CN111996201A - Samlika recombinant virus and recombinant vaccine strain of recombinant A-type foot-and-mouth disease virus VP1 gene, and preparation method and application thereof - Google Patents

Samlika recombinant virus and recombinant vaccine strain of recombinant A-type foot-and-mouth disease virus VP1 gene, and preparation method and application thereof Download PDF

Info

Publication number
CN111996201A
CN111996201A CN202010212907.XA CN202010212907A CN111996201A CN 111996201 A CN111996201 A CN 111996201A CN 202010212907 A CN202010212907 A CN 202010212907A CN 111996201 A CN111996201 A CN 111996201A
Authority
CN
China
Prior art keywords
recombinant
virus
gene
sva
seneca
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202010212907.XA
Other languages
Chinese (zh)
Other versions
CN111996201B (en
Inventor
郑海学
杨帆
曹伟军
蒋保余
朱紫祥
魏婷
郑敏
�田宏
张克山
张伟
刘永杰
党文
马旭升
李丹
茹毅
何继军
郭建宏
刘湘涛
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Lanzhou Veterinary Research Institute of CAAS
Original Assignee
Lanzhou Veterinary Research Institute of CAAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Lanzhou Veterinary Research Institute of CAAS filed Critical Lanzhou Veterinary Research Institute of CAAS
Priority to CN202010212907.XA priority Critical patent/CN111996201B/en
Publication of CN111996201A publication Critical patent/CN111996201A/en
Application granted granted Critical
Publication of CN111996201B publication Critical patent/CN111996201B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525Virus
    • A61K2039/5256Virus expressing foreign proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/55Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • A61K2039/552Veterinary vaccine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/32011Picornaviridae
    • C12N2770/32021Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/32011Picornaviridae
    • C12N2770/32034Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/32011Picornaviridae
    • C12N2770/32051Methods of production or purification of viral material
    • C12N2770/32052Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/32011Picornaviridae
    • C12N2770/32111Aphthovirus, e.g. footandmouth disease virus
    • C12N2770/32122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/32011Picornaviridae
    • C12N2770/32111Aphthovirus, e.g. footandmouth disease virus
    • C12N2770/32134Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/10Plasmid DNA
    • C12N2800/106Plasmid DNA for vertebrates
    • C12N2800/107Plasmid DNA for vertebrates for mammalian

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Immunology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Chemical & Material Sciences (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention provides a Senecan recombinant virus of a recombinant A-type foot-and-mouth disease virus VP1 gene, a recombinant vaccine strain, a preparation method and application thereof, relating to the technical field of genetic engineering. The invention provides a seneca virus recombinant nucleic acid, a seneca recombinant virus containing the recombinant nucleic acid, a seneca recombinant vaccine strain containing the seneca recombinant virus, a preparation method and an application thereof. The invention carries out deletion mutation transformation on SVV/FJ/001 strain genes, and the VP1 gene of A-type FMDV is fused into cDNA of the SVV/FJ/001 strain genes to obtain Senecan recombinant viruses, wherein the recombinant viruses can express the fused genes, and the expression products have good reactogenicity; the obtained vaccine strain has high antigen productivity, obviously reduced pathogenicity and even no pathogenicity to pigs, can not only stimulate the immune response of SVA after an inactivated vaccine immunizes animals, but also generate the immunocompetence aiming at the fusion gene, and can be used for preventing and controlling the epinakavirus and one or more non-epinakaviruses.

Description

Samlika recombinant virus and recombinant vaccine strain of recombinant A-type foot-and-mouth disease virus VP1 gene, and preparation method and application thereof
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to a seneca recombinant virus and a recombinant vaccine strain of a recombinant A-type foot-and-mouth disease virus VP1 gene, and a preparation method and application thereof.
Background
Senecavirus a (SVA), also known as Senecavirus (Senecavirus), Seneca Valley Virus (SVV), belongs to the genus Senecavirus (Senecavirus) of the Picornaviridae (Picornaviridae) and is also the only member of this genus. The virus infected pig can cause primary vesicular disease of the pig, and is difficult to distinguish from clinical symptoms caused by foot-and-mouth disease, pig vesicular disease, vesicular stomatitis and the like. After SVA infection, weaned piglets and pigs of all ages which are kept, fattened and bred can be affected with vesicular lesions, and are accompanied with clinical symptoms such as lameness, fever, anorexia, lethargy and the like, and newborn piglets can have symptoms such as continuous diarrhea, dehydration and the like besides the symptoms, and even die suddenly.
Foot and Mouth Disease Virus (FMDV) belongs to the genus Aphthovius of Picornaviridae (Picornaviridae) and comprises seven serotypes A, O, C, Asial, SAT1, SAT2 and SAT3, and no cross protection exists among the types. The total length of the viral genome is about 8.5kb, and consists of a 5 'non-coding region, an ORF region and a 3' non-coding region. The coding region encodes a polyprotein, which is gradually degraded by viral self-protease and host cell protease to form various intermediates and mature 4 structural proteins (VP4, VP2, VP3 and VP1) and 8 non-structural proteins (L)pro2A, 2B, 2C, 3A, 3B, 3C, 3D). Among them, VP1 is the most important capsid protein encoded by structural protein gene, and is the main antigenic protein for determining FMDV antigenicity, inducing organism to produce neutralizing antibody and stimulating protective immune responseIn the family of picornaviridae, VP1 is recognized as the most immunogenic protein, and therefore, as an antigen gene of FMDV, VP1 protein is expressed, and the biological activity and immunogenicity thereof are maintained, thus playing an important role in research of FMDV genetic engineering vaccines.
Disclosure of Invention
In view of the above, the present invention aims to provide a seneca virus recombinant nucleic acid of a recombinant type a foot-and-mouth disease virus VP1 gene, a seneca recombinant virus comprising the recombinant nucleic acid, a seneca recombinant virus encoded by the recombinant nucleic acid, a seneca recombinant vaccine strain comprising the seneca recombinant virus, and a preparation method and applications thereof. The SVV/FJ/001 strain is subjected to gene deletion mutation transformation, and meanwhile, the VP1 gene of the A-type foot-and-mouth disease virus is fused into SVAcDNA to obtain the Senecan recombinant virus, the recombinant virus can express the fused exogenous FMDV VP1 gene, and an expression product has good reactogenicity; the prepared vaccine strain has high antigen productivity, obviously reduced pathogenicity and even no pathogenicity to pigs; the inactivated vaccine is used for immunizing animals to generate the immunocompetence of SVA and the immunocompetence aiming at the fusion gene. The vaccine strain obviously improves the biological safety and can be used for preventing and controlling the epidotic fever virus and one or more non-epidotic fever viruses.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides a seneca virus recombinant nucleic acid, wherein the sequence of the recombinant nucleic acid comprises deletion mutation modification of a 5' UTR gene sequence of a seneca virus strain, and a VP1 gene of A-type foot-and-mouth disease virus is inserted between Sph I and Not I enzyme cutting sites of seneca virus cDNA.
Preferably, the nucleotide sequence of the 5'UTR gene modified by deletion mutation of the 5' UTR gene sequence of the Seneca virus strain is shown as SEQ ID NO. 1; the nucleotide sequence of the VP1 gene of the inserted A-type foot-and-mouth disease virus is shown in SEQ ID NO. 2.
Preferably, the Seneca virus strain comprises the SVV/FJ/001 strain.
The invention also provides application of the recombinant nucleic acid in preparation of the Seneca virus recombinant nucleic acid or Seneca recombinant vaccine strain of the recombinant A-type FMDV VP1 gene.
The invention also provides a seneca recombinant virus of the recombinant A-type FMDV VP1 gene, which comprises the recombinant nucleic acid.
6. A seneca recombinant virus of a recombinant A-type FMDV VP1 gene encoded by the recombinant nucleic acid of any one of claims 1-3.
The invention also provides a recombinant vaccine strain containing the recombinant virus.
Preferably, the epicaic recombinant vaccine strain can not only stimulate the immunological activity of animals to the epicaic virus, but also generate the immunological activity to the foot-and-mouth disease virus.
The invention also provides a construction method of the seneca recombinant virus, which comprises the following steps:
(1) using cDNA of A/GDMM/2013 strain as a template, and amplifying by using a specific primer pair to obtain VP1 gene of A-type FMDV; the specific primer pair for amplifying the VP1 gene comprises an upstream primer and a downstream primer AS-R, wherein the upstream primer comprises AVP1-F0 and AVP1-F, the nucleotide sequence of the upstream primer AVP1-F0 is shown AS SEQ ID No.3, the nucleotide sequence of the upstream primer AVP1-F is shown AS SEQ ID No.4, and the nucleotide sequence of the downstream primer AS-R is shown AS SEQ ID No. 5;
(2) respectively amplifying to obtain an S1 fragment and an S20 fragment of the SVV/FJ/001 strain by using a specific primer pair by taking the cDNA of the SVV/FJ/001 strain as a template; the specific primer pair for amplifying the S1 fragment comprises an upstream primer and a downstream primer SVA-1R, wherein the upstream primer comprises SVA-1F0 and SVA-1F; the nucleotide sequence of the upstream primer SVA-1F0 is shown as SEQ ID NO.6, and the nucleotide sequence of the upstream primer SVA-1F is shown as SEQ ID NO. 7; the nucleotide sequence of the downstream primer SVA-1R is shown as SEQ ID NO. 8;
the specific primer pair for amplifying the S20 fragment comprises an upstream primer SVA-2F1 and a downstream primer SVA-2R, the nucleotide sequence of the upstream primer SVA-2F1 is shown as SEQ ID NO.9, and the nucleotide sequence of the downstream primer SVA-2R is shown as SEQ ID NO. 10;
(3) fusing the VP1 gene fragment obtained in the step (1) with the S20 gene fragment to obtain an S2-AVP1 fragment;
(4) respectively connecting the S1 fragment and the S2-AVP1 fragment with a pMD 20T vector to obtain subclone plasmids PMD-S1 and PMD-S2-AVP 1;
(5) amplifying by using mutation primers SVA-m5UTRF and SVA-m5 UTRA by using the subcloning plasmid PMD-S1 as a template to obtain a subcloning plasmid PMD-mS1, wherein the nucleotide sequence of the SVA-m5 UTRA is shown as SEQ ID NO.11, and the nucleotide sequence of the SVA-m5 UTRA is shown as SEQ ID NO. 12;
(6) carrying out double enzyme digestion on plasmid PMD-mS1 by PacI and SphI, carrying out double enzyme digestion on plasmid PMD-S2-AVP1 by SphI and NotI, recovering a gene fragment, and inserting the gene fragment into eukaryotic transcription plasmid prO/CHA/99 subjected to double enzyme digestion by PacI and NotI in a connecting and replacing manner to obtain recombinant plasmid prSVV/FJ-M-AVP 1;
(7) transfecting the obtained recombinant plasmid prSVV/FJ-M-AVP1 to a seneca virus sensitive cell to obtain the seneca recombinant virus of the recombinant A-type FMDV VP1 gene.
Preferably, in step (3), fusion PCR is carried out by using primers AVP1-F and SVA-2R to fuse gene segments; the nucleotide sequence of the AVP1-F is shown as SEQ ID NO.4, and the nucleotide sequence of the SVA-2R is shown as SEQ ID NO. 10.
Preferably, the mutated 5' UTR gene segment of step (5) comprises a nucleic acid sequence as shown in SEQ ID No.1, or comprises said recombinant nucleic acid.
Preferably, the Senecavirus sensitive cells of step (7) comprise BHK-21 cells, PK-15 cells, ST cells, SK-RST cells, IBRS-2 cells, H1299 cells or 293T cells.
The invention also provides the application of the seneca recombinant virus of the recombinant A-type FMDV VP1 gene or the seneca recombinant virus prepared by the method in the preparation of the seneca recombinant vaccine.
The invention also provides a Seika recombinant vaccine of the recombinant A-type FMDV VP1 gene.
The invention also provides application of the epicaic recombinant vaccine strain or the epicaic recombinant vaccine in preparing a medicament for simultaneously preventing and/or controlling related diseases of animals caused by epicaic virus and foot-and-mouth disease virus.
Preferably, the animal comprises a pig, a cow or a sheep.
The invention provides a seneca virus recombinant nucleic acid of a recombinant A-type FMDV VP1 gene, a seneca recombinant virus containing the recombinant nucleic acid, a seneca recombinant virus coded by the recombinant nucleic acid, a seneca recombinant vaccine strain containing the seneca recombinant virus, and a preparation method and application thereof. According to the resources such as epikavirus molecular epidemiology and early-stage accumulated epidemic strains, an established high-efficiency reverse genetic operation technology platform is utilized, SVV/FJ/001 strain gene is analyzed, full-length cDNA which is subjected to gene deletion mutation modification on the virus strain is constructed, VP1 gene of A-type foot-and-mouth disease virus is fused into SVA cDNA, virus rescue, recombinant strain biological characteristic determination and the like are carried out, the successfully rescued recombinant virus is shown to have cell infection characteristic and high yield characteristic which are similar to wild type, meanwhile, the recombinant virus can express the fused A-type FMDV VP1 protein and has good reactogenicity, pathogenicity research results show that the pathogenicity of the recombinant virus is obviously reduced and even has no pathogenicity to pigs, the biological safety of the virus strain is obviously improved, therefore, the preparation method can be utilized, SVA is used as a virus framework inserted with exogenous pathogenic antigen gene to construct chimeric vaccine strains, after the animals are immunized, the immunological activity aiming at the parent framework strain and the inserted exogenous antigen gene can be obtained at the same time.
The antigen gene P1 gene of the SVV/FJ/001 strain of the invention has homology of more than 98.6 percent with the isolated SVA epidemic strain gene reported in China, and has high homology with the epidemic strain in other countries, because the P1 gene is the antigen gene of SVA and can induce organisms to generate neutralizing antibodies, the SVV/FJ/001 strain is used as a template, reverse genetic operation technology is utilized, SVA infectious cDNA clone is constructed through amplification and transformation, and simultaneously, the A-type foot-and-mouth disease virus antigen gene VP1 is inserted into the SVA infectious clone to successfully rescue recombinant viruses, thereby not only realizing antigen matching and immune responsiveness of the SVA strain and ensuring pertinence of the SVA strain and the epidemic strain, but also effectively expressing the inserted foot-and-mouth disease antigen gene, showing that the SVA can be used as a virus skeleton expressed by exogenous genes by using the construction method, used for chimeric expression of antigen genes of different exogenous pathogens and realizes the research and application of chimeric vaccine based on SVA.
The Seneca recombinant virus rSVV/FJ-M-AVP1 has high virus titer, the lesion time after stable passage is about 12-18 h, and the poison price is 106.5TCID50/mL~1010.0TCID50/mL。
The recombinant virus rSVV/FJ-M-AVP1 of the seneca carries out partial deletion and mutation transformation on the 5' UTR of the virus, and simultaneously, an A-type FMDV VP1 gene capable of being efficiently expressed is embedded, compared with the pathogenicity of SVV/FJ/001, the recombinant virus strain obviously reduces the pathogenicity of the virus strain to pigs, even has no pathogenicity to the pigs, and obviously improves the biological safety.
The scheme of the invention realizes a more active and effective construction mode of the SVA recombinant/chimeric vaccine strain, realizes innovation of the SVA virus seed preparation process, and has great application value.
Drawings
FIG. 1 shows the results of electrophoresis of the SVA S1 fragment and the S2-AVP1 fragment amplified in example 2, wherein 1 is the amplification product of the S1 fragment; 2 is an amplification product of the S2-AVP1 fragment; m is DL 5000DNA Marker;
FIG. 2 is a schematic diagram showing the construction method of the recombinant plasmid prSVV/FJ-M-AVP1 of Selenkavirus in example 2;
FIG. 3 is the cytopathic effect (CPE) caused by infection of BHK-21 cells with the recombinant virus rSVV/FJ-M-AVP1 strain of example 3, wherein A represents normal BHK-21 cells; b represents BHK-21 cells presenting CPE;
FIG. 4 shows the indirect immunofluorescence results of the recombinant virus rSVV/FJ-M-AVP1 strain inoculated in example 4, wherein A represents the normal cell control, and B represents the detection results after the recombinant virus rSVV/FJ-M-AVP1 strain is inoculated;
FIG. 5 shows the result of ELISA detection of the reactivity of rSVV/FJ-M-AVP1 strain recombinant virus and FMDV type A specific antibody in example 4;
FIG. 6 shows the results of Westernblot analysis of rSVV/FJ-M-AVP1 recombinant virus in example 4.
Detailed Description
The invention provides a seneca virus recombinant nucleic acid, wherein the sequence of the recombinant nucleic acid comprises deletion mutation modification of a 5' UTR gene sequence of a seneca virus strain, and a VP1 gene of A-type foot-and-mouth disease virus is inserted between Sph I and Not I enzyme cutting sites of seneca virus cDNA.
The Selcarca virus strain of the present invention preferably includes SVV/FJ/001 strain. The SVV/FJ/001 strain is preferably the SVV/FJ/001 strain which is preserved in China center for type culture Collection and has the preservation number of CCTCC NO. V201802, and has been disclosed in China granted patent "Sernica Valley virus vaccine and preparation method and application" ZL201810003888.2 ".
The invention preferably carries out deletion mutation transformation on the 5'UTR gene sequence of the SVV/FJ/001 strain, and the nucleotide sequence of the 5' UTR gene of the SVV/FJ/001 strain after transformation is shown in SEQ ID NO. 1. The nucleotide sequence of the VP1 gene of the inserted type A foot-and-mouth disease virus is preferably shown as SEQ ID NO. 2.
The invention also provides application of the recombinant nucleic acid in preparation of the Seneca virus recombinant nucleic acid or Seneca recombinant vaccine strain of the recombinant A-type FMDV VP1 gene.
The invention also provides a seneca recombinant virus of the recombinant A-type FMDV VP1 gene, which comprises the recombinant nucleic acid.
The invention also provides a seneca recombinant virus of the recombinant A-type FMDV VP1 gene encoded by the recombinant nucleic acid.
The invention also provides a recombinant vaccine strain containing the recombinant virus.
The recombinant vaccine strain of the epinocardia seriolae can not only stimulate the immunocompetence of animals to the epinocardia virus, but also generate the immunocompetence to the foot-and-mouth disease virus.
The invention also provides a construction method of the seneca recombinant virus, which comprises the following steps:
(1) using cDNA of A/GDMM/2013 strain as a template, and amplifying by using a specific primer pair to obtain VP1 gene of A-type FMDV; the specific primer pair for amplifying the VP1 gene comprises an upstream primer and a downstream primer AS-R, wherein the upstream primer comprises AVP1-F0 and AVP1-F, the nucleotide sequence of the upstream primer AVP1-F0 is shown AS SEQ ID No.3, the nucleotide sequence of the upstream primer AVP1-F is shown AS SEQ ID No.4, and the nucleotide sequence of the downstream primer AS-R is shown AS SEQ ID No. 5;
(2) respectively amplifying to obtain an S1 fragment and an S20 fragment of the SVV/FJ/001 strain by using a specific primer pair by taking the cDNA of the SVV/FJ/001 strain as a template; the specific primer pair for amplifying the S1 fragment comprises an upstream primer and a downstream primer SVA-1R, wherein the upstream primer comprises SVA-1F0 and SVA-1F; the nucleotide sequence of the upstream primer SVA-1F0 is shown as SEQ ID NO.6, and the nucleotide sequence of the upstream primer SVA-1F is shown as SEQ ID NO. 7; the nucleotide sequence of the downstream primer SVA-1R is shown as SEQ ID NO. 8;
the specific primer pair for amplifying the S20 fragment comprises an upstream primer SVA-2F1 and a downstream primer SVA-2R, the nucleotide sequence of the upstream primer SVA-2F1 is shown as SEQ ID NO.9, and the nucleotide sequence of the downstream primer SVA-2R is shown as SEQ ID NO. 10;
(3) fusing the VP1 gene fragment obtained in the step (1) with the S20 gene fragment to obtain an S2-AVP1 fragment;
(4) respectively connecting the S1 fragment and the S2-AVP1 fragment with a pMD 20T vector to obtain subclone plasmids PMD-S1 and PMD-S2-AVP 1;
(5) amplifying by using mutation primers SVA-m5UTRF and SVA-m5 UTRA by using the subcloning plasmid PMD-S1 as a template to obtain a subcloning plasmid PMD-mS1, wherein the nucleotide sequence of the SVA-m5 UTRA is shown as SEQ ID NO.11, and the nucleotide sequence of the SVA-m5 UTRA is shown as SEQ ID NO. 12;
(6) carrying out double enzyme digestion on plasmid PMD-mS1 by PacI and SphI, carrying out double enzyme digestion on plasmid PMD-S2-AVP1 by SphI and NotI, recovering a gene fragment, and inserting the gene fragment into eukaryotic transcription plasmid prO/CHA/99 subjected to double enzyme digestion by PacI and NotI in a connecting and replacing manner to obtain recombinant plasmid prSVV/FJ-M-AVP 1;
(7) transfecting the obtained recombinant plasmid prSVV/FJ-M-AVP1 to a seneca virus sensitive cell to obtain the seneca recombinant virus of the recombinant A-type FMDV VP1 gene.
The invention takes cDNA of A/GDMM/2013 strain as a template, and obtains VP1 gene of A-type FMDV by amplifying with a specific primer pair; the specific primer pair for amplifying the VP1 gene comprises an upstream primer and a downstream primer AS-R, wherein the upstream primer comprises AVP1-F0 and AVP1-F, the nucleotide sequence of the upstream primer AVP1-F0 is shown AS SEQ ID No.3, the nucleotide sequence of the upstream primer AVP1-F is shown AS SEQ ID No.4, and the nucleotide sequence of the downstream primer AS-R is shown AS SEQ ID No. 5. The invention preferably designs a primer for synthesizing and amplifying VP1 according to the A/GDMM/2013 strain gene sequence (Genebank: KF450794) of the O-type foot-and-mouth disease virus:
AVP1-F0:
5’-gatgcaatcaggcgacgtcgagaccaaccctggccctatgaccaccgccaccggggaa-3’(SEQ ID NO.3);
AVP1-F:
5’-cccagcatgcttccctttcgcagctacaagcagaagatgctgatgcaatcaggcgacgtc-3' (SEQ ID NO.4), the horizontal line part is the enzyme cutting site of SphI;
AS-R:5’-caggatcgggttgtcagaagcgggtccagggttggactcaac-3’(SEQ ID NO.5)。
the invention preferably extracts the total RNA of the A/GDMM/2013 strain, carries out reverse transcription to synthesize first strand cDNA, takes the reverse transcribed first strand cDNA AS a template, uses primers AVP1-F0 and AS-R for amplification, takes the amplification product AS a template, uses primers AVP1-F and AS-R for second round amplification, and obtains a gene segment containing the type A foot-and-mouth disease virus VP1, which is shown AS SEQ ID NO. 2. The amplification conditions of the fusion PCR of the present invention are preferably: 5min at 94 ℃; 30s at 94 ℃, 30s at 57 ℃, 50s at 72 ℃ after 35 cycles; 10min at 72 ℃.
The method takes cDNA of SVV/FJ/001 strain as a template, and utilizes a specific primer pair to respectively amplify to obtain an S1 fragment and an S20 fragment of the SVV/FJ/001 strain; the specific primer pair for amplifying the S1 fragment comprises an upstream primer and a downstream primer SVA-1R, wherein the upstream primer comprises SVA-1F0 and SVA-1F; the nucleotide sequence of the upstream primer SVA-1F0 is shown as SEQ ID NO.6, and the nucleotide sequence of the upstream primer SVA-1F is shown as SEQ ID NO. 7; the nucleotide sequence of the downstream primer SVA-1R is shown as SEQ ID NO. 8; the specific primer pair for amplifying the S20 fragment comprises an upstream primer SVA-2F1 and a downstream primer SVA-2R, wherein the nucleotide sequence of the upstream primer SVA-2F1 is shown as SEQ ID NO.9, and the nucleotide sequence of the downstream primer SVA-2R is shown as SEQ ID NO. 10.
In the present invention, the source of the cDNA of the SVV/FJ/001 strain is not particularly limited, but is preferably obtained by extracting RNA and then reverse transcription.
The sequences of the primers used for amplifying the S1 fragment and the S20 fragment are shown as follows:
SVA-1F0:
5’-gtgaggacgaaactataggaaaggaattcctatagtcttgaaagggggggctgggcc-3’(SEQ ID NO.6);
SVA-1F:5’-ataggtttaattaatgttaagcgtctgatgagtccgtgaggacgaaactatagga-3' (SEQ ID NO.7), the horizontal line part is PacI enzyme cutting site;
SVA-1R:5’-gggaagcatgctggggcaccaggcac-3' (SEQ ID NO.8), the horizontal line part is the enzyme cutting site of SphI;
SVA-2F1:5’-gttgagtccaaccctggacccgcttctgacaacccgatcctg-3’(SEQ ID NO.9);
SVA-2R:5’-ttttctagagcggccgct38-3' (SEQ ID NO.10), the horizontal line part is the NotI cleavage site, and t38 represents 38nt of Poly (T).
In the invention, a PacI enzyme digestion site and a hammerhead enzyme core sequence are introduced into an upstream primer SVA-1F, SVA-1F0 for amplifying an S1 fragment to ensure that infectious virus RNA is generated after transcription through shearing modification, and a downstream primer SVA-1R contains a SphI enzyme digestion site; the upstream primer for amplifying the S20 fragment is SVA-2F1, is used for amplification and is fused with the AVP1 fragment, and the downstream primer SVA-2R contains NotI enzyme cutting site and poly (T) of 38 nt. In the present invention, it is preferable to amplify the S1 fragment by first amplifying the S1 fragment with the primers SVA-1F0 and SVA-1R, using the amplification product as a template, and then performing a second amplification with the primers SVA-1F and SVA-1R to obtain the S1 fragment.
The amplification system and procedure for the S1 fragment and S20 fragment of the present invention are not particularly limited, and may be preferably performed according to the method described in "molecular biology laboratory Manual of Fine Manual" (Main eds., F.M. Osber, R.E. Kingston, J.G. Sadmann, Ma-Shi-Jun, Shujiong-translation, Beijing: scientific Press, 2004).
The VP1 gene fragment obtained in the step (1) is fused with the S20 gene fragment to obtain the S2-AVP1 fragment. The invention preferably utilizes the primers AVP1-F and SVA-2R to carry out fusion PCR to fuse gene segments; the nucleotide sequence of the AVP1-F is shown as SEQ ID NO.4, and the nucleotide sequence of the SVA-2R is shown as SEQ ID NO. 10. The amplification conditions of the fusion PCR of the present invention are preferably: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 57 ℃ for 30s, and 72 ℃ for 4min for 30 s; 10min at 72 ℃.
The S1 fragment and the S2-AVP1 fragment are respectively connected with a pMD 20T vector to obtain subclone plasmids PMD-S1 and PMD-S2-AVP 1. According to the invention, the S1 fragment and the S2-AVP1 fragment are preferably collected by respectively recovering the obtained amplification products by using glue. The present invention is not particularly limited to the system and procedure for the connection.
The subclone plasmid PMD-S1 is used as a template, mutation primers SVA-m5UTRF and SVA-m5 UTRA are used for amplification to obtain the subclone plasmid PMD-mS1, the nucleotide sequence of the SVA-m5UTRF is shown as SEQ ID No.11, and the nucleotide sequence of the SVA-m5 UTRA is shown as SEQ ID No. 12. The sequences of the mutation primers are respectively as follows:
SVA-m5UTRF:5’-gttctagcctactcgttttttcccctactcactcattcgtgttgtaactacaggat-3’(SEQ ID NO.11);
SVA-m5UTRR:5’-atcctgtagttacaacacgaatgagtgagtaggggaaaaaacgagtaggcta gaac-3’(SEQ ID NO.12)。
by using the scheme of the invention, the mutated 5' UTR gene segment comprises a nucleic acid sequence preferably shown as SEQ ID NO.1 or comprises the recombinant nucleic acid.
The invention uses PacI and SphI double enzyme digestion of plasmid PMD-mS1 and SphI and NotI double enzyme digestion of plasmid PMD-S2-AVP1 to recover gene segments, and inserts the gene segments into eukaryotic transcription plasmid prO/CHA/99 which is subjected to PacI and NotI double enzyme digestion to obtain recombinant plasmid prSVV/FJ-M-AVP 1. The recombinant plasmid prSVV/FJ-M-AVP1 contains a modified SVV/FJ/001 full-length gene and is simultaneously chimeric with an A-type FMDV VP1 gene.
The recombinant plasmid prSVV/FJ-M-AVP1 obtained is transfected into Seneca virus sensitive cells to obtain Seneca recombinant virus of recombinant A type FMDV VP1 gene. The Seneca virus sensitive cell comprises BHK-21 cell, PK-15 cell, ST cell, SK-RST cell, IBRS-2 cell, H1299 cell or 293T cell.
The invention also provides the application of the seneca recombinant virus of the recombinant A-type FMDV VP1 gene or the seneca recombinant virus prepared by the method in the preparation of the seneca recombinant vaccine.
The invention also provides a Seika recombinant vaccine of the recombinant A-type FMDV VP1 gene. The preparation method of the senecan recombinant vaccine is not particularly limited, and the vaccine can be prepared by using a conventional method in the field.
The invention also provides application of the epicaic recombinant vaccine strain or the epicaic recombinant vaccine in preparing a medicament for simultaneously preventing and/or controlling related diseases of animals caused by epicaic virus and foot-and-mouth disease virus.
The animals according to the present invention preferably include pigs, cattle or sheep.
In the present invention, the recombinant seneca virus/vaccine strain may preferably further comprise one or more antigenic genes of non-seneca valley virus strains, the non-seneca valley virus strains preferably comprising: foot-and-mouth disease virus, porcine circovirus, classical swine fever virus, porcine parvovirus and porcine reproductive and respiratory syndrome virus, so that the corresponding seneca recombinant vaccine prepared from the recombinant seneca virus can prevent and/or control related diseases caused by one or more non-seneca valley viruses besides animal seneca valley viruses.
The present invention provides a recombinant nucleic acid of Seneca virus and its application, which are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
The experimental procedures used in the following examples were carried out under conventional conditions, unless otherwise specified, as described in molecular biology laboratory Manual (ed. F.M. Osber, R.E. Kingston, J.G. Sedman, ed., Mashimi, Shujiong, Beijing: scientific Press, 2004).
Example 1
Acquisition of type A foot-and-mouth disease virus VP1 gene
The A/GDMM/2013 strain is deposited in a foot-and-mouth disease reference laboratory of a country designated by the veterinary office of Ministry of agriculture, and can be obtained by the public through a commission letter approved by the veterinary office of Ministry of agriculture. Primers for the synthetic amplification of VP1 were designed based on the A/GDMM/2013 strain gene sequence (Genebank: KF 450794):
AVP1-F0:
5'-gatgcaatcaggcgacgtcgagaccaaccctggccctatgaccaccgccaccggggaa-3'(SEQ ID NO.3);
AVP1-F:
5'-cccagcatgcttccctttcgcagctacaagcagaagatgctgatgcaatcaggcgacgtc-3'(SEQ ID NO.4);
AS-R:5'-caggatcgggttgtcagaagcgggtccagggttggactcaac-3'(SEQ ID NO.5)。
in the specific primers, SphI enzyme cutting sites and SVA gene sequences are introduced into an upstream primer AVP1-F, AVP1-F0 used for amplifying the AVP1 segment, and a downstream primer is AS-R used for amplification and fused with the SVA-S20 segment.
Extracting total RNA of A/GDMM/2013 with RNAeasy Mini Kit (Qiagen), Reverse transcribing with primer OligodT to synthesize first strand cDNA, Reverse transcribing with PrimeScript Reverse Transcriptase (TaKaRa) with very strong extending ability, preparing 20 uL reaction system according to the product instruction, reacting at 42 deg.C for 1h, using the Reverse transcribed first strand cDNA AS template, amplifying with primers AVP1-F0 and AS-R, using the amplified product AS template, performing second amplification with primers AVP1-F and AS-R to obtain gene fragment containing type A foot-and-mouth disease virus VP1, wherein the amplification uses LA suitable for long-fragment amplification and excellent performance
Figure BDA0002423415790000121
(TaKaRa Co., Ltd.) DNA polymerase, a 50. mu.L reaction system was prepared according to the product instructions, and the amplification conditions were as follows: at 94 ℃ for 5min, at 94 ℃ for 30s, at 57 ℃ for 30s, at 72 ℃ for 50s, after 35 cyclesAnd purifying and recovering PCR amplification products at 72 ℃ for 10 min. The sequencing result shows that the type A foot-and-mouth disease virus VP1 is the nucleotide sequence shown in SEQ ID NO. 2.
Example 2
Construction of infectious clone of Seneca virus of recombinant A-type foot-and-mouth disease virus VP1 gene
The SVV/FJ/001 strain used was deposited in the China center for type culture Collection (microbial Collection number: CCTCC NO: V201802), (disclosed in the granted patent "Sernica Valley Virus vaccine and its preparation method and application" ZL201810003888.2, "which is incorporated herein by reference in its entirety), and synthetic amplification primers were designed based on SVA genomic sequences (Genebank: KY 747510):
SVA-1F0:
5'-gtgaggacgaaactataggaaaggaattcctatagtcttgaaagggggggctgggcc-3'(SEQ ID NO.6);
SVA-1F:5'-ataggtttaattaatgttaagcgtctgatgagtccgtgaggacgaaactatagga-3'
(SEQ ID NO.7);
SVA-1R:5'-gggaagcatgctggggcaccaggcac-3'(SEQ ID NO.8);
SVA-2F1:5'-gttgagtccaaccctggacccgcttctgacaacccgatcctg-3'(SEQ ID NO.9);
SVA-2R:5'-ttttctagagcggccgct38-3'(SEQ ID NO.10);
SVA-m5UTRF:5'-gttctagcctactcgttttttcccctactcactcattcgtgttgtaactacaggat-3'(SEQ ID NO.11);
SVA-m5UTRR:
5'-atcctgtagttacaacacgaatgagtgagtaggggaaaaaacgagtaggctagaac-3'(SEQ ID NO.12)。
in the specific primers, a PacI enzyme digestion site and a hammerhead enzyme core sequence are introduced into an upstream primer SVA-1F, SVA-1F0 for amplifying an S1 fragment so as to ensure that infectious virus RNA is generated by shearing modification after transcription, and a downstream primer SVA-1R contains a SphI enzyme digestion site; the upstream primer for amplifying the S20 fragment is SVA-2F1, is used for amplification and is fused with the AVP1 fragment, and the downstream primer SVA-2R contains NotI enzyme cutting site and poly (T) of 38 nt. SVA-m5UTRF and SVA-m5UTRR are primers for deletion and site-directed mutagenesis of the 5' UTR gene on the S1 fragment.
Extracting total RNA of SVV/FJ/001 with RNAeasy Mini Kit (Qiagen), synthesizing first strand cDNA by Reverse transcription with primer SVA-2R, preparing 20 muL reaction system according to product instruction, reacting for 1h at 42 ℃ for standby, using Reverse transcribed first strand cDNA as template, amplifying with primers SVA-1F0 and SVA-1R, using the amplification product as template, performing second amplification with primers SVA-1F and SVA-1R to obtain first gene segment S1; and amplifying by using primers SVA-2F1 and SVA-2R by using the reverse transcribed first strand cDNA as a template to obtain a second gene segment S20. The LA for amplification is suitable for long-fragment amplification and has excellent performance
Figure BDA0002423415790000131
(TaKaRa Co., Ltd.) DNA polymerase, a 50. mu.L reaction system was prepared according to the product instructions, and the amplification conditions were as follows: 5min at 94 ℃, 30s at 57 ℃, 3min at 72 ℃ for 30s, purifying and recovering PCR amplification products after 35 cycles and 10min at 72 ℃.
Carrying out fusion PCR by using the gene fragment containing the type A foot-and-mouth disease virus VP1 obtained in example 1 and the amplified S20 gene fragment as templates, adding primers AVP1-F and SVA-2R into the reaction to obtain an SVA S2-AVP1 fragment, wherein the amplification conditions are as follows: 5min at 94 ℃, 30s at 57 ℃, 30 min at 72 ℃ and 30s at 4min, purifying and recovering PCR amplification products after 30 cycles and 10min at 72 ℃. The electrophoresis results of the amplification products are shown in FIG. 1, and the sizes of S1 and S2-AVP1 are 3506bp and 4584bp, respectively, which are consistent with the expected sizes.
The S1 and S2-AVP1 gene fragments are respectively recovered by glue, connected with a pMD 20T vector, transformed into JM109 competent cells, screened, sequenced and identified as positive clones which are respectively named as PMD-S1 and PMD-S2-AVP 1. Amplifying by using plasmid PMD-S1 as template and primer SVA-m5 UTRT and SVA-m5 UTRT, deleting and mutating 5' UTR gene on S1 fragment, amplifying by using high fidelity
Figure BDA0002423415790000132
HS (TaKaRa Co., Ltd.) DNA polymerase according to the productThe specification prepares a 50-mu-L reaction system, and the amplification conditions are as follows: 5min at 95 ℃; 1min at 95 ℃, 1min at 55 ℃ and 6min at 68 ℃ after 20 cycles; and (2) digesting the amplification product by DpnI at 68 ℃ for 10min to remove the template plasmid, transforming DH5 alpha competent cells, screening, sequencing and identifying a positive clone, namely PMD-mS1, wherein the sequencing result shows that mS1 contains a 5' UTR gene modified by deletion mutation and is a nucleotide sequence shown as SEQ ID NO. 1.
Plasmid PMD-mS1 is subjected to double enzyme digestion by PacI and SphI, plasmid PMD-S2-AVP1 is subjected to double enzyme digestion by SphI and NotI, target fragments are respectively recovered, then plasmid prO/CHA/99 (disclosed in an granted patent of 'Asia 1 type foot-and-mouth disease recombinant virus and a preparation method and application thereof' ZL201310175323.X 'A type foot-and-mouth disease recombinant vaccine strain and a preparation method and application thereof' 483ZL 5', which are incorporated into the application in full-text by reference) containing foot-and-mouth disease virus O/CHA/99 strain is subjected to double enzyme digestion by PacI and NotI, vector fragments are purified and recovered, are connected by T4 ligase and are transformed into JM109 competent cells, and are subjected to enzyme digestion, sequencing and positive cloning to obtain SVA recombinant plasmid prSVV/FJ-M-AVP1 containing VP1 gene of 5' UTR modified foot-and foot-mouth disease virus A type foot-mouth disease virus, and the construction method is shown in figure 2.
Example 3
Rescue of recombinant A-type foot-and-mouth disease virus VP1 gene senocard virus and culture characteristics of different cells
3.1 rescue of recombinant Selenecar viruses
By using
Figure BDA0002423415790000141
Plasmid Plus Maxi Kit (QIAGEN Co.) the recombinant Plasmid prSVV/FJ-M-AVP1 from example 2 was prepared, used for transfection when BHK-21 cells grew to 80%, in liposomal LipofectamineTM2000(Invitrogen) 4. mu.g of recombinant plasmid was transfected into BHK-21 cells, together with liposome controls and normal cell controls, and placed in a 5% CO-containing chamber2Transfecting in a 37 ℃ incubator for 6h, removing the supernatant, adding MEM (minimum essential medium) into the incubator, continuously culturing, observing the cell state and the cytopathic condition, harvesting the virus when about 90% of cells have lesions, repeatedly freezing and thawing for 3 times, and inoculating the virus againBHK-21 cells are planted until virus can stably produce cytopathy, and the cytopathy phenomena of cell rounding, cell falling, plaque formation and fragment disintegration are gradually generated. The resulting recombinant virus was named rSVV/FJ-M-AVP1, and in FIG. 3, A: a normal control BHK-21 cell picture is obtained; b: the rescued recombinant virus rSVV/FJ-M-AVP1 infected BHK-21.
3.2 culture Properties of recombinant Selenecar viruses in different cells
The recombinant Securium insignis virus rSVV/FJ-M-AVP1 strain obtained by the 3.1 rescue is infected into different cells, and the result shows that the recombinant strain can proliferate in BHK-21 cells, PK-15 cells, ST cells, SK-RST cells, IBRS-2 cells, H1299 cells or 293T cells and other cells and cause typical cytopathic effect, and has similar culture characteristics with wild parent strain SVV/FJ/001 strain on the different cells.
Example 4
Identification of Senecan recombinant virus of recombinant A-type foot-and-mouth disease virus VP1 gene
4.1 RT-PCR identification of the stability of recombinant viruses
The supernatant of BHK-21 cells infected by the stably passaged rSVV/FJ-M-AVP1 strain is extracted by RNAeasy Mini Kit (Qiagen), total RNA is extracted, after reverse transcription, S2-AVP1 gene fragment of fusion AVP1 gene and S1 gene containing 5'UTR are amplified, purified and recovered, and then sent for sequencing, and the result shows that the obtained fragment inserted with foreign gene and 5' UTR gene are consistent with the theoretical sequence. The recombinant viruses of passage 5, 10, 15 and 20 are amplified by the same method, and sequencing shows that the AVP1 gene inserted by the recombinant viruses in the passage process and site-directed deletion mutation of 5' UTR can stably exist.
4.2 Indirect immunofluorescence identification of SVA Virus antigens
Repeatedly freezing and thawing the culture of the rSVV/FJ-M-AVP1 strain infected BHK-21 cells, inoculating the culture into a six-hole plate (monolayer cells grow to 60-70%) with BHK-21 cells and a glass slide at the bottom, and placing the six-hole plate with the BHK-21 cells in a medium containing 5% CO2In a 37 ℃ incubator, after 24 hours, indirect immunofluorescence is carried out according to a conventional method, wherein a primary antibody is SVA guinea pig positive serum, a secondary antibody is FITC labeled goat anti-guinea pig IgG (Sigma company), and normal fine particles are arranged at the same timeAnd (4) cell comparison. Green-specific fluorescence was seen in cells inoculated with the culture of rSVV/FJ-M-AVP1 strain, whereas no fluorescence was seen in the normal cell control (FIG. 4).
4.3 ELISA detection
Repeatedly freezing and thawing culture of SVV/FJ/001 strain, rSVV/FJ-M-AVP1 strain and A/GDMM/2013 strain, respectively inactivating, diluting with coating solution, coating ELISA reaction plate, detecting reactivity of the coating antigen and specific antibody of A type FMDV by indirect ELISA method with normal cell culture as control, wherein the first antibody is A type FMDV rabbit polyclonal antibody, and the second antibody is HRP-labeled goat anti-rabbit IgG (Sigma). The rSVV/FJ-M-AVP1 strain can specifically bind to type A FMDV antibody, and the reactivity of A/GDMM/2013 strain to the antibody is similar, and neither SVV/FJ/001 strain nor cell culture react with type A FMDV specific antibody (FIG. 5).
4.4 Westernblot analysis
Collecting cells infected by SVV/FJ/001 strain, rSVV/FJ-M-AVP1 strain, A/GDMM/2013 strain and normal control cells, processing cell protein samples according to a Western blot method, performing SDS-PAGE electrophoresis, membrane transfer and blocking, wherein the primary antibody is an A-type FMDV rabbit polyclonal antibody, and the secondary antibody is HRP-labeled goat anti-rabbit IgG (Sigma). The results showed that the rSVV/FJ-M-AVP1 strain-infected cell sample detected a specific reaction band around 25kD, which was slightly larger than the A/GDMM/2013 strain sample, presumably due to 2A fusion expression. In contrast, protein bands were not observed in both the SVV/FJ/001 strain samples and the normal cell control (FIG. 6).
Example 5
Pathogenicity test of Seneca recombinant virus of recombinant A-type foot-and-mouth disease virus VP1 gene
5.1 test of the pathogenicity of recombinant Selenecar Virus on cells
Digesting susceptible cells of SVA such as BHK-21 cells, PK-15 cells, ST cells, IBRS-2 cells, etc. in example 3 according to a conventional method, adding DMEM complete medium containing 10% fetal bovine serum, plating the cells in 12-well plates containing 5% CO at 37 deg.C2The culture is carried out in an incubator until the cell monolayer grows to 80-90 percent for standby. Viral fluids were diluted 10-fold with DMEM, and each dilution (10)-5.0~10-10.0) Respectively, virus liquid ofAdding into cell plate, diluting each with 4 wells, and placing at 37 deg.C with 5% CO2The cells were cultured in the incubator (2), observed for 4 days, and half of the infection amount (TCID) of the virus to different cells such as BHK-21 cells was measured by the Reed-Muench method50). According to this method, the virus titer of rSVV/FJ-M-AVP1 strain on different cells such as BHK-21 was measured, and the TCID of rSVV/FJ-M-AVP1 strain was calculated50Is 10-6.5/mL~10-10.0/mL。
The Reed-Muench calculation Method is prior art in the art and is described in detail in the prior document "Reed, L.J.and Muench, H. (1938)," A Simple Method of Estimating Fine percentage Endpoints ". The American Journal of herene 27: 493-497", which is hereby incorporated by reference into the present application.
5.2 pathogenicity test of recombinant Seneca Virus in pigs
9 pigs for the screening test in the non-affected area are detected by a neutralization test, and the SVV neutralizing antibody titer is less than 1: 4. according to the conditions of the established virus attacking model of the SVV/FJ/001 strain to the pig, the prepared rSVV/FJ-M-AVP1 strain is subjected to virus attacking by adopting an injection way, two gradients are set for the virus attacking dosage, and the two gradients are respectively 2 multiplied by 109TCID50,2×1010TCID50Simultaneously, SVV/FJ/001 strain cytotoxicity is set as a contrast, and the counteracting dosage is 2 multiplied by 109 TCID 502 mL/head, continuously observing for 13 days, observing and recording the morbidity, judging the morbidity of the animals according to the symptoms of blisters on hooves, rhinoscopes and lips, and scoring (5 points, the judgment standard is made according to the judgment standard of the foot-and-mouth disease, and the higher the point is, the more serious the clinical symptoms are). The challenge results show that typical clinical symptoms appear from the next day after the control of the wild parent strain SVV/FJ/001 strain, blisters appear on hooves, and some blisters appear on a rhinoscope. After the recombinant Seneca virus rSVV/FJ-M-AVP1 strain is challenged, no clinical symptoms appear in both challenged dose groups, and the results are shown in Table 1.
TABLE 1 clinical symptoms of the porcine pathogenicity test with recombinant Seneca Virus
Figure BDA0002423415790000171
Example 6
Preparation and immunoassay of Sai Nei card recombinant vaccine of recombinant A-type foot-and-mouth disease virus VP1 gene
6.1 vaccine preparation
The obtained rSVV/FJ-M-AVP1 strain was cultured according to the method of example 3, the virus was inoculated into the susceptible cells forming a monolayer in an amount of 1% of the culture medium, when the lesion reached more than 80%, the cell culture medium containing the virus was harvested, and after repeated freeze-thawing, it was stored at-70 ℃ for future use. The virus content was determined as described in example 5, and the TCID of the virus was calculated according to the Reed-Muench method50Results were no less than 10 per ml of virus fluid6.5TCID50. Inactivating with 1.5mmol/L of Binary Ethylene Imine (BEI) (Sigma Co.) at 30 deg.C for 36h, adding blocking agent sodium thiosulfate solution, standing overnight at 4 deg.C, and storing. Inactivated antigen was screened with ISA206 adjuvant (SEPPIC, france) at a ratio of 1: emulsifying at a ratio of 1 to prepare the water-in-oil-in-water vaccine, and subpackaging for later use.
6.2 vaccine immunization test
The obtained seneca recombinant virus inactivated vaccine qualified in security inspection is used for immunizing 5 pigs, and 2 non-immune controls are arranged at the same time to determine the immune efficacy. Experimental pigs were purchased from non-affected areas and tested by neutralization experiments, and the titer of SVA neutralizing antibody was < 1: 4; the A-type antibodies detected by FMD liquid blocking ELISA (LPB-ELISA) produced by national foot-and-mouth disease reference laboratory are all less than 1: 4. the second immunization is carried out at 28d of the first immunization, blood is collected and serum is separated at 7 days, 14 days, 21 days, 28 days and 42 days after the immunization, the SVA carries out neutralization antibody detection and statistics of detection results, and the 42d serum detects A type FMDV antibody, and the results show that the vaccine has good immunogenicity, can effectively excite serum SVA neutralizing antibody (table 2), can generate specific antibody of FMDV, and has the titer of more than or equal to 64.
TABLE 2 detection results of SVA neutralizing antibody levels after Immunity of Senecan recombinant vaccines
Figure BDA0002423415790000181
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Lanzhou veterinary research institute of Chinese academy of agricultural sciences
<120> Senecan recombinant virus and recombinant vaccine strain of recombinant A-type foot-and-mouth disease virus VP1 gene, and preparation method and application thereof
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 655
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ttgaaagggg gggctgggcc ctcatgccca gtccttcctt tccccttccg gggggtaaac 60
cggctgtgtt tgctagaggc acagaggagc aacatccaac ctgcttttgt ggggaacagt 120
gcggctccaa ttcctgcgtc gccaaaggtg ttagcgcacc caaacggcgc atctaccaat 180
gctattggtg tggtctgcga gttctagcct actcgttttt tcccctactc actcattcgt 240
gttgtaacta caggatttgg ccctcgcacg ggatgtgcga taaccgcaag attgactcaa 300
gcgcggaaag cgttgtaacc acatgctgtt agtcccttta tggctgtgag atggctatcc 360
acctcggatc actgaactgg agctcgaccc tccttagtaa gggaaccgag aggccttcct 420
gcaacaagct ccgacacaga gtccacgtga ttgctaccac catgagtaca tggttctccc 480
ctctcgaccc aggacttctt tttgaatatc cacggctcga tccagagggt ggggcatgat 540
ccccctagca tagcgagcta cagcgggaac tgtagctagg ccttagcgtg ccttggatac 600
tgcctgatag ggcgacggcc tagtcgtgtc ggttctatag gtagcacata caaat 655
<210> 2
<211> 690
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
atgaccaccg ccaccgggga atcagcagac cctgtcacaa ccaccgttga gaactacggt 60
ggcgagacac aagtacagcg gcgttaccac accgacgtcg gcttcttaat ggacaggttc 120
gtgcagatca agcctgtggg ccccacacat gtcattgacc tcatgcagac acaccaacac 180
gggctggtgg gcgccatgtt gcgcgcggcc acctactact tttctgatct tgagattgtg 240
gtgaaccaca cgggtaacct aacgtgggta cccaatggag cacccgaggc agcactgcaa 300
aacacgagca accccactgc ttaccacaaa gcgccgttca cgaggcttgc gctcccctac 360
accgcgccac accgcgtgct ggcaactgtg tacagtggga cgagcaagta ctccgcacct 420
caaaaccggc gaggtgactc gggtcctctc gcggcgagac tcgctgcaca gctccctgcc 480
tccttcaact tcggtgcaat tcgggccacg gagatccgcg aactccttgt gcgcatgaag 540
cgcgccgagc tctactgccc caggccactg ttggcggtgg aggtgtcgtc gcaagacaga 600
cacaagcaga aaatcattgc ccctgcaaaa caactcctga actttgacct gctcaagttg 660
gcgggagacg ttgagtccaa ccctggaccc 690
<210> 3
<211> 58
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gatgcaatca ggcgacgtcg agaccaaccc tggccctatg accaccgcca ccggggaa 58
<210> 4
<211> 60
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
cccagcatgc ttccctttcg cagctacaag cagaagatgc tgatgcaatc aggcgacgtc 60
<210> 5
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
caggatcggg ttgtcagaag cgggtccagg gttggactca ac 42
<210> 6
<211> 57
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gtgaggacga aactatagga aaggaattcc tatagtcttg aaaggggggg ctgggcc 57
<210> 7
<211> 55
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
ataggtttaa ttaatgttaa gcgtctgatg agtccgtgag gacgaaacta tagga 55
<210> 8
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
gggaagcatg ctggggcacc aggcac 26
<210> 9
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
gttgagtcca accctggacc cgcttctgac aacccgatcc tg 42
<210> 10
<211> 55
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
ttttctagag cggccgcttt tttttttttt tttttttttt tttttttttt ttttt 55
<210> 11
<211> 56
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
gttctagcct actcgttttt tcccctactc actcattcgt gttgtaacta caggat 56
<210> 12
<211> 56
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
atcctgtagt tacaacacga atgagtgagt aggggaaaaa acgagtaggc tagaac 56

Claims (10)

1. The sequence of the recombinant nucleic acid comprises deletion mutation transformation of a 5' UTR gene sequence of a seneca virus strain, and insertion of a VP1 gene of A-type foot-and-mouth disease virus between Sph I and Not I enzyme cutting sites of seneca virus cDNA.
2. Use of the recombinant nucleic acid of claim 1 in the preparation of seneca virus recombinant nucleic acid or seneca recombinant vaccine strain of recombinant type A FMDVVP1 gene.
3. A seneca recombinant virus comprising the recombinant FMDVVP1 type a gene of the recombinant nucleic acid of claim 1.
4. A seneca recombinant virus of the recombinant type a FMDVVP1 gene encoded by the recombinant nucleic acid of claim 1.
5. A recombinant vaccine strain comprising the recombinant Seika vims of claim 3 or 4.
6. The method for constructing a seneca recombinant virus according to claim 3 or 4, comprising the steps of:
(1) using cDNA of A/GDMM/2013 strain as a template, and amplifying by using a specific primer pair to obtain VP1 gene of A-type FMDV; the specific primer pair for amplifying the VP1 gene comprises an upstream primer and a downstream primer AS-R, wherein the upstream primer comprises AVP1-F0 and AVP1-F, the nucleotide sequence of the upstream primer AVP1-F0 is shown AS SEQ ID No.3, the nucleotide sequence of the upstream primer AVP1-F is shown AS SEQ ID No.4, and the nucleotide sequence of the downstream primer AS-R is shown AS SEQ ID No. 5;
(2) respectively amplifying to obtain an S1 fragment and an S20 fragment of the SVV/FJ/001 strain by using a specific primer pair by taking the cDNA of the SVV/FJ/001 strain as a template; the specific primer pair for amplifying the S1 fragment comprises an upstream primer and a downstream primer SVA-1R, wherein the upstream primer comprises SVA-1F0 and SVA-1F; the nucleotide sequence of the upstream primer SVA-1F0 is shown as SEQ ID NO.6, and the nucleotide sequence of the upstream primer SVA-1F is shown as SEQ ID NO. 7; the nucleotide sequence of the downstream primer SVA-1R is shown as SEQ ID NO. 8;
the specific primer pair for amplifying the S20 fragment comprises an upstream primer SVA-2F1 and a downstream primer SVA-2R, the nucleotide sequence of the upstream primer SVA-2F1 is shown as SEQ ID NO.9, and the nucleotide sequence of the downstream primer SVA-2R is shown as SEQ ID NO. 10;
(3) fusing the VP1 gene fragment obtained in the step (1) with the S20 gene fragment to obtain an S2-AVP1 fragment;
(4) respectively connecting the S1 fragment and the S2-AVP1 fragment with a pMD 20T vector to obtain subclone plasmids PMD-S1 and PMD-S2-AVP 1;
(5) amplifying by using mutation primers SVA-m5UTRF and SVA-m5 UTRA by using the subcloning plasmid PMD-S1 as a template to obtain a subcloning plasmid PMD-mS1, wherein the nucleotide sequence of the SVA-m5 UTRA is shown as SEQ ID NO.11, and the nucleotide sequence of the SVA-m5 UTRA is shown as SEQ ID NO. 12;
(6) carrying out double enzyme digestion on plasmid PMD-mS1 by PacI and SphI, carrying out double enzyme digestion on plasmid PMD-S2-AVP1 by SphI and NotI, recovering a gene fragment, and inserting the gene fragment into eukaryotic transcription plasmid prO/CHA/99 subjected to double enzyme digestion by PacI and NotI in a connecting and replacing manner to obtain recombinant plasmid prSVV/FJ-M-AVP 1;
(7) transfecting the obtained recombinant plasmid prSVV/FJ-M-AVP1 to a seneca virus sensitive cell to obtain the seneca recombinant virus of the recombinant A-type FMDVVP1 gene.
7. Use of the seneca recombinant virus of the recombinant type A FMDVVP1 gene of claim 3 or 4 or the seneca recombinant virus prepared by the method of claim 6 in the preparation of a seneca recombinant vaccine.
8. A senecan recombinant vaccine of a recombinant A-type FMDVVP1 gene.
9. Use of the seneca recombinant vaccine strain of claim 5 or the seneca recombinant vaccine of claim 8 for the preparation of a medicament for the simultaneous prevention and/or control of related diseases caused by seneca virus and foot-and-mouth disease virus in animals.
10. The use of claim 9, wherein the animal comprises a pig, a cow or a sheep.
CN202010212907.XA 2020-03-24 2020-03-24 Samlika recombinant virus and recombinant vaccine strain of recombinant A-type foot-and-mouth disease virus VP1 gene, and preparation method and application thereof Active CN111996201B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010212907.XA CN111996201B (en) 2020-03-24 2020-03-24 Samlika recombinant virus and recombinant vaccine strain of recombinant A-type foot-and-mouth disease virus VP1 gene, and preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010212907.XA CN111996201B (en) 2020-03-24 2020-03-24 Samlika recombinant virus and recombinant vaccine strain of recombinant A-type foot-and-mouth disease virus VP1 gene, and preparation method and application thereof

Publications (2)

Publication Number Publication Date
CN111996201A true CN111996201A (en) 2020-11-27
CN111996201B CN111996201B (en) 2021-07-13

Family

ID=73461462

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010212907.XA Active CN111996201B (en) 2020-03-24 2020-03-24 Samlika recombinant virus and recombinant vaccine strain of recombinant A-type foot-and-mouth disease virus VP1 gene, and preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN111996201B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115850394A (en) * 2023-01-08 2023-03-28 中国农业科学院兰州兽医研究所 B cell epitope peptide of Seneca virus VP2 structural protein and application thereof
CN116159133A (en) * 2022-09-15 2023-05-26 中农威特生物科技股份有限公司 Pig A-type foot-and-mouth disease mRNA vaccine and preparation method thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110317278A (en) * 2019-08-02 2019-10-11 天康生物(上海)有限公司 The fusion protein and its encoding gene of SVV and FMDV, expression vector, cell line, engineering bacteria and vaccine and application

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110317278A (en) * 2019-08-02 2019-10-11 天康生物(上海)有限公司 The fusion protein and its encoding gene of SVV and FMDV, expression vector, cell line, engineering bacteria and vaccine and application

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
宋高媛等: "嵌合口蹄疫病毒抗原表位的重组塞内卡病毒A的构建及其鉴定", 《畜牧兽医学报》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116159133A (en) * 2022-09-15 2023-05-26 中农威特生物科技股份有限公司 Pig A-type foot-and-mouth disease mRNA vaccine and preparation method thereof
CN116159133B (en) * 2022-09-15 2024-02-20 中农威特生物科技股份有限公司 Pig A-type foot-and-mouth disease mRNA vaccine and preparation method thereof
CN115850394A (en) * 2023-01-08 2023-03-28 中国农业科学院兰州兽医研究所 B cell epitope peptide of Seneca virus VP2 structural protein and application thereof
CN115850394B (en) * 2023-01-08 2023-10-20 中国农业科学院兰州兽医研究所 B cell epitope peptide of structural protein of sai-Ka virus VP2 and application

Also Published As

Publication number Publication date
CN111996201B (en) 2021-07-13

Similar Documents

Publication Publication Date Title
CN109762792B (en) Porcine reproductive and respiratory syndrome virus chimeric strain and application thereof
US10918710B2 (en) Temperature-sensitive attenuated FMDV strains, construction method and application thereof
CN111019910B (en) F genotype mumps virus attenuated strain, construction method and application thereof
US10421790B2 (en) Feline calicivirus vaccine
CN111575247B (en) Newcastle disease chimeric virus marked vaccine strain and construction method and application thereof
CN107201346B (en) Foot-and-mouth disease marked vaccine strain with 3B protein dominant epitope deletion and construction method and application thereof
US11883482B2 (en) Recombinant nucleic acid of Seneca valley virus, recombinant vaccine strain and preparation method and use thereof
CN111744000B (en) Foot-and-mouth disease recombinant virus with reduced immunosuppressive function and preparation method and application thereof
CN109321534A (en) A kind of recombination VIII type newcastle disease virus low virulent strain
CN111996201B (en) Samlika recombinant virus and recombinant vaccine strain of recombinant A-type foot-and-mouth disease virus VP1 gene, and preparation method and application thereof
US8409588B2 (en) Recombinant foot and mouth disease vaccine
CN103555680B (en) One has immunogenic PRRSV virus-like particle and preparation and application thereof
CN113061587A (en) Antigen spectrum expanded O-type foot-and-mouth disease virus strain and construction method and application thereof
CN112280753A (en) Pseudorabies virus TK, gE, gI and gG gene deletion strain and preparation method and application thereof
CN111961654B (en) Heat-resistant phenotype-stable genetic recombinant foot-and-mouth disease virus (FMDV) avirulent strain carrying negative marker and O/A type FMDV bivalent inactivated vaccine
CN104250638A (en) Porcine reproductive and respiratory syndrome virus attenuated strain, vaccine composition and preparation method and application thereof
CN117143924B (en) Recombinant feline herpesvirus co-expressing feline calicivirus and feline parvovirus antigen proteins, live vector vaccine and application thereof
CN111996203B (en) Sai-lnica recombinant virus and recombinant vaccine of recombinant O-type foot-and-mouth disease virus epitope gene, and preparation method and application thereof
CN111996202B (en) Indocard recombinant virus and recombinant vaccine strain of recombinant O-type foot-and-mouth disease virus VP1 gene, and preparation method and application thereof
CN107041951B (en) Recombinant trivalent inactivated vaccine for foot-and-mouth disease and preparation method and application thereof
CN111944770B (en) Foot-and-mouth disease virus attenuated mutant strain and preparation method and application thereof
CN114606207B (en) Porcine epidemic diarrhea virus variant strain independent of pancreatin and construction and application thereof
CN106929519B (en) Nucleotide sequence, expressed protein, strain, vaccine composition prepared from nucleotide sequence and expressed protein, and application of vaccine composition
CN118291537A (en) Construction method and application of sai card virus-3A negative mark virus
CN115820572A (en) Recombinant virus strain for expressing double-copy Lassa fever virus GP gene and construction method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant