-PCR with the primers OZ1490 (+)/OZ 3980 (-) primer pair (OZ 1490 (+): gacaagaccacgccgtatt (SEQ ID NO: 9), OZ3980 (-): tgcatctggttgatggtgtc (SEQ ID NO: 10)) in the table, purified and recovered, and sent to Shanghai sanny Co., ltd for sequencing to verify the correctness of the recombinant virus.

Sequencing results showed that: rHN/XJ, rHN/XJ/NXGH and rHN/XJ/MSGH recombinant FMDV all contain the intended substitutions, indicating that the present invention successfully constructs recombinant FMDV containing target gene substitutions.

2. Indirect immunofluorescence

When BHK-21 monolayer cells grow to 70% -80% full, rHN/XJ, rHN/XJ/NXGH and rHN/XJ/MSGH recombinant viruses are inoculated respectively. The expression of 3A protein was detected by indirect immunofluorescence 6h after virus inoculation. The method comprises the following specific steps: (1) The cells inoculated with the virus are discarded, rinsed 3 times with PBS (0.01 mol/L pH 7.2), added with 4% ice-cold paraformaldehyde and fixed for 30min at room temperature; (2) rinsing 3 times with PBS, adding 5% BSA, and blocking for 30min at room temperature; (3) After PBS rinsing for 3 times, adding 1:500 dilution of anti-FMDV nonstructural protein 3A monoclonal antibody 3A24 respectively, and incubating for 1h at 37 ℃; (4) Rinsing 5 times by PBS, adding FITC-labeled IgG secondary antibody diluted by 1:100, and incubating for 1h at 37 ℃; (5) Rinsing 5 times with PBS, adding 0.5 μg/ml DAPI for 10min, washing 5 times with PBS, removing excessive DAPI, photographing under confocal fluorescence microscope, and setting normal cell control.

The results show that: BHK-21 cells inoculated with rHN/XJ, rHN/XJ/NXGH and rHN/XJ/MSGH all can act with the 3A monoclonal antibody to generate specific green fluorescence, and no visible fluorescence can be seen by the control cells acting with the 3A monoclonal antibody (see figure 5), which shows that the successful construction of 3 recombinant FMDV by the invention, the replacement of L+P1 or G-H loop genes does not affect the rescue of infectious recombinant FMDV.

3. Electron microscope observation

And (3) respectively proliferating 100mL of FMDV rHN/XJ, rHN/XJ/NXGH and rHN/XJ/MSGH in BHK-21 cells, freezing and thawing for 2-3 times, adding BEI for inactivation, centrifuging at 12000rpm/min for 1h, collecting virus supernatant, and centrifuging at 35000rpm/min for 3h at 4 ℃. The centrifuged pellet was resuspended in PBS (ph=7.6) buffer and visualized by electron microscopy after negative staining. And (3) the observation result of the electron microscope shows that: the morphology of the 4 recombinant viruses was identical, with the morphology of FMDV, with approximately 25nm diameter, spherical virus particles (FIG. 6).

Example 4

Growth characteristics of recombinant viruses

1. Genetic stability analysis to rescue viruses

3 transfected supernatants prepared in example 3 were inoculated into T25 cell flasks filled with BHK-21 cells at an inoculum size of 10%, cells were harvested when 100% of cells inoculated with transfected supernatant showed typical CPE, serial passages were continued under the same conditions after repeated freeze thawing for 3 times, the time for 100% of cells inoculated with each virus showed typical CPE after passage 5 was observed, and RT-PCR was performed on passage 5 and 10 viruses to examine the change in G-H loop amino acid of the rescued virus. Results of serial passages are indicated: the time of appearance of typical CPE tends to be stable after the 3 rescuing recombinant viruses are continuously transferred to the 5 th generation, the time of appearance of CPE of 100% of cells after the parent viruses rHN/XJ are infected with the cells is about 48H, the time of appearance of CPE of 100% of cells after the cells are infected with the rHN/XJ/NXGH viruses is about 12H, and the time of appearance of CPE of 100% of cells after the cells are infected with the rHN/XJ/MSGH viruses is about 48H as with the parent viruses, which indicates that the replacement of FMDV O/NXYCh/CHA/2018G-H significantly shortens the time of appearance of CPE of 100% of cells caused by recombinant FMDV. The time for CPE to appear in 100% of the cells after passage 5 of the recombinant virus is shown in table 1. The sequence determination results of the 5 th generation G-H gene and the 10 th generation G-H gene of the rHN/XJ/NXGH recombinant virus show that the recombinant virus is transmitted to the 10 th generation G-H ring without any change.

TABLE 1 time after passage 5 of the recombinant virus when 100% of the cells appeared to be typical CPE (h)

Virus (virus)

Generation P5

Generation P6

Generation P7

P8 generation

Generation P9

Generation P10

rHN/XJ

48h

rHN/XJ/NXGH

12h

rHN/XJ/MSGH

48h

2 one-step growth curve of recombinant virus

The 7 th generation rHN/XJ, rHN/XJ/NXGH and rHN/XJ/MSGH viruses were diluted in 10 series, then the different dilutions of viruses were inoculated with a single layer of grown BHK-21 cells (200. Mu.l/well, 6-well plate) respectively, placed in a 37℃incubator, shaken once every 10min, added with 2mL of an gum tragacanth mixture (one 2 XMEM, one 1.2% gum tragacanth, 1% serum) after 1h, and after 48h the broth was aspirated, washed 1-2 times with PBS, and then fixed with a fixing solution (50% acetone+50% methanol) at room temperature for 30min, and then crystal violet stained for 1h, after washing with clear water, plaque forming units (PFU/mL) of each virus were calculated. Recombinant virus of 7 th generation at 1×10 ⁶ PFU/mL virus infection was inoculated with a single layer of BHK-21 cells (25 mL flask), the inoculated virus solution was adsorbed for 1 hour, and after washing 2 times with MEM, 5mL of MEM medium was added to the flask, and the flask was incubated at 37℃for further incubation. Samples were collected 4h, 8h, 12h, 16h and 20h after inoculation, and after 3 times of repeated freeze thawing, virus titer (PFU/mL) was measured on BHK-21 monolayer cells (6 well plate) as described above (experiment was performed 2 times of repetition), and a one-step growth curve of the virus was drawn.

The results show that: compared with the parent virus rHN/XJ, the recombinant virus inserted into the FMD epidemic strain O/NXYCh/CHA/2018G-H significantly improves the replication titer of the recombinant FMDV within 4H-20H after infecting cells, while replacing the G-H loop of the vaccine strain O1/Manisa/TUR/69 does not improve the replication titer of the recombinant FMDV at different infection times (see FIG. 7). This suggests that the effect of the insertion of the G-H loop amino acid on FMDV replication levels is different.

Example 5

Preparation method of FMDV inactivated vaccine

1. Proliferation, inactivation and purification of FMDV

Recombinant virus rHN/XJ/NXGH and parental virus rHN/XJ were used as controls to inoculate 100% confluent monolayer adherent BHK-21 cells (175 mL cell flask, 27mL receiving solution+3 mL virus solution) and incubated in a 37℃incubator, and when 100% of the cells exhibited typical CPE, the viruses were harvested, each approximately 500mL. After repeating freeze thawing of the collected virus liquid for 3 times, the collected virus liquid was centrifuged at 6000rpm/min at 4℃for 1 hour to remove cell debris. The collected viral supernatants were inactivated with 1% -1.2% BEI at 30℃for 28h. And carrying out safety inspection of the inactivated virus antigen by using a milk mouse and cells for blind transmission for 4 generations. And (3) purifying the virus particles by a sucrose density gradient centrifugation method after the virus particles are qualified, and measuring the 146S content of the virus antigen by a liquid chromatograph. The antigen concentration was diluted to 12. Mu.g/mL with PBS solution at pH 7.6.

2. Vaccine formulation

And (3) placing the ISA201 adjuvant in a 37 ℃ constant-temperature water bath for preheating, slowly adding a proper amount of the adjuvant into the virus antigen according to the ratio of antigen to adjuvant volume ratio=46:54, slowly shaking until the antigen and the adjuvant are not layered, and placing the prepared vaccine product (146S antigen concentration is 6 mug/mL) in a temperature of 4-8 ℃ for later use.

Example 6

Immune animal experiments of different recombinant virus strains

10 healthy susceptible pigs (O-type foot-and-mouth disease liquid phase blocking ELISA antibody titer < 1:6,3ABC antibody negative) of 90 days old are selected and divided into groups A and B2, and 5 pigs in each group. Group A vaccinated with parental virus rHN/XJ vaccine and group B vaccinated with rHN/XJ/NXGH virus vaccine. Auricular muscle is injected at a dose of 2 mL/head. All pigs were immunized for 14, 21 and 28 days, serum was collected, and antibody titers of the immunized serum were detected with an O-type foot-and-mouth disease virus liquid phase blocking ELISA (LPB-ELISA) kit (institute of veterinary science, langzhou, national academy of agricultural sciences) as follows:

(1) on the U-shaped reaction plate, diluting serum to be detected by PBST multiple ratio to 50 mu L/hole; positive control serum was diluted from 1:2 to 1:256 at column 11; simultaneously setting negative control serum, and diluting from 1:2 to 1:4; a 4-well whole virus control was set.

(2) The virus antigen was diluted to working concentration with PBST, added to each well at 50 μl/well, sealed and incubated for 1.5h with shaking at 37 ℃.

(3) The antigen-antibody mixture was transferred from the U-shaped reaction plate to the ELISA plate coated with the foot-and-mouth disease type O rabbit antibody in order, 50. Mu.L/well, sealed and incubated for 1h at 37℃with shaking.

(4) The plates were washed 5 times with PBST, patted dry, added with foot-and-mouth disease O-type guinea pig antibody working solution (red) at 50. Mu.L/well, sealed and incubated for 30min at 37℃with shaking.

(5) The plates were washed 5 times, dried, and incubated with 50. Mu.L/Kong Jiatu of anti-guinea pig IgG-HRP working solution (blue), sealing plates, shaking, and incubating at 37℃for 30min.

(6) Washing the plate 5 times, and drying. The TMB substrate A solution and the TMB substrate B solution were mixed uniformly in a ratio of 1:1, and 50. Mu.L/well of the mixed substrate solution was added and the mixture was allowed to stand at 37℃for 15 minutes.

(7) After the reaction was completed, 50. Mu.L/well of a stop solution was added to terminate the reaction, and the OD450nm was read on an microplate reader.

(8) Antibody titer determination: virus antigen control 4 wells, highest and lowest OD were discarded _450nm Value, calculate average OD of remaining 2 wells _450nm The value divided by 2 is the critical value, which represents the control OD blocking 50% of the reaction _450nm Values. Detection hole OD _450nm The value is greater than the critical value and is a negative hole, and is smaller than the critical value and is a positive hole. If the critical value and the OD of the positive well with the highest dilution factor are the same _450nm The highest dilution multiple of the positive hole of the tested sample is taken as the antibody titer of the serum with the same value; if the critical value is at two dilution holes OD _450nm Between the values, the antibody titers were taken as the anti-log median of the dilution of the adjacent positive and negative wells. Wherein the antibody titer measured 28 days after immunization is greater than 1:128, the immunized animal can be basically protected.

The results show that: rHN/XJ/NXGH and rHN/XJ virus vaccine immunized pigs have substantially similar average LPB-ELISA antibody titers after 14, 21 and 28 days, and liquid phase antibodies generated by induction of the two vaccines after 28 days of immunization are greater than 1:128, which indicates that the recombinant virus containing FMDV O/NXYCh/CHA/2018G-H loop genes has good immunogenicity as the parent virus, and the replacement of the G-H loop does not affect the antigenicity of the virus (see Table 2).

Table 2 FMDV vaccine immunization of pigs LPB-ELISA antibody titers

As shown by the results of the above examples, the replacement of the G-H loop gene of FMDV O/NXYCh/CHA/2018 on the backbone of the parent virus rHN/XJ significantly shortens the time for which 100% of cells have typical CPE to 12H, and increases the replication titer by more than 5 times after the virus infects the cells for 12H, but the replacement of the G-H loop gene of O1/Manisa/TUR/69 does not shorten the time for which 100% of cells have typical CPE, nor significantly improve the replication titer of recombinant FMDV. Animal experiments also showed that: the recombinant virus rHN/XJ/NXGH has good immunogenicity as the parent virus, and the replacement of the G-H loop gene of the O/NXYCh/CHA/2018 virus does not affect the antigenicity of the recombinant virus.

In conclusion, the replacement of the G-H loop gene of the O/NXYCh/CHA/2018 virus greatly shortens the time for 100% of cells infected by the recombinant virus rHN/XJ/NXGH to generate typical CPE, obviously improves the replication titer of the virus, and maintains the immunogenicity of the parent virus, so that the recombinant virus rHN/XJ/NXGH is considered to have potential as an FMD vaccine candidate strain and is used for effective prevention and control of O-type FMD in China.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Sequence listing

<110> the animal doctor institute of Lanzhou, china academy of agricultural sciences

<120> an O-type foot-and-mouth disease virus strain with improved replication titer, and construction method and application thereof

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2811

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

atgaacacga ctgactgttt tatcgctctg ttacacgttc tcagggagat taaagcactg 60

tttctgtcac gaacacaagg gaaaatggaa ttcacacttc acaacggtga aaagaaggtc 120

ttctacgcca gacccaacaa ccacgacaat tgctggttga acgccatcct ccaactgttc 180

aggtacgtcg acgaaccctt cttcgactgg gtctacgact cacctgagaa ccttactctt 240

gaggcgatca ggcgactcga agaaattact ggtcttgagc tacacgaggg tggaccaccc 300

gcccttgtcg tctggaacat taagcacttg ctctgcaccg gaatcggcac cgcttcgcgg 360

cctagcgagg tgtgtatggt ggacggtaca gacatgtgct tggccgactt ccacgctggt 420

atctttctga agggacaaga ccacgccgta ttcgcctgtg tcacctccga cgggtggtac 480

gcgattgacg acgaggattt ttacccgtgg acaccagacc cggctgacgt tttggttttt 540

gttccgtacg atcaagaacc acttaatgga gaatggaaag caaaggtcca gaagcggctt 600

aagggcgccg ggcaatccag cccgacgacc gggtcacaga accaatcagg caacactgga 660

agcatcatta acaactacta catgcagcaa taccagaact ccatggacac acagcttggt 720

gacaacgcca ttagcggagg ctccaacgag ggttctacgg ataccacctc cacccacacg 780

aacaacaccc agaacaacga ctggttttca aaactggcca actccgctct cagcggtctc 840

ttcggtgctc ttctcgccga caaaaagaca gaggaaacta ccctcctcga ggaccgcatt 900

ctcaccaccc gcaacggaca cacgacctcg acaacccagt cgagcgtcgg ggtgacgtac 960

gggtatgcaa cagctgagga cttcgtgagc gggcccaaca cctctggtct tgagaccagg 1020

gttgtccagg ccgaacggtt cttcaaaacc cacttgttcg actgggtcac cagtgacccg 1080

tttggacggt gccacatgtt ggagctcccg actgaccaca aaggcgtcta cggcagccta 1140

accgactcgt acgcgtatat gaggaacggt tgggacgttg aagtcaccgc ggtgggaaac 1200

cagttcaacg gaggctgctt gttggtggca atggtaccag agctttgttc catcaacaag 1260

agagagctgt accagctcac acttttcccc caccagttca ttaacccacg gacgaacatg 1320

acggcacaca tcactgtgcc ctacgttggc gtcaacaggt acgaccaata caaggtgcat 1380

aaaccctgga cccttgttgt catggtcgtg gcccccttga cggtcaacaa tgagggtgct 1440

ccgcaaatca aggtgtatgc caacatcgcc cccaccaacg tttacgttgc gggtgaattc 1500

ccttccaagg aggggatctt ccccgtggca tgcagcgacg gttacggcgg tttggtgacc 1560

acggacccaa agacggcgga ccccgtgtac gggaaagtgt tcaacccccc ccgtaacttg 1620

ttgccagggc ggtttacaaa cctccttgat gtggccgagg cgtgtcccac gttcctacac 1680

ttcgaaggtg acgtaccgta cgtgaccacg aagacggact cagacagggt gttggcccaa 1740

ttcgacctgt ctctggcagc aaagcacatg tcgaacactt tcctcgcggg tcttgcccag 1800

tattacacac agtacagcgg caccatcaac ctacacttca tgttcacagg gcccaccgat 1860

gcgaaggcgc gctacatgat tgcgtatgcc cctcctggca tggaaccgcc gaaaacgcct 1920

gaggccgccg cacactgcat tcacgctgag tgggacacag ggctgaattc aaagttcaca 1980

ttttcaattc cctacctttc ggccgctgac tacgcgtaca ccgcgtccga cgtcgccgaa 2040

accacaaacg tgcagggatg ggtctgcttg ttccagataa cacacgggaa agccgacggc 2100

gatgctctga ttgtgctagc tagtgctggc aaagactttg acctacgcct accggttgac 2160

gcccgcacgc agaccacctc tgcgggcgag tccgcggacc ccgttaccgc caccgttgag 2220

aattacggtg gtgagacaca ggtccagaga cgccagcaca cggatatctc gtttatacta 2280

gacagatttg tgaaagtcac accaaaagac caaatcaatg tgctggacct gatgcagatc 2340

cctgcccaca ctttagtagg ggccctcctg cggacggcca cctactactt ctccgacttg 2400

gagttggctg tcaaacacaa gggtgatctc acctgggttc cgaacggggc ccctgagaca 2460

gctttggaca acaccaccaa cccaacagct taccacaaag caccactcac gcgactggcc 2520

ttgccttaca cggccccaca ccgcgtctta gcgaccgtct acaacggaag ttgtaagtac 2580

agtggcgccc gcgtgagcaa cgtgaggggt gaccttcaag tgttggctca gaaggcagaa 2640

agagctctgc ccacctcctt taactatggt gccattaagg caacccgggt gactgagtta 2700

ctctaccgaa tgaagagagc cgagacatac tgccccaggc cccttcttgc cattcaaccg 2760

agtgacgcta gacacaagca gaagatcgtg gcacccgcaa aacagcttct g 2811

<210> 2

<211> 2811

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

atgaatacaa ctgactgttt tattgctctg ctgcacgctc tcagagagat aaaaacactg 60

tttctttcac gaacacaagg aaagatggaa ttcacacttc acaacggtga gaaaaagact 120

ttctattcta ggcccaacaa ccacgacaat tgttggttga acaccatcct ccaattgttt 180

aggtacgtcg atgaaccttt cttcgactgg gtctatgaat cacctgaaaa cctcactctt 240

gaggcgattg ggcaactgga agaactcact ggtcttaagc tgcacgaggg tgggccaccc 300

gctctcgtca tttggaacat caagcatttg ctccacaccg gaattggcac tgcctcgcga 360

cccagcgagg tgtgcatggt cgatggcacg gacatgtgtt tggctgactt ccacgctggc 420

atcttcctga aagggcaaga gcacgctgtg ttcgcctgcg tcacctccaa cgggtggtac 480

gcgatcgacg acgaggactt ctacccctgg acgcctgatc cgtccgacgt tctggtgttt 540

gtcccgtacg atcaagaacc actcaacgga gagtggaaga caaaggttca aaagcgactc 600

aaaggagccg ggcaatccag cccggcaact gggtcgcaga atcagtcagg caacactgga 660

agtattatca acaactacta catgcagcag taccagaact ctatggacac acaacttgga 720

gacaatgcca ccagcggagg atccaatgag gggtccacag acaccacttc cacccacaca 780

accaacacac aaaacaatga ttggttctca aaactggcca gttctgcttt cagcggtctg 840

tttggcgctc ttctcgccga caagaaaacc gaggagacca ctctcctcga ggaccgtatc 900

ctcactaccc gcaacggaca cacgacctcg acaacccagt cgagcgtcgg agttacttac 960

gggtacgcaa cagctgagga ttttgtgagc gggccaaaca catctggtct cgagaccagg 1020

gttgtgcagg cagagcggtt cttcaaaacc catctgttcg actgggtcac cagtgatcca 1080

ttcgggcggt gccacctgct agaacttcca actgaccaca aaggggtcta cggcggcctg 1140

actgactctt atgcttacat gagaaacggt tgggacgttg aggtcactgc agtgggaaac 1200

cagttcaacg gaggttgtct actggtggcc atggtgccag aactttgctc catccagaag 1260

agagagctgt accaacttac gctcttccct catcagttca tcaaccctcg cacgaacatg 1320

acggcgcaca tcactgtgcc ctttgttggc gtcaaccgct acgaccagta caaagtgcac 1380

aagccttgga cccttgtggt catggtcgtg gcccctttga ctgtcaacaa cgaaggtgcc 1440

ccacagatca aggtttacgc caacatcgcc cctaccaacg tccacgttgc gggtgagttc 1500

ccttccaaag aagggatttt ccccgtggcg tgcagcgacg gttacggcgg tctggtgacc 1560

actgacccga agacggctga ccccgcctac gggaaagtgt ttaacccccc tcgcaacatg 1620

ttgcccggcc ggttcaccaa cttccttgat gtggctgagg cgtgtcctac gtttctgcac 1680

tttgaaggtg acgtaccgta cgtgaccacg aagacagatt cggacagggt gctcgctcag 1740

tttgacctgt ctttggcagc aaagcacatg tcaaacacct tcctggcagg tctcgcccag 1800

tactacacac agtacagcgg caccatcaac ctgcacttca tgttcacagg ccccactgac 1860

gcgaaagcgc gttacatgat tgcatatgcc ccgcctggca tggagccgcc taaaacacct 1920

gaggcggctg ctcactgcat tcacgcagag tgggacacag ggctgaactc aaagttcaca 1980

ttttcaatcc cctacctttc ggcggctgat tacgcgtaca ccgcgtctga cgctgccgaa 2040

accacaaatg tgcagggatg ggtgtgcttg ttccaaataa cacacgggaa agccgacggt 2100

gacgcactgg tcattctggc gagcgccggt aaggactttg agttgcgttt gccggttgat 2160

gcccgcacac agaccacctc cacaggtgag tccgctgatc ccgtgaccac caccgttgag 2220

aactacggtg gagagacaca ggtccagaga cgtcaacaca ccgacgtttc tttcattttg 2280

gacagatttg tgaaagtaac accgaaagac caaatcaatg tgttggacct gatgcaaacc 2340

cctgctcaca ctttggtagg cgcgctcctc cgcaccgcca cttactactt cgcagaccta 2400

gaagtggcag tgaagcacga gggcaacctc acctgggtcc cgaacggggc gcccgaggcg 2460

gcgctggaca acaccaccaa cccgacggcc taccacaagg caccgctcac ccgtcttgct 2520

ctgccttaca cagcaccaca ccgtgttctg gctaccgttt acaacgggaa ctgcaagtat 2580

ggcgagggcg ctgtgaccaa cgtgaggggt gacttgcaag tgttggctca gaaggcagca 2640

agaacgctgc ccacctcctt taactacggt gccatcaagg ctacccgggt gactgaactg 2700

ctttaccgca tgaagagggc cgaaacatac tgccctcggc ctctgctggc cattcacccg 2760

gaacaagcca gacacaagca gaagattgtg gcacctgtga aacagttgtt g 2811

<210> 3

<211> 90

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

aacgggaact gcaagtatgg cgagggcgct gtgaccaacg tgaggggtga cttgcaagtg 60

ttggctcaga aggcagcaag aacgctgccc 90

<210> 4

<211> 90

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

aacgggaact gcaaatacac cgggggcccg ctgcccaacg tgagaggcga tctccaagtg 60

ctggcgccga aggcggcgag gccgctgcct 90

<210> 5

<211> 90

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

aacgggaact gcaagtatgg tgacggcacg gtggccaatg tgagaggtga cctgcaagtg 60

ttggcccaga aggcggcgag agcgctgcct 90

<210> 6

<211> 30

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 6

Asn Gly Asn Cys Lys Tyr Gly Glu Gly Ala Val Thr Asn Val Arg Gly

1 5 10 15

Asp Leu Gln Val Leu Ala Gln Lys Ala Ala Arg Thr Leu Pro

20 25 30

<210> 7

<211> 30

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 7

Asn Gly Asn Cys Lys Tyr Thr Gly Gly Pro Leu Pro Asn Val Arg Gly

1 5 10 15

Asp Leu Gln Val Leu Ala Pro Lys Ala Ala Arg Pro Leu Pro

20 25 30

<210> 8

<211> 30

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 8

Asn Gly Asn Cys Lys Tyr Gly Asp Gly Thr Val Ala Asn Val Arg Gly

1 5 10 15

Asp Leu Gln Val Leu Ala Gln Lys Ala Ala Arg Ala Leu Pro

20 25 30

<210> 9

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

gacaagacca cgccgtatt 19

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

tgcatctggt tgatggtgtc 20

Claims

1. An O-type foot-and-mouth disease virus strain with improved replication titer is characterized in that the O-type foot-and-mouth disease virus strain takes recombinant foot-and-mouth disease virus rHN/XJ as a skeleton, and G-H ring antigen epitope genes of O/NXYCh/CHA/2018 strains are embedded;

the recombinant foot-and-mouth disease virus rHN/XJ is obtained by taking a foot-and-mouth disease vaccine strain O/HN/CHA/93 as a skeleton and embedding an L+P1 gene of an epidemic strain O/XJ/CHA/2017;

the nucleotide sequence of the G-H loop antigen epitope gene of the O/NXYCh/CHA/2018 strain is shown as SEQ ID NO:4, a step of;

the nucleotide sequence of the L+P1 gene of the O/XJ/CHA/2017 strain is shown in SEQ ID NO:2.

2. the method for constructing an O-type foot-and-mouth disease virus strain with improved replication titer as claimed in claim 1, comprising the steps of:

1) Taking an O/HN/CHA/93 strain half-length plasmid pSK-Z123 as a skeleton, and artificially synthesizing a recombinant vector containing foot-and-mouth disease virus O/XJ/CHA/2017 strain L+P1 genes to obtain a pSK-Z123XJLP1 recombinant plasmid;

2) Taking the pSK-Z123XJLP1 recombinant plasmid in the step 1) as a framework, and embedding G-H loop genes of O/NXYCh/CHA/2018 strains to obtain pSK-Z123XJLP1/NXGH;

3) By usingSpeI andBglII, digesting the pSK-Z123XJLP1/NXGH in the step 2) to obtain an enzyme section;

4) Cloning the enzyme section into a pOFS plasmid to obtain PQSE;

3. The method of construction according to claim 2, wherein step 3) is saidSpeI andBglII digestive system: 10 XBuffer H10. Mu.L,BglⅡ4 μL、Spe I4. Mu.L, recombinant plasmid 4. Mu.g, ddH ₂ O was replenished to 100 μl;

the enzyme digestion system is incubated for 1-2 h at 37 ℃.

4. The method according to claim 2, wherein the cloning site of the pOFS plasmid in step 4) isSpeⅠ/BglⅡ。

5. The method of claim 2, further comprising identifying PQSE after cloning in step 4);

the identification method adoptsPstThe enzyme I carries out enzyme digestion on the recombinant plasmid PQSE, three bands of 838bp,4250bp and 6050bp are cut out, the size of the recombinant plasmid PQSE is initially correct, then sequencing analysis is carried out on the recombinant plasmid PQSE which is identified by enzyme digestion, and the result shows that the recombinant plasmid PQSE is on the framework embedded with the O/XJ/CHA/2017 strain L+P1 gene, and the O/NXYCh/CHA/2018 strain G-H loop gene is also embedded.

6. The use of the O-type foot-and-mouth disease virus strain with increased replication titer of claim 1 or the O-type foot-and-mouth disease virus strain obtained by the construction method of any one of claims 2 to 5 in the preparation of a vaccine for preventing and controlling foot-and-mouth disease.

7. A vaccine for preventing and controlling foot-and-mouth disease is characterized by comprising an adjuvant and the O-type foot-and-mouth disease virus strain with improved replication titer according to claim 1 or the O-type foot-and-mouth disease virus strain obtained by the construction method according to claim 2-5.