CN115896043B

CN115896043B - O-type foot-and-mouth disease vaccine candidate strain, construction method and application thereof

Info

Publication number: CN115896043B
Application number: CN202210793288.7A
Authority: CN
Inventors: 李平花; 孙普; 查晶晶; 卢曾军; 袁红; 李冬; 包慧芳; 曹轶梅; 白兴文; 付元芳; 马雪青; 李坤; 赵志荀; 刘在新
Original assignee: Lanzhou Veterinary Research Institute of CAAS
Current assignee: Lanzhou Veterinary Research Institute of CAAS
Priority date: 2022-07-07
Filing date: 2022-07-07
Publication date: 2023-06-20
Anticipated expiration: 2042-07-07
Also published as: CN115896043A

Abstract

The invention discloses an O-type foot-and-mouth disease vaccine candidate strain, a construction method and application thereof, and belongs to the technical field of biological products. The invention uses the reverse genetic operation technology of foot-and-mouth disease virus, takes the infectious clone of the current epidemic strain O/XJ/CHA/2017L+P1 gene of the chimeric foot-and-mouth disease virus as a skeleton, further replaces the equivalent gene with the G-H loop gene of the foot-and-mouth disease virus O/SCGH/CHA/2016, and constructs recombinant virus rHN/XJ/SCGH. Compared with the parent virus rHN/XJ, the time for 100% infection cytopathy caused by the recombinant virus rHN/XJ/SCGH is shortened to 12 hours, the replication titer is obviously improved, the recombinant virus vaccine immunized pig can generate high-level and protective cross neutralizing antibodies to four epidemic viruses of foot-and-mouth disease type O, and the antigen spectrum is expanded. Therefore, the recombinant virus rHN/XJ/SCGH constructed by the reverse genetic operation technology is suitable for serving as an FMD vaccine candidate strain and is used for effectively preventing and controlling the current O-type foot-and-mouth disease in China.

Description

O-type foot-and-mouth disease vaccine candidate strain, construction method and application thereof

Technical Field

The invention belongs to the technical field of biological products, and relates to an O-type foot-and-mouth disease vaccine candidate strain, a construction method and application thereof.

Background

Foot-and-mouth disease (FMD) is a virulent infectious disease of major livestock infections such as pigs, cattle and sheep. The disease is popular in China for a long time, and has huge harm to livestock breeding industry. For the last 10 years, A, O type FMD is mainly popular in China, wherein A type FMD tends to be controlled, and O type FMD still seriously jeopardizes livestock breeding industry in China. Analysis of recently popular Foot-and-mouth disease viruses (FMDV) revealed four lineage strains, mainly of three topologies (middle east-south asia (ME-SA), southeast asia (SEA) and classical chinese (cathiay)), mya-98 lineage (SEA), panAsia lineage (ME-SA), ind-2001 lineage (ME-SA) and cathiay lineage, respectively. The current complex situation that the O-type FMD multi-lineage virus strains are popular in China exacerbates the variation of viruses, so that new variant strains are continuously generated, epidemic situation is frequently caused, and unprecedented serious challenges are provided for the prevention and control of the FMD in China.

FMDV is a picornavirus, has multiple serotypes, and is highly variable in genes and antigens, making FMD difficult to control. FMDV of different serotypes lacks cross-immune protection, and even though there is a large difference in antigenicity of different viruses of the same serotype, the extent of serological cross-reactivity is different. For FMDV of the same serotype, when the viral genetic variation accumulates to a certain extent, it will result in a change in viral antigenicity, thereby reducing the antigen-matching or antigen-mismatch of the vaccine in question with the epidemic strain, resulting in a reduced immunoprotection efficacy or immune failure of the vaccine. For example, O/Mya-98 lineage strains have been popular since 2010, regular amino acid variation in structural protein VP1 has occurred, resulting in reduced antigen matching of field-epidemic strains and vaccine strains. The epidemic pig-philic Cathay lineage strain in China has been inherited into four branches (old pig virus, new pig virus-1, new pig virus-2, new pig virus-3), and the existing vaccine strain is not matched with the antigen of the new pig virus-3 branch strain in recent years. Therefore, aiming at the complex situation that the current O-type multiple-lineage virus strains in China are popular together, the screening of vaccine candidate strains which are highly matched with antigens of all the current O-type virus strains is urgently needed, and the vaccine candidate strains are used for effective prevention and control of FMD in China.

The FMDV structural protein VP1 contains a highly variable G-H ring, and the ring is the most important epitope for inducing the organism to generate neutralizing antibodies, and plays a very important role in vaccine immune protection. The research shows that the G-H of different FMDV chimeric can expand the antigen spectrum of FMD vaccine. In view of this, in order to expand the antigen spectrum of the O-type FMD vaccine, the present invention constructs recombinant FMDV by reverse genetic manipulation technology of FMDV, further replaces G-H loop genes of the O-type foot-and-mouth disease classical vaccine strain and the Cathay lineage virus strain prevalent in our country on the backbone of chimeric FMDV O/XJ/CHA/2017 (Ind-2001 lineage) virus leader protein L and structural protein P1 recombinant virus, thereby researching its potential as an O-type FMD vaccine candidate strain.

Disclosure of Invention

The invention aims to provide an O-type FMD vaccine candidate strain, a construction method and application thereof, wherein the time for 100% of cytopathy caused by constructed recombinant FMDV is shortened to 12 hours, the replication titer is obviously improved, and the recombinant virus vaccine immunized pig can generate high-level and protective cross neutralizing antibodies to epidemic viruses of four foot-and-mouth disease types O (Mya-98 pedigree, panasia pedigree, ind-2001 pedigree and Cathay pedigree), so that the antigen spectrum is expanded.

The O-type FMD vaccine candidate strain is obtained by taking a full-length infectious clone pQSA of recombinant FMDV rHN/XJ as a skeleton and embedding G-H ring genes of FMDV O/SCGH/CHA/2016; the full-length infectious clone pQSA of the recombinant FMDV rHN/XJ is obtained by taking the full-length infectious clone pOFS of an FMD vaccine strain O/HN/CHA/93 as a framework and embedding the L+P1 gene of an FMD epidemic strain O/XJ/CHA/2017. The nucleotide sequence of the G-H loop gene of the FMDV O/SCGH/CHA/2016 strain is shown as SEQ ID NO: shown at 5. The nucleotide sequence of the L+P1 gene of the FMDV O/XJ/CHA/2017 strain is shown as SEQ ID NO:2.

the construction method of the O-type FMD vaccine candidate strain comprises the following steps:

(1) Artificially synthesizing a recombinant plasmid pSK-Z123XJLP1 containing the FMD epidemic strain O/XJ/CHA/2017L+P1 genes by taking an FMD vaccine strain O/HN/CHA/93 half-length plasmid pSK-Z123 as a template;

(2) Artificially synthesizing recombinant plasmid pSK-Z123XJLP1/SCGH containing FMDV O/SCGH/CHA/2016 strain G-H ring gene chimeric by taking the recombinant plasmid pSK-Z123XJLP1 synthesized in the step (1) as a template; the synthesized plasmid is digested by SpeI and BglII restriction enzymes, and then a target fragment of about 5400bp is recovered and inserted into the pOFS plasmid digested by SpeI and BglII restriction enzymes, so as to obtain a recombinant full-length plasmid pQSQ;

(3) And transfecting a NotI-linearized recombinant full-length plasmid pQSQ into BSR/T7 cells, and rescuing the recombinant FMDV to obtain an O-type FMD vaccine candidate strain rHN/XJ/SCGH.

The invention also provides application of the O-type FMD vaccine candidate strain obtained by the construction method in preparation of prevention and control FMD vaccine. Experiments show that the skeleton of the same virus is replaced by G-H containing different amino acid compositions, the influence on CPE of 100% of infected cells is different, and the influence on the replication level of foot-and-mouth disease viruses is different. Parental virus rHN/XJ and recombinant virus rHN/XJ/targh vaccine immunized pigs can only produce high levels of protective cross-neutralizing antibodies to three lineage epidemic viruses O/XJ/CHA/2017 (Ind 2001 lineage), O/Tibet/99 (PanAsia lineage) and O/NXYCh/CHA/2018 (Mya-98 lineage), whereas recombinant virus vaccine rHN/XJ/SCGH immunized pigs can produce high levels of protective cross-neutralizing antibodies to four lineage epidemic viruses O/XJ/CHA/2017, O/Tibet/99, O/NXYCh/CHA/2018 and O/SCGH/CHA/2016 (cathy lineage), thus recombinant virus vaccine rHN/XJ/SCGH expands the antigen spectrum, potentially for the preparation of vaccines currently preventing FMD of type O.

In conclusion, the invention utilizes FMDV reverse genetic manipulation technology, takes the infectious clone of chimeric FMDV O/XJ/CHA/2017 virus L+P1 gene as a skeleton, constructs the recombinant virus rHN/XJ/SCGH for replacing the Cathay epidemic toxin O/SCGH/CHA/2016G-H gene in China, shortens the time for causing 100% of infected cytopathy to 12 hours, obviously improves the replication titer, and animals immunized by the recombinant virus vaccine can generate high-level and protective cross neutralizing antibodies for four epidemic viruses of FMD, thereby expanding antigen spectrum. Therefore, the recombinant virus rHN/XJ/SCGH constructed by the reverse genetic manipulation technology is suitable for serving as an FMD vaccine candidate strain and is used for effectively preventing and controlling the current O-type FMD in China.

Drawings

FIG. 1 is a schematic diagram of the genome of a FMDV recombinant full-length plasmid (dark grey parts indicate the L+P1 gene of FMDV O/XJKS/2017/CHA strain, light grey indicates the position of G-H);

FIG. 2 is a graph of the restriction map of the recombinant plasmid PstI (M: DNA standard marker;1: PQSA plasmid was digested with pstI; 2: PQSD plasmid was digested with pstI; 3: PQSQ plasmid was digested with pstI);

FIG. 3 is an alignment of the amino acids encoded by the G-H loops of the full length recombinant plasmid;

FIG. 4 shows BSR/T7 cells after 60h transfection of recombinant plasmid (A: normal BSR/T7 cells, B, C and D are BSR/T7 cells after 60h transfection of plasmids pQSA, pQSD and PQSQ, respectively);

FIG. 5 is an indirect immunofluorescence result;

FIG. 6 is an electron micrograph of recombinant FMDV (left: rHN/XJ; middle: rHN/XJ/TURGH; right: rHN/XJ/SCGH);

FIG. 7 is a one-step growth curve for recombinant viruses.

Detailed Description

The invention is further illustrated by the following examples.

The experimental methods used in the following examples are conventional methods unless otherwise specified.

Plasmid pOFS and half-length plasmid pSK-Z123 (see Pinghua Li et al, 2012 published articles Evaluation of a genetically modified foot-and-mouth disease virus vaccine candidate generated by reverse genetics, li et al BMC Veterinary Research 2012, 8:57) containing the complete gene of FMD vaccine strain O/HN/CHA/93 were used for construction of recombinant full-length plasmids. FMD epidemic strains O/SCGH/CHA/2016 (cathiay lineage, genBank KX 161429.1), O/Tibet/99 (PanAsia lineage, genBank AJ 539138), O/XJ/CHA/2017 (Ind-2001 lineage, genBank MF 461724.1)), O/NXYCh/CHA/2018 (Mya-98 lineage, genBank MH 791315.1) were stored in the national foot-and-mouth disease reference laboratory. The gene sequences of the viruses are queried in genebank. The method of artificially synthesizing the recombinant vector is not particularly limited, and artificial synthesis methods well known in the art may be employed. In the embodiment of the invention, the artificial synthesis of the recombinant vector is completed by Jin Wei Biotechnology Inc.

1. Construction of chimeric FMD epidemic Strain O/XJ/CHA/2017L+P1 Gene full-length clone

The recombinant half-length plasmid pSK-Z123XJLP1 (synthesized by Jin Wei Saprol. Biotechnology Co., ltd.) containing the L+P1 gene of the virus (O/XJ/CHA/2017) is designed and synthesized based on the L and P1 nucleotide sequences (SEQ ID NO: 2) of the O/XJ/2017/CHA virus strain published in Genebank by using the half-length plasmid pSK-Z123 of FMD vaccine strain O/HN/CHA/93 as a backbone. The plasmid was digested with SpeI and BglII restriction enzymes, and the fragment of interest of about 5400bp was recovered and inserted into the pOFS plasmid digested with the same enzymes to give the full-length plasmid pQSA of the chimeric O/XJ/CHA/2017 virus L+P1 gene. Wherein the SpeI and BglII digestion systems are as follows: 10 XBuffer H10 mu L, bgl II 4 mu L, spe I4 mu L, recombinant plasmid 4 mu g, ddH ₂ O was replenished to 100. Mu.L. The enzyme digestion system is incubated for 1-2 h at 37 ℃. pQSA was identified by cleavage with Pst I, resulting in the excision of the size bands of purpose of 838bp,4250bp and 6050bp, which were consistent with the expected size (see FIG. 2). The recombinant plasmid with correct enzyme digestion identification was sent to Jin Weizhi biotechnology limited company for sequence determination, and the result shows that the constructed recombinant plasmid contains expected substitution.

2. Construction of chimeric G-H loop FMDV recombinant full-length clone

The plasmid pSK-Z123XJLP1/TURGH containing O/TUR/5/2009G-H loop chimeric and the plasmid pSK-Z123XJLP1/TURGH containing O/SCGH/CHA/2016G-H loop chimeric were designed and synthesized based on the panda sub-lineage international vaccine strain O/TUR/5/2009 (GenBank KP 202878.1) published in Genebank and the G-H loop gene (amino acids 130-160 of VP 1) of the popular Cathay lineage FMDV O/SCGH/CHA/2016 in China (Jin Wei, shimadzu Biotechnology Co.). The synthesized plasmids were digested with SpeI and BglII restriction enzymes, respectively, and about 5400bp of the desired fragment was recovered, respectively, and inserted into pOFS plasmids digested with the same enzymes, to obtain recombinant full-length plasmids and pQSD and pQSQ (see FIG. 1). The 2 recombinant plasmids were identified by cleavage with PstI, and as a result, the desired bands (838bp, 4250bp and 6050 bp) were excised, which were consistent with the expected sizes (see FIG. 2). Wherein the SpeI and BglII digestion systems are as follows: 10 XBuffer H10 mu L, bgl II 4 mu L, spe I4 mu L, recombinant plasmid 4 mu g, ddH ₂ O was replenished to 100. Mu.L. The enzyme digestion system is incubated for 1-2 h at 37 ℃. The enzyme digestion is identified to be correctThe recombinant plasmid was sent to Jin Weizhi Biotechnology Inc. for sequencing, and the results indicated that the constructed recombinant plasmid contained the intended substitutions. Wherein the nucleotide sequences of the L+P1 genes of pOFS and pQSA are respectively shown in SEQ ID NO. 1 and SEQ ID NO. 2, the nucleotide sequences of the G-H loops of pQSA, pQSD and pQSQ plasmids are respectively shown in SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5, and the corresponding amino acid sequences are respectively shown in SEQ ID NO. 6, SEQ ID NO. 7 and SEQ ID NO. 8. The amino acid alignment of the recombinant full-length plasmid G-H loop gene is shown in FIG. 3.

TABLE 1 partial sequence names and viruses corresponding to recombinant plasmids

3. Rescue of marker viruses

QIAGEN Plasmid Midi Kits full-length recombinant plasmids pQSA, pQSD and pQSQ were prepared, and NotI was linearized and purified and recovered as transfection templates using a DNA fragment recovery kit. The routinely cultured single-layer BSR/T7 cells are grown to 70-80% by using liposome Lipofectamine ^TM 2000 mediated transfection (see protocol for specific procedures). 5h after transfection 2mL of DMEM medium containing 8% fetal bovine serum was added and incubated at 37℃with 5% CO ₂ The incubator continued to culture and cells were observed for cytopathic (cytopathogenic effect, CPE).

The results show that: typical CPE was present in all 3 full-length recombinant plasmids 60h after transfection of BSR/T7 cells, i.e.the cells in the fibrous distribution became larger and rounded (FIG. 4). Cells were harvested 68h after transfection, and after repeated freeze thawing 2 times, serial passaging was performed on BHK-21, -70 storage of each generation of virus for later use. The rescued genetically engineered viruses were named rHN/XJ, rHN/XJ/TURGH, and rHN/XJ/SCGH, respectively.

4. Identification of recombinant viruses

4.1, RT-PCR identification

The transfected supernatants were each extracted with RNAasy Mini Kit for total cytotoxic RNA, and primers OZ1490 (+)/OZ 3980 (-) (OZ 1490 (+): GACAAGACCACGCCGTATT), OZ3980 (-), were used: TGCATCTGGTTGATGGTGTC) amplifying the P1 gene fragments of the transfected supernatant respectively by RT-PCR, purifying and recovering the fragments, and then delivering the fragments to Shanghai Sanguis Limited company for sequencing to verify the correctness of the recombinant viruses. Sequencing results showed that: rHN/XJ, rHN/XJ/TURGH and rHN/XJ/SCGH recombinant viruses all contain target substitutions, demonstrating that the present invention successfully constructs recombinant FMDV containing the intended gene substitutions.

4.2 indirect immunofluorescence

When BHK-21 monolayer cells grow to 70% -80% full, rHN/XJ, rHN/XJ/TURGH and rHN/XJ/SCGH recombinant viruses are inoculated respectively. The expression of 3B protein was detected by indirect immunofluorescence 6h after virus inoculation. The method comprises the following specific steps: (1) The cells inoculated with the virus are discarded, rinsed 3 times with PBS (0.01 mol/L pH 7.2), added with 4% ice-cold paraformaldehyde and fixed for 30min at room temperature; (2) rinsing 3 times with PBS, adding 5% BSA, and blocking for 30min at room temperature; (3) After PBS rinsing for 3 times, adding 1:500 dilution of anti-FMDV nonstructural protein 3B monoclonal antibody 3B4B1 respectively, and incubating for 1h at 37 ℃; (4) Rinsing 5 times by PBS, adding FITC-labeled IgG secondary antibody diluted by 1:100, and incubating for 1h at 37 ℃; (5) Rinsing with PBS for 5 times, adding 0.5ug/ml DAPI for 10min, washing with PBS for 5 times, removing excessive DAPI, photographing under confocal fluorescence microscope, and setting normal cell control.

The results show that: BHK-21 cells inoculated with rHN/XJ, rHN/XJ/TURGH and rHN/XJ/SCGH all can act with 3B monoclonal antibody to generate specific green fluorescence, and no visible fluorescence can be seen by control cells and 3B monoclonal antibody (see figure 5), which shows that the successful construction of recombinant FMDV by the invention, the replacement of L+P1 or G-H loop genes does not affect the rescue of infectious recombinant FMDV.

4.3, electron microscope observation

And (3) respectively proliferating 100mL of FMDV rHN/XJ, rHN/XJ/TURGH and rHN/XJ/SCGH in BHK-21 cells, freezing and thawing for 2-3 times, adding BEI for inactivation, centrifuging at 12000rpm/min for 1h, collecting virus supernatant, and centrifuging at 35000rpm/min for 3h at 4 ℃. The centrifuged pellet was resuspended in PBS (ph=7.6) buffer and visualized by electron microscopy after negative staining. And (3) the observation result of the electron microscope shows that: the morphology of the 3 recombinant viruses was identical, with the morphology of FMDV, with approximately 25nm diameter, spherical virus particles (FIG. 6).

5. Growth characteristics of recombinant viruses

5.1 time to CPE in 100% of infected cells by recombinant Virus

The 3 transfected supernatants were inoculated with the grown BHK-21 cells at 10% of the inoculum size, the cells were harvested when 100% of the cells to be inoculated with the transfected supernatant showed typical CPE, and after 3 repeated freeze thawing, serial passaging was continued under the same conditions, and the time at which 100% of the infected cells showed typical CPE per virus after passage 5 was observed (Table 2). Results of serial passages are indicated: after the 3 recombinant viruses which are saved are continuously transferred to the 6 th generation, the time for generating typical CPE tends to be stable, the time for generating CPE by 100% of infected cells of a parent virus is about 48 hours, the time for generating the typical CPE by 100% of infected cells of rHN/XJ/TURGH virus is about 15 hours, and the time for generating the typical CPE by 100% of infected cells of rHN/XJ/SCGH virus is about 12 hours. This result shows that: replacement of FMDV vaccine strain O/TUR/5/2009 and epidemic strain O/SCGH/CHA/2016G-H both significantly shortened the time to CPE in 100% of infected cells, and the effect of different G-H loops on CPE in 100% of infected cells was different.

TABLE 2 time after passage 5 of the recombinant virus when 100% of the cells appeared CPE (h)

5.2 one step growth curve of recombinant virus

The 6 th generation rHN/XJ, rHN/XJ/TURGH and rHN/XJ/SCGH viruses were respectively diluted 10 times, then the different dilutions of viruses were inoculated with a single layer of grown BHK-21 cells (200 ul/well, 6-well plate) respectively, placed in a 37℃incubator, shaken once every 10min, added with 2mL of an tragacanth mixture (2 XMEM, 1.2% tragacanth, 1% serum) after 1h, statically cultured for 48h, after washing with PBS for 1-2 times, added with a fixative (50% acetone+50% methanol) for 30min at room temperature, then stained with crystal violet for 1h, and plaque forming units (PFU/mL) of each virus were calculated after washing with clear water. The 6 th generation recombinant virus was inoculated with a single layer of BHK-21 cells which had grown at an infection amount of 1moi, the inoculated virus solution was adsorbed for 1 hour, and after washing 2 times with MEM, 5mL of MEM medium was added and the culture was continued in an incubator at 37 ℃. Samples were collected 4h, 8h, 12h, 16h and 20h after inoculation, and titers (PFU/mL) of the viruses were determined on BHK-21 monolayer cells (6 well plates) after 3 times of repeated freeze thawing (experiments were performed 2 times of repetition) as described above, and a one-step growth curve of the viruses was drawn (FIG. 7).

The results show that: compared with the parent virus rHN/XJ, the replication titer of the recombinant FMDV is obviously improved within 4H-20H after the recombinant virus inserted into the FMD vaccine strain O/TUR/5/2009 and the epidemic strain O/SCGH/CHA/2016G-H infects cells, but the replication titer of the recombinant virus rHN/XJ/SCGH inserted into the epidemic strain O/SCGH/CHA/2016G-H is slightly higher than rHN/XJ/TURGH at different times, which indicates that the framework of the same virus is substituted for G-H containing different amino acid compositions, and the influence on the replication level of the foot-and-mouth disease virus is different.

6. Preparation of FMDV inactivated vaccine

6.1 proliferation, inactivation and purification of FMDV

Recombinant viruses rHN/XJ/TURGH, rHN/XJ/SCGH and parent viruses rHN/XJ were inoculated with 100% confluent monolayer adherent BHK-21 cells (175 mL cell flask, 27mL of inoculation liquid+3 mL of virus liquid), incubated in a 37℃incubator, and when typical CPE occurred in 100% infected cells, the viruses were harvested separately, each approximately 500mL. After repeating freeze thawing for 3 times, the collected virus liquid is centrifuged at 8000rpm/min at 4 ℃ for 1h, and cell debris is removed. The collected viral supernatants were inactivated with 1-1.2% BEI at 30℃for 28h. The inactivated virus antigen is subjected to inactivation safety test by using a milk mouse and cells for 4 generations in a blind way. And (3) purifying the virus particles by a sucrose density gradient centrifugation method after the virus particles are qualified, and detecting the 146S content of the virus antigen by a liquid chromatograph. The antigen concentration was diluted to 12 μg/mL with PBS solution at ph=7.6.

6.2 preparation of vaccine

And (3) placing the ISA201 adjuvant in a 37 ℃ constant-temperature water bath for preheating, slowly adding a proper amount of the adjuvant into the virus antigen according to the ratio of antigen to adjuvant volume ratio=1:1, slowly shaking until the antigen and the adjuvant are not layered, and placing the prepared vaccine product (the antigen concentration is 6 mug/mL) in a temperature of 4-8 ℃ for standby.

7. Animal experiment

15 healthy susceptible pigs (O-type foot-and-mouth disease liquid phase blocking ELISA antibody titer < 1:6,3ABC antibody negative) of 90 days old are selected and divided into A, B and C3 groups, each group having 5 pigs. Group A vaccinates against parental virus rHN/XJ vaccine, group B vaccinates against rHN/XJ/TURGH virus vaccine, and group C vaccinates against rHN/XJ/SCGH. Auricular muscle is injected at a dose of 2 mL/head. All pigs were immunized for 28 days and blood was collected and serum was collected for use.

Cross-neutralizing antibodies of different lineages FMDV (O/SCGH/CHA/2016, O/Tibet/99, O/XJ/CHA/2017 and O/NXYCh/CHA/2018) were detected in immune serum 28 days after immunization of animals with three vaccines using a mini-neutralization assay as follows:

a. all immune sera were inactivated for 30min at 56 ℃ prior to the assay;

b. taking inactivated serum, diluting the serum with serum-free cell culture solution on a 96-well micro-cell culture plate, and performing a series of multiple dilution from 1:4, wherein the content of each well is 50 mu L, and each dilution is 2-4 wells;

c. taking virus liquid stored in-70 ℃ refrigerator, and taking the virus liquid as 200TCID according to the determined toxicity price ₅₀ Dilution (after mixing with equal amount of serum, its toxicity is 100TCID ₅₀ )；

d. 50 mu L of diluted virus solution is added into each hole of a 96-blank plate containing diluted serum, and 5% CO is placed ₂ A 37 ℃ incubator;

e. after neutralization for 1h by adding cell suspension serum virus, taking out, adding 50 mu L of cell suspension (the monolayer is grown in 24h, and 100-150 ten thousand cells per ml is common) into each hole, sealing by transparent adhesive tape, and culturing in a 37 ℃ incubator. After 48h, appropriate judgment is carried out under a microscope, and after 72h, fixation dyeing is carried out;

f. the following controls must be set up for each plate per test: (1) positive and negative serum controls: the positive and negative serum controls were each provided with 2-4 wells, 50 μl per well, the positive wells were blue in color and the negative wells were not colored. (2) Virus regression test: the virus was first treated as 0.1, 1, 10, 100TCID ₅₀ Dilutions were performed, 2-4 wells per dilution, 50 μl per well. Then 50. Mu.l of the cell suspension was added to each well. 0.1TCID ₅₀ Should be blue, 100TCID ₅₀ No staining, otherwise the experiment was not true. (3) Normal cell control: to avoid experimental errors caused by the culture plates themselves, a 2-4 well normal cell control without virus and serum should be established on each plate, which control should be kept good throughout the experimentMorphological and life characteristics, the staining is blue. (4) The primary test should be carried out by setting 2-4 holes of serum toxicity control (corresponding to the lowest serum dilution in the test) without virus;

g. the results were judged when all of the viral regression test, positive, negative, normal cell controls, and serum toxicity controls were established. Judging negative when 100% CPE appears in the serum hole to be detected, and judging positive when more than 50% of cells appear in the protector; results of fixed virus dilution serum neutralization assay calculation, final dilution of serum was expressed as 50% endpoint of serum/virus mixture, serum neutralization titer was calculated by Karber method, neutralization titer 1:45 (1.65 log ₁₀ ) Or more positive, 1:16-1:32 is suspicious and has to be reworked, and titer of 1:11 or less is negative.

The results of the serum neutralization experiments of immunized animals show that: pigs immunized with parental virus rHN/XJ and recombinant virus rHN/XJ/TURGH vaccines can only produce high levels of protective cross-neutralizing antibodies (. Gtoreq.2.43 log) against three lineages of epidemic viruses O/XJ/CHA/2017 (Ind 2001 lineages), O/Tibet/99 (Panasia lineages) and O/NXYCh/CHA/2018 (Mya-98 lineages) ₁₀ ) But none produced protective cross-neutralizing antibodies (< 1.65 log) to the Cathay lineage epidemic strain O/SCGH/CHA/2016 ₁₀ ) The method comprises the steps of carrying out a first treatment on the surface of the While recombinant virus vaccine rHN/XJ/SCGH immunized pigs can produce high levels of protective (> 2.47 log) against four lineages epidemic O/XJ/CHA/2017, O/Tibet/99, O/NXYCh/CHA/2018 and O/SCGH/CHA/2016 (Cathay lineages) ₁₀ ) Cross-neutralizing antibodies. The above results indicate that: immunization with recombinant viral vaccine rHN/XJ/SCGH against the G-H loop gene of the Cathay topological strain produced high levels of protective cross-neutralizing antibodies not only against pandemic strains of the pan-sub-lineage, the Myanmar 98 lineage and the Ind2001 lineage, but also against the Cathay lineage epidemic strain O/SCGH/CHA/2016, whereas vaccine immunized pigs prepared from recombinant viruses of the parent virus and chimeric classical vaccine strain O/TUR/5/2009G-H loops were unable to produce protective cross-neutralizing antibodies against the Cathay lineage epidemic strain O/SCGH/CHA/2016.

TABLE 3 neutralization anti-Hold titers of porcine serum against homologous and heterologous viruses (log ₁₀ )

Note that: OIE specifies that the neutralizing antibody titer is greater than or equal to 1.65log ₁₀ Typically protection.

In conclusion, the invention utilizes FMDV reverse genetic manipulation technology, takes chimeric FMDV O/XJ/CHA/2017 virus L+P1 gene infectious clone as a framework, constructs recombinant virus rHN/XJ/SCGH for replacing Cathay epidemic virus O/SCGH/CHA/2016G-H gene in China, has short virus collection time (12H) and high replication titer (1 multiplied by 10) ^7.6 PFU/mL), the animals immunized by the virus vaccine can generate high-level protective cross neutralizing antibodies to epidemic viruses of four lineages, and the antigen spectrum is expanded. Therefore, the recombinant virus rHN/XJ/SCGH constructed by the reverse genetic manipulation technology is suitable for serving as an FMD vaccine candidate strain and is used for effectively preventing and controlling the current O-type FMD in China.

The foregoing is merely a preferred embodiment of the present invention, and it should be noted that it would be within the purview of one of ordinary skill in the art to utilize reverse genetics of FMDV to replace G-H loops of other prevalent strains of the catray lineage to produce antigen-profile expanded FMD strains, and such modifications and alterations should also be considered as the scope of the present invention, without departing from the principles of the present invention.

Claims

1. An O-type foot-and-mouth disease vaccine candidate strain, characterized in that: the recombinant foot-and-mouth disease virus rHN/XJ full-length infectious clone pQSA is taken as a skeleton, and G-H loop genes of O/SCGH/CHA/2016 strains are embedded to obtain the recombinant foot-and-mouth disease virus; the full-length infectious clone PQSA of the recombinant foot-and-mouth disease virus rHN/XJ is obtained by taking the full-length infectious clone pOFS of a foot-and-mouth disease vaccine strain O/HN/CHA/93 as a skeleton and embedding the L+P1 gene of a foot-and-mouth disease epidemic strain O/XJ/CHA/2017;

the nucleotide sequence of the G-H loop gene of the O/SCGH/CHA/2016 strain is shown as SEQ ID NO:5 is shown in the figure; the nucleotide sequence of the L+P1 gene of the O/XJ/CHA/2017 strain is shown as SEQ ID NO:2.

2. A method of constructing a vaccine candidate strain for foot-and-mouth disease type O according to claim 1, comprising the steps of:

(1) Artificially synthesizing a recombinant plasmid pSK-Z123XJLP1 containing the foot-and-mouth disease epidemic strain O/XJ/CHA/2017L+P1 genes by taking a foot-and-mouth disease vaccine strain O/HN/CHA/93 half-length plasmid pSK-Z123 as a template;

(2) Artificially synthesizing a recombinant plasmid pSK-Z123XJLP1/SCGH containing O/SCGH/CHA/2016G-H ring gene chimeric of the foot-and-mouth disease virus by taking the recombinant plasmid pSK-Z123XJLP1 synthesized in the step (1) as a template; the synthesized plasmid is digested by SpeI and BglII restriction enzymes, and then a target fragment of about 5400bp is recovered and inserted into the pOFS plasmid digested by SpeI and BglII restriction enzymes, so as to obtain a recombinant full-length plasmid pQSQ;

(3) And transfecting a NotI linearized recombinant full-length plasmid pQSQ into BSR/T7 cells to rescue the recombinant foot-and-mouth disease virus, thereby obtaining an O-type foot-and-mouth disease vaccine candidate strain rHN/XJ/SCGH.

3. An application of an O-type foot-and-mouth disease vaccine candidate strain constructed based on the O-type foot-and-mouth disease vaccine candidate strain of claim 1 or the construction method of claim 2 in preparing an O-type foot-and-mouth disease vaccine.

4. The use of a candidate strain of O-type foot-and-mouth disease vaccine according to claim 3 for the preparation of a O-type foot-and-mouth disease vaccine, characterized in that: the prevention and control objects of the O-type foot-and-mouth disease vaccine are O/XJ/CHA/2017, O/Tibet/99, O/NXYCh/CHA/2018 and O/SCGH/CHA/2016 virus strains.