CN114606207B

CN114606207B - Porcine epidemic diarrhea virus variant strain independent of pancreatin and construction and application thereof

Info

Publication number: CN114606207B
Application number: CN202210214959.XA
Authority: CN
Inventors: 肖少波; 方六荣; 李明翔; 周艳荣; 方谱县; 卢佑新; 彭旋
Original assignee: Huazhong Agricultural University
Current assignee: Wuhan Keqian Biological Co ltd
Priority date: 2022-03-05
Filing date: 2022-03-05
Publication date: 2022-09-20
Anticipated expiration: 2042-03-05
Also published as: CN114606207A

Abstract

The invention relates to a porcine epidemic diarrhea virus variant strain independent of pancreatin and construction and application thereof. Specifically, a CRISPR/Cas9 is used for cutting an infectious clone plasmid pBAC-AJ1102 strain of porcine epidemic diarrhea virus variant strain AJ1102, and a homologous recombination mode is further used for obtaining a recombinant plasmid pBAC-AJ1102-S2' of which the gene of PEDV AJ1102 strain S2' is replaced by the gene of JS2008 strain S2' _JS2008 Rescue of pancreatin-independent recombinant Virus rAJ1102-S2 'following transfection of the cells' _JS2008 . Recombinant virus rAJ1102-S2' _JS2008 The proliferation titer in the cells is obviously higher than that of the AJ1102 strain; rAJ1102-S2 'compared with AJ1102 strain' _JS2008 Strains can induce higher levels of neutralizing antibodies against the classical strain of PEDV JS 2008.

Description

Porcine epidemic diarrhea virus variant strain independent of pancreatin and construction and application thereof

Technical Field

The invention belongs to the technical field of animal virology and genetic engineering, and particularly relates to a porcine epidemic diarrhea virus variant strain independent of pancreatin, and construction and application thereof.

Background

Porcine Epidemic Diarrheal Virus (PEDV) is an enterocoronavirus that mainly causes vomiting, diarrhea, dehydration and death of newborn piglets. In 1971, the United kingdom first reported the emergence of PEDV, and later in Europe in several countries also reported the emergence of PEDs (Pensaert MB et al. A new coronavirus-like composites associated with a dialhrea in Swine. Arch Virol,1978,58: 243. sup. 247; Takahashi K et al. an outbreak of a new type associated with a coranvirus like composites in Japan. vet Sci,1983,45: 829. 832). And it is found that vaccines prepared from classical strains do not effectively protect immunized pigs against infection by PEDV variant strains, and there is therefore an urgent need to develop vaccines from PEDV variant strains.

However, pancreatin is required to be added when the PEDV variant strain is cultured in cells at present, so that the difficulty of virus culture is increased, the basic research of the virus and the development of the vaccine are influenced, and the pancreatin is not required to be added when the PEDV classical strain is cultured. It has been reported in the literature that pancreatin-independent strains can be obtained by serial passages of PEDV variant strains or by screening with other reagents, but this method is usually carried out for about 30 generations, and is time-consuming, and the genes encoding the virus may mutate during in vitro subculture, which may lead to changes in immunogenicity and pathogenicity (Sun M et al. identification of two mutation sites in plasmid and expression proteins mediated optimal cellular infection of viral immunogenic genes in 2017,30:48(1): 44).

The CRISPR/Cas9technology is a new gene editing technology developed in recent years, and can cut BAC plasmids containing virus full-length DNA or cDNA in vitro, obtain recombinant BAC plasmids in a homologous recombination mode, and rescue recombinant viruses after transfecting cells. The method can be used for quickly obtaining the accurately edited strain, and has the outstanding advantages of simple operation, high efficiency and the like.

In the prior art, after the S2 subunit of the PEDV variant strain YN200 of G2 type is replaced by the S2 subunit of the DR13 strain of vaccine strain of G1 type by using CRISPR/Cas9technology, pancreatin dependence of YN200 is changed to become pancreatin independent strain (study on mechanism of influence of S protein of porcine epidemic diarrhea virus on pancreatin study [ D ]. university of agriculture in huazhong, 2021). However, the recombinant virus replaces the whole S2 subunit of the PEDV strain YN200, lacks part of antigenic sites in the S2 subunit of the PEDV strain YN200, and is not beneficial to preparing vaccines for resisting PEDV variant strains, and in addition, research reports that the dependence of the strains on pancreatic enzymes can be changed by mutating amino acid sites on S2 subunits of S genes of the PEDV strain (Li W et al. A single-site mutation a viral clearance site in the spike protein reproducing site cannot be improved) (Li W et al. A single-site mutation a viral titer is not improved) (J Virol,2015,89(15): 8077-81).

Disclosure of Invention

The invention aims to provide a porcine epidemic diarrhea virus variant strain independent of pancreatin, which is obtained quickly by replacing part of S2 genes of the variant strain AJ1102, and the in vitro proliferation titer of the recombinant variant strain is obviously improved compared with that of a parent strain AJ 1102.

The invention also aims to provide application of the porcine epidemic diarrhea virus variant strain independent of pancreatin in preparing porcine epidemic diarrhea inactivated vaccines.

In order to achieve the purpose, the invention adopts the following technical measures:

through comparing the sequences of the PEDV classical strain and the variant strain S gene, the variant strain AJ1102 strain and the variant strain JS2008 strain S gene are found to have larger difference. The invention obtains recombinant viruses rAJ1102-S2 'which are completely independent of pancreatin and can be stably passaged in vitro by replacing the S2' subunit of the variant strain AJ1102 strain with the S2 'subunit of the classical strain JS2008 strain' _JS2008 Moreover, the multiplication titer of the recombinant virus is obviously improved compared with that of a parent strain; animal experiments prove that the strain can not only induce the generation of neutralizing antibodies against the PEDV variant strain AJ1102 consistent with the parent strain AJ1102 strain, but also rAJ1102-S2 'compared with the AJ1102 strain' _JS2008 The strain can induce higher level of neutralizing antibody against the PEDV classical strain JS2008, so the strain can be used as a candidate strain for producing porcine epidemic diarrhea inactivated vaccine. Meanwhile, the strain is used for preparing the vaccine, so that the production process of the vaccine can be simplified, the antigen content is improved, and the cost is reduced。

The recombinant virus rAJ1102-S2' _JS2008 The CRISPR/Cas9technology is used for construction, and the specific steps are as follows:

(1) two sgRNA primers targeting the upstream and downstream of S2' subunit of the S gene of the PEDV AJ1102 strain are designed, overlap extension PCR amplification is carried out respectively with a primer scaffold oligo to obtain transcription templates of sgRNA-S2' a and sgRNA-S2' b, and in vitro transcription is carried out to obtain sgRNA-S2' a and sgRNA-S2' b.

(2) The BAC plasmid pBAC-AJ1102 containing the PEDV AJ1102 strain full-length cDNA is cut by using a CRISPR/Cas9 system, and the linearized BAC plasmid is obtained by recovering a kit.

(3) The sequence of replacing the PEDV AJ1102 strain S2 'subunit with the JS2008 strain S2' subunit is obtained by fusion PCR amplification, and the fusion fragment and the upper stream and the lower stream of the linearized BAC plasmid respectively contain 20bp homologous arms.

(4) Homologous recombination is carried out on the BAC plasmid linearized in the step (2) and the fusion fragment in the step (3), and an infectious clone plasmid pBAC-AJ1102-S2 'with the subunit sequence of the AJ 1102S gene S2' replaced by the subunit sequence of the JS 2008S gene S2 'is obtained' _JS2008 。

(5) Mixing pBAC-AJ1102-S2' _JS2008 DH10B chemical competent cells are transformed, positive clones are screened by PCR and sequenced, and the positive clones with correct sequencing are amplified and cultured to extract a large amount of plasmids.

(6) Mixing pBAC-AJ1102-S2' _JS2008 Positive clone transfects Vero cell, rescues recombinant virus PEDV rAJ1102-S2' _JS2008 Obtaining the strain of the porcine epidemic diarrhea virus variant strain PEDV rAJ1102-S2' _JS2008 。

Compared with the prior art, the invention has the following advantages:

the invention replaces the smallest gene segment S2' according to the S gene difference of the variant strain AJ1102 and the classical strain JS2008, and retains the immunogenicity of the original strain as far as possible. The obtained recombinant strain is still a PEDV variant strain, but pancreatin is not required to be added in-vitro culture, the proliferation titer is obviously improved compared with that of a parent strain AJ1102, and a higher neutralizing antibody aiming at a PEDV classical strain JS2008 can be induced.

Drawings

FIG. 1: porcine epidemic diarrhea virus infectious clone plasmid pBAC-AJ1102-S2' _JS2008 Schematic diagram of the construction of (1).

FIG. 2: electrophorogram after pBAC-AJ1102 in vitro cleavage.

FIG. 3: electrophoresis chart of the replaced template of S2' subunit of PEDV AJ1102 strain S gene.

FIG. 4: PEDV AJ1102 strain, JS2008 strain and rescued PEDV rAJ1102-S2' _JS2008 Pictures of strains infected with Vero cells.

FIG. 5: indirect immunofluorescence identification of rescued PEDV rAJ1102-S2' _JS2008 In the figure, Trypsin and No Trypsin respectively represent the conditions under the pancreatin condition and the non-pancreatin condition; mock represents the control non-vaccinated group.

FIG. 6: PEDV rAJ1102-S2 'with and without pancreatin' _JS2008 Propagation curves of the strain, JS2008 strain and AJ1102 strain in Vero cells.

FIG. 7: PEDV rAJ1102-S2' _JS2008 Neutralizing antibodies against the AJ1102 strain were generated after immunization of piglets with strain JS2008 strain and AJ1102 strain.

FIG. 8: PEDV rAJ1102-S2' _JS2008 Neutralizing antibodies against strain JS2008, which were generated after immunization of piglets by strain JS2008 and strain AJ 1102.

FIG. 9: schematic representation of different fragment substitutions or different point mutations of the PEDV AJ1102 strain S2 gene.

FIG. 10: indirect immunofluorescence is used for identifying virus schematic of different point mutations of the rescued PEDV AJ1102 strain S2 gene, and in the figure, Trypsin and No Trypsin are respectively shown under the pancreatin condition and the non-pancreatin condition.

Preservation information

Porcine epidemic diarrhea virus strain JS 2008:

preservation time: 23/2/2022;

the name of the depository: china center for type culture Collection;

the preservation number is: CCTCC NO: V202207;

the address of the depository: wuhan university in Wuhan, China;

and (3) classification and naming: porcine epidemic diarrhea virus PEDV JS 2008;

porcine epidemic diarrhea virus recombinant strain rAJ1102-S2' _JS2008 Strain:

preservation time: 23/2/2022;

the name of the depository: china center for type culture Collection;

the preservation number is: CCTCC NO: V202206;

the address of the depository: wuhan university in Wuhan, China;

and (3) classification and naming: porcine epidemic diarrhea virus recombinant strain PEDV rAJ1102-S2' _JS2008 。

Detailed Description

The present invention will be described in detail with reference to specific examples, but the present invention is not limited to the following examples, and the test methods not described in detail in the examples are all conventional in the art.

PEDV AJ1102 strain (GenBank accession No.: MK584552) was isolated, identified and preserved by virus division in the key laboratory of the national agricultural microbiology of university of agriculture in China (Jing Bi, Songlin Zeng, Shaobo Xiao, Huangchun Chen, Liurong Fang. complete genome sequence of clinical epidemic diarrheum virus strain AJ1102isolated from a suckling pig spleen with an acid diarrheum China. journal of virology.2012, 86: 10910-.

PEDV JS2008 strain is stored in the national focus laboratory of agricultural microbiology, university of Huazhong agriculture in virus laboratories.

pBAC-AJ1102 is infectious clone plasmid containing PEDV AJ1102 strain full-length cDNA, and PEDV can be rescued by transfecting Vero cells (see Peng Q, Fan L, Ding Z, Wang D, Peng G, and Xiao S.Rapid manipulation of the cyclic epidemic Diarrula genome by CRISPR/Cascade technology.J.Virol.methods.2020,276: 772.doi:10.1016/j.jviromet.2019.113772) according to the preparation method of pBAC-AJ1102, and is constructed and stored by the national emphasis laboratory of agricultural microbiology of Huazhong university.

Vero cells: purchased from the China Center for Type Culture Collection (CCTCC) at the university of Wuhan, China.

Chloramphenicol (cat # BS 049B): purchased from Biosharp.

DMEM medium (cat # 12100046), SuperScript IV Reverse Transcriptase Transcriptase (cat # 18090010), Platinum SuperFi Green PCR Master Mix (cat # 12359-010), T4 DNA Ligase (cat # 15224025), Lipofectamine 3000 (cat # L3000015): all purchased from Thermofisher Scientific, USA.

Fetal bovine serum (FBS, cat # P30-3302): purchased from PAN Biotech, germany.

Infusion Clone Kit (cat # 12462): purchased from precious bioengineering (Dalian) Co.

DH10B chemically competent cells (cat # CY80233 d): purchased from Shanghai super research Biotechnology, Inc.

Cas9 nucleic, S.Pyogenes (cat # M0386S), T7 RNA polymerase (cat # M0251S): all from NEB, uk.

The PEDV N protein monoclonal antibody is prepared and stored in a laboratory for viruses in the national key laboratory of agricultural microbiology of Huazhong university of agriculture (the N protein monoclonal antibody is prepared by constructing pET-30a-N recombinant plasmids by using complete N genes of AJ1102 strains and preparing the recombinant plasmids according to a conventional method of the monoclonal antibody).

FITC-labeled goat anti-mouse IgG (cat # A0568), nuclear dye DAPI (cat # C1005): purchased from Shanghai Bintitian Biotechnology, Inc.

100mM ATP solution (pH 7.5): 2.75g of anhydrous ATPNa are weighed out ₂ To 40mL ddH ₂ In O, pH was adjusted to 7.5 with 10M NaOH, ddH was added ₂ And (4) metering the volume of O to 50mL, subpackaging and storing at-20 ℃ for later use.

Preparing an LB culture medium: weighing 5g peptone, 2.5g yeast extract, 5g NaCl in 1L Erlenmeyer flask, adding ddH ₂ And O is added to 500mL, and the mixture is autoclaved at 121 ℃ for 20 min.

Example 1 recombinant Strain rAJ1102-S2 'of porcine epidemic diarrhea Virus' _JS2008 Construction of

(1) Preparation of transcription templates for PEDV AJ1102 strains sgRNA-S2'a and sgRNA-S2' b: two sgRNA primers sgRNA-F1 (shown in SEQ ID NO: 1) and sgRNA-F2 (shown in SEQ I) for targeting the S2' subunit of the S gene of PEDV AJ1102 strain are designedD NO: 2), performing overlap extension PCR by using a primer pair sgRNA-F1 and a scaffold oligo (shown in SEQ ID NO: 3), a primer pair sgRNA-F2 and a scaffold oligo respectively, wherein the amplification system comprises 25 mu L of Platinum SuperFi Green PCR Master Mix, 10 mu L of GC Enhancer, 20 mu M of each of the upstream primer and the downstream primer (final concentration), and ddH ₂ O to a total volume of 50. mu.L. The reaction conditions were as follows: 30s at 98 ℃; 10s at 98 ℃, 10s at 55 ℃ and 30s at 72 ℃; after 30 cycles, extension was carried out for 10min at 72 ℃. After the reaction is finished, the amplified product is subjected to 1% agarose Gel electrophoresis, and a target fragment is recovered by using Gel Extraction Kit according to the instruction, so that transcription templates of PEDV AJ1102 strain sgRNA-S2'a (shown in SEQ ID NO: 4) and sgRNA-S2' b (shown in SEQ ID NO: 5) are obtained.

(2) Preparation of PEDV AJ1102 strains sgRNA-S2'a and sgRNA-S2' b: carrying out in vitro transcription on the transcription template obtained in the step 1) by using a T7 in vitro transcription kit, wherein the transcription system and conditions are as follows: mu.L of 10 × Transcription buffer, NTPs with the final concentration of 2mM, 1. mu.g of Transcription template, 2. mu. L T7 RNA polymerase, RNase inhibitor with the final concentration of 1U/. mu.L, 1. mu.L of DTT, and supplemented with RNase-free water to 20. mu.L, and after mixing, the mixture is reacted at 37 ℃ for 16 h. After the reaction is finished, sgRNA-S2'a and sgRNA-S2' b are obtained and are directly used for subsequent experiments or stored at-80 ℃ for later use.

(3) Cleavage and recovery of pBAC-AJ 1102: the recombinant plasmid pBAC-AJ1102 was cleaved with Cas9 nuclease from NEB under the following conditions: 5 mu g of pBAC-AJ1102, 5 mu L of Cas9 nuclear, 10 mu g of sgRNA-S2'a, 10 mu g of sgRNA-S2' b and 5 mu L of 10 × reaction buffer, adding RNase-free water until the total volume is 50 mu L, mixing uniformly, and incubating for 2.5h at 37 ℃. The cleavage products were recovered with the Cycle Pure Kit as described in the specification. mu.L of the recovered product was subjected to 1% agarose gel electrophoresis to examine the cleavage effect, as shown in FIG. 2, and the result confirmed that pBAC-AJ1102 was successfully cleaved.

(4) Amplification of displaced template: PEDV AJ1102 strain cDNA was used as a template, and PEDV-S2 ' F (SEQ ID NO: 6) and PEDV-S2 ' were used as primer sets ' _JS2008 R (SEQ ID NO: 7) amplifying a PEDV S2' displacement template upstream fragment (SEQ ID NO: 12); PEDV JS2008 strain cDNA is used as a template, and a primer pair PEDV-S2 'is used' _JS2008 F (SEQ ID NO: 9) andPEDV-S2 'R (shown in SEQ ID NO: 8) amplified a fragment downstream of the PEDV S2' displacement template (shown in SEQ ID NO: 13). The PCR reaction system is as follows: 25 μ L Platinum SuperFi Green PCR Master Mix, 10 μ L GC Enhancer, 20 μ M each of the upstream and downstream primers (final concentration), 6 μ L cDNA, supplemented with ddH ₂ O to a total volume of 50. mu.L. The reaction conditions were as follows: 3min at 98 ℃; 30s at 98 ℃,30 s at 58 ℃ and 1min at 72 ℃; after 34 cycles, 10min at 72 ℃. After completion of PCR amplification, the amplification product was subjected to electrophoresis on a 1% agarose Gel, and recovered with Gel Extraction Kit from Omega according to the instructions.

Taking the recovered product as a template, and carrying out fusion PCR amplification by using primers PEDV-S2 'F and PEDV-S2' R, wherein the reaction system is as follows: 25 μ L Platinum SuperFi Green PCR Master Mix, 10 μ L GC Enhancer, 20 μ M each of upstream and downstream primers (final concentration), 2 μ L each of upstream and downstream fragments (above recovered product) of S2' substitution template, and ddH addition ₂ O to a total volume of 50. mu.L. The reaction conditions were as follows: 30min at 98 ℃; 3s at 98 ℃,30 s at 50 ℃ and 2min at 72 ℃; after 34 cycles, extension was carried out for 10min at 72 ℃. After the completion of PCR, the amplified product was electrophoresed on 1% agarose gel to obtain an amplified band of about 2.6kb in size, which is a displacement template, as shown in FIG. 3. After completion of the electrophoresis, the Gel Extraction Kit was used for recovery according to the instructions. The product was recovered and stored at-20 ℃ for future use.

(5) Homologous recombination ligation of the replacement template to linearized pBAC-AJ 1102: homologous recombination ligation of the linearized pBAC-AJ1102 recovered after cleavage in step (3) and the replacement template in step (4) was performed with the Infusion Clone Kit, and the reaction system was as follows: 4 μ L of pBAC-AJ1102, 4 μ L of displacement template, and 2 μ L of Infusion Clone enzyme, wherein the molar ratio of pBAC-AJ1102 to displacement template is 1:5, gently mixing, and reacting at 50 ℃ for 30 min.

(6) Conversion of ligation products: and (3) slowly adding 10 mu L of the ligation product obtained in the step (5) into 100 mu L of DH10B chemically competent cells, gently mixing uniformly, and standing in an ice water bath for 30 min. After heat shock at 42 ℃ for 90s, the mixture is immediately placed in an ice water bath for 2min, 600 mu L of LB culture medium is added, and recovery is carried out at 37 ℃ and 180rpm for 1 h. After completion of recovery, centrifugation was carried out at 5000rpm for 2min, 500. mu.L of LB medium was discarded, the remaining LB medium was used to suspend competent cells, the competent cells were spread on an LB solid plate containing 12.5. mu.g/mL of chloramphenicol, and after 10min, the plate was inverted and placed in a 37 ℃ incubator to continue culturing for 15 h.

(7) Screening of positive clones: 10 colonies were picked and cultured in a flask containing 1mL LB at 37 ℃ and 225rpm for 8 hours, and then identified by PCR amplification using primers PEDV S2 'DF (shown in SEQ ID NO: 10) and PEDV S2' DR (shown in SEQ ID NO: 11). The PCR conditions were as follows: 2.5 uL 10 XBuffer, 10 uM each of the upstream and downstream primers (final concentration), 1 uL dNTPs, 0.25 uL rTaq, 2.5 uL bacterial liquid, and ddH ₂ O to 25. mu.L. The amplification conditions were as follows: 2min at 95 ℃; 30s at 95 ℃,30 s at 53 ℃ and 2min at 72 ℃; after 34 cycles, extension was carried out for 5min at 72 ℃. After the reaction is finished, 4 mu L of amplification product is used for identifying positive clone by using 1% agarose gel electrophoresis, and PCR product identified as positive clone is sent to Wuhan engine biotechnology limited company for sequencing. Sequencing results show that the subunit S2 'of PEDV JS2008 strain has been successfully replaced to the C end (nt 2679-nt 4160) of the pBAC-AJ 1102S gene, and the positive clone plasmid is named pBAC-AJ1102-S2' _JS2008 The positive clone contains S2' _JS2008 The S gene sequence of the replacement fragment is shown as SEQ ID NO. 14. Porcine epidemic diarrhea virus infectious clone plasmid pBAC-AJ1102-S2' _JS2008 Is shown in figure 1.

(8)pBAC-AJ1102-S2′ _JS2008 The extraction: after the colony identified as positive in step (7) was subjected to scale-up culture, the Plasmid pBAC-AJ1102-S2 'was extracted in large quantities with the Plasmid DNA purification Kit according to the instructions' _JS2008 . The last step was performed with 100. mu.L ddH ₂ Eluting with O, and storing at-20 deg.C for use.

(9) Recombinant virus rAJ1102-S2' _JS2008 The rescue of (1): mu.g of recombinant plasmid pBAC-AJ1102-S2 'were ligated with Lipofectamine 3000 according to the instructions' _JS2008 Vero cells (2. mu.g/well) transfected to 80% fusion. After transfection for 6h, cells were washed 2 times with DMEM containing 2% fetal calf serum, 2mL of DMEM containing 2% fetal calf serum was added to each well, and when the cells were cultured continuously until more than 80% of cytopathic effects, the cell cultures were harvested, frozen and thawed 2 times at-70 deg.C, centrifuged at 2000rpm for 5min, and the supernatants were re-inoculated with Vero cells for subculture.

As shown in FIG. 4, pBAC-AJ1102-S2' _JS2008 48h after Vero cell transfection, the cells appeared clearly diseased, mainly manifested as cell lysis, consistent with the cell pathological changes caused by PEDV JS2008 strain, but different from the cell pathological changes caused by PEDV AJ1102 strain (mainly manifested as cell outline disappearance and cell fusion), indicating that the recombinant virus was successfully rescued, and the cells were named as PEDV rAJ1102-S2' _JS2008 And (4) strain.

(10) Recombinant virus rAJ1102-S2' _JS2008 The identification of (2): with PEDV rAJ1102-S2' _JS2008 The genome of the strain was used as a template, RT-PCR amplification was performed with the primer PEDV S2' DF/R, and the amplification product was sequenced, resulting in PEDV rAJ1102-S2' compared to the parental strain PEDV AJ1102 ' _JS2008 The strain S gene nt 2679-nt 4160 is replaced by the corresponding sequence of the strain JS2008, and the S gene sequence containing the strain S2' replacing JS2008 is shown as SEQ ID NO.14, which indicates that the recombinant virus is constructed correctly.

Furthermore, a monoclonal antibody against PEDV AJ1102 strain and rAJ1102-S2 'with PEDV N protein as primary antibody' _JS2008 The strains were subjected to indirect Immunofluorescence (IFA) detection, and the results are shown in FIG. 5, in which PEDV AJ1102 strains and rAJ1102-S2 'were obtained under an inverted fluorescent microscope' _JS2008 Specific green fluorescence appeared in the cells infected by the strain, while no fluorescence appeared in the control non-inoculated cells, indicating that the rescued virus was PEDV.

(11) Recombinant virus rAJ1102-S2' _JS2008 Proliferative properties in cell culture:

PEDV rAJ1102-S2′ _JS2008 detection of pancreatin dependence of the strain: detection of PEDV rAJ1102-S2 'with and without pancreatin addition' _JS2008 Plaques and growth curves of the strains, JS2008 strain and AJ1102 strain on Vero cells, and it was found that PEDV rAJ1102-S2' _JS2008 The Vero cells inoculated by the strain JS2008 strain do not form the plaques regardless of the addition of pancreatin, while the PEDV AJ1102 strain does not form the plaques if the pancreatin is not added when the Vero cells are cultured, and the plaques can be formed by adding the pancreatin.

As shown in FIG. 6, rAJ1102-S2 'when pancreatin is added' _JS2008 The growth curves of the strain JS2008 and AJ1102 on Vero cells were the same, and when no pancreatin was added, rAJ1102-S2' _JS2008 The strain had a consistent growth tendency with strain JS2008, however, rAJ1102-S2' _JS2008 The proliferation titer in the absence of trypsin was significantly higher than that in the presence of trypsin for strain JS2008, while that in the presence of trypsin was significantly higher for strain AJ1102 than that in the absence of trypsin. Illustrating PEDV rAJ1102-S2' _JS2008 The proliferation characteristics of the strain on Vero cells are different from that of the AJ1102 strain, while proliferation on Vero cells is independent of the presence of pancreatin, consistent with the classical strain JS 2008.

Stability testing of passage in cells: PEDV rAJ1102-S2' _JS2008 The strain can stably cause typical cytopathic effect when continuously transmitted to 20 generations on Vero cells, and the virus titer after P15 generation is not lower than 10 ^7.5 TCID ₅₀ and/mL. RT-PCR amplification and sequencing of the S2 'fragments of the P5, P10, P15, P20 and P30 viruses with the primer PEDV S2' DF/R, respectively, all agreed with the sequence of the S2 'fragment of JS2008, indicating that PEDV rAJ1102-S2' _JS2008 The strain can be stably passaged on cells.

Example 2: PEDV rAJ1102-S2' _JS2008 Immunogenicity of strains

PEDV rAJ1102-S2' _JS2008 Strain JS2008 strain and AJ1102 strain (virus content is adjusted to 10) ^6.5 TCID ₅₀ and/mL) is inactivated by 0.2 percent of formaldehyde for 48 hours respectively, Vero cells are inoculated for inactivation test after inactivation is finished, and virus liquid qualified by test is added with 201 adjuvant with equal mass for emulsification. And inoculating the emulsified virus solution to PEDV antigen antibody negative healthy piglets with age of 28 days through neck muscles, wherein each group has 5 heads and 2 mL/head, and boosting the immunization once by the same dose 14 days after the immunization, and setting 5 heads of control piglets. Blood was collected 14 days, 31 days, and 45 days after the initial immunization, and then neutralizing antibodies were detected using PEDV AJ1102 strain and JS2008 strain, respectively.

The results are shown in FIGS. 7 and 8: PEDV rAJ1102-S2' _JS2008 The level of neutralizing antibodies of the strain inactivated vaccine is equivalent to that of neutralizing antibodies of the AJ1102 strain induced by the AJ1102 strain inactivated vaccine, and the level of neutralizing antibodies of the JS2008 strain induced by the AJ1102 strain is obviously lower than that of the AJ1102 strain and rAJ1102-S2' _JS2008 ；rAJ1102-S2′ _JS2008 Strain, AJ1102 strain and strain JS2008 induced aiming at strain JS2008Has a significant difference in neutralizing antibody levels against JS2008 strain induced the highest neutralizing antibody level against JS2008 strain, followed by rAJ1102-S2' _JS2008 Strain AJ1102 induced the lowest level of neutralizing antibodies against JS2008 strain. Note rAJ1102-S2' _JS2008 The strain can induce immune pigs to generate high-level neutralizing antibodies aiming at the AJ1102 strain, and can also induce higher neutralizing antibodies aiming at the JS2008 strain.

Example 3: comparison of the results of substitution or different point mutation of different fragments of the PEDV AJ1102 strain S2 gene

According to the experimental method in example 1, AJ1102

strain S2 subunit

894 and 976 amino acid single-point mutation strain, 894 and 976 amino acid double-point mutation strain, AJ1102 strain S2' -HR1 region replaced by JS2008 strain recombinant strain and AJ1102 strain HR1 replaced by JS2008 strain recombinant strain (shown in fig. 9) were also constructed, the experimental procedure was as in example 1, and the primer sequences for fusion PCR amplification are shown in the following table.

Primer name	Primer sequence (5 '→ 3')
		Mid-S _R894G -F	AGTGGCAGGGTGGTACAAAAAGGGTCTTTTATTGAAGACCTGC
Mid-S _R894G -R	GCAGGTCTTCAATAAAAGA CCC TTTTTGTACCACCCTGCCACT
		Mid-S _Y976H -F	GCGGCATTGCCTTTTAGCGATGCTGTTCAAGCGAGACTGAATTATC
Mid-S _Y976H -R	CAGTCTCGCTTGAACAGC ATC GCTAAAAGGCAATGCCGCTG

The three S2 subunit point mutation strains constructed above can be successfully rescued, and a monoclonal antibody of PEDV N protein is adopted as a primary antibody to the recombinant strain rAJ1102-S _R894G 、rAJ1102-S _H976Y And rAJ1102-S _R894G/H976Y Performing indirect Immunofluorescence (IFA) detection respectively; the results are shown in FIG. 10, in the presence of pancreatin, under an inverted fluorescence microscope PEDV AJ1102-S _R894G 、rAJ1102-S _H976Y And rAJ1102-S _R894G/H976Y The cells infected by the strain all show specific green fluorescence. rAJ1102-S in the absence of trypsin _R894G/H976Y Strains have little fluorescence, and rAJ1102-S _R894G And rAJ1102-S _H976Y Basically has no fluorescence, and shows that the obtained three point mutation strains are pancreatic enzyme dependent strains.

In addition, the recombinant virus could not be successfully obtained by replacing the region of the AJ1102 strain S2' -HR1 with the recombinant strain JS2008 and replacing the region of the AJ1102 strain HR1 with the recombinant strain JS2008 through three times of repeated transfection and rescue.

The above-described embodiments are merely preferred embodiments of the present invention, and not intended to limit the scope of the invention, so that equivalent changes or modifications in the structure, features and principles described in the present invention should be included in the claims of the present invention.

SEQUENCE LISTING

<110> university of agriculture in Huazhong

<120> porcine epidemic diarrhea virus variant strain independent of pancreatin and construction and application thereof

<130> do not

<160> 14

<170> PatentIn version 3.3

<210> 1

<211> 55

<212> DNA

<213> Artificial sequence

<400> 1

ttctaatacg actcactata gcatctgaca ctactatcaa tgttttagag ctaga 55

<210> 2

<211> 56

<212> DNA

<213> Artificial sequence

<400> 2

ttctaatacg actcactata ggccacgtgc agtgatgttt ctgttttaga gctaga 56

<210> 3

<211> 80

<212> DNA

<213> Artificial sequence

<400> 3

aaaagcaccg actcggtgcc actttttcaa gttgataacg gactagcctt attttaactt 60

gctatttcta gctctaaaac 80

<210> 4

<211> 121

<212> DNA

<213> Artificial sequence

<400> 4

ttctaatacg actcactata gcatctgaca ctactatcaa tgttttagag ctagaaatag 60

caagttaaaa taaggctagt ccgttatcaa cttgaaaaag tggcaccgag tcggtgcttt 120

t 121

<210> 5

<211> 122

<212> DNA

<213> Artificial sequence

<400> 5

ttctaatacg actcactata ggccacgtgc agtgatgttt ctgttttaga gctagaaata 60

gcaagttaaa ataaggctag tccgttatca acttgaaaaa gtggcaccga gtcggtgctt 120

tt 122

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence

<400> 6

catctgacac tactatcaat 20

<210> 7

<211> 43

<212> DNA

<213> Artificial sequence

<400> 7

gcaggtcttc aataaaagac cctttttgta ccaccctgcc act 43

<210> 8

<211> 21

<212> DNA

<213> Artificial sequence

<400> 8

cgtgtattga aaaagtccaa g 21

<210> 9

<211> 43

<212> DNA

<213> Artificial sequence

<400> 9

agtggcaggg tggtacaaaa agggtctttt attgaagacc tgc 43

<210> 10

<211> 18

<212> DNA

<213> Artificial sequence

<400> 10

ctcaggttgc ttttgacc 18

<210> 11

<211> 21

<212> DNA

<213> Artificial sequence

<400> 11

ctagaatcac aatggatttg c 21

<210> 12

<211> 1110

<212> DNA

<213> porcine epidemic diarrhea virus

<400> 12

catctgacac tactatcaat gggtttagtt ctttctgtgt tgacactaga caatttacca 60

tttcactgtt ttataacgtt acaaacagtt atggttacgt gtctaaatca caggacagta 120

attgcccttt taccttgcaa tctgttaatg attatctgtc ttttagcaaa ttttgtgttt 180

ctaccagcct tttggctagt gcctgtacca tagatctttt tggttaccct gagtttggta 240

gtggtgttaa gttcacgtcc ctttactttc aattcacaaa gggtgagttg attactggca 300

cgcctaaacc acttgaaggt gttacggacg tttcttttat gactctggat gtgtgtacca 360

agtatactat ctatggcttt aaaggtgagg gtatcattac ccttacaaat tctagctttt 420

tggcaggtgt ttattataca tctgattctg gacagttgtt agcttttaag aatgtcacta 480

gtggtgctgt ttattctgtt acgccatgtt ctttttcaga gcaggctgca tatgttgatg 540

atgatatagt gggtgttatt tctagtttgt ctagctccac ttttaacagt actagggagt 600

tgcctggttt cttctaccat tctaatgatg gctctaattg tacagagcct gtgttggtgt 660

atagtaacat aggtgtttgt aaatctggca gtattggcta tgtccgatct cagtctggcc 720

aagtcaagat tgcacccacg gttactggga atattagtat tcccaccaac tttagtatga 780

gtattaggac agaatattta cagctttaca acacgcctgt tattgttgat tgtgctacat 840

atgtttgtaa tggtaactct cgttgtaaac aattactcac ccagtacact gcagcatgta 900

agaccataga gtcagcatta caactcagcg ctaggcttga gtctgctgaa gtcaactcta 960

tgcttactat ttctgaagag gctctacagt tagctaccat cagttcgttt aatggtgatg 1020

gatataattt tactaatgtg ctgggtgttt ccgtgtatga ccctgcaagt ggcagggtgg 1080

tacaaaaagg gtcttttatt gaagacctgc 1110

<210> 13

<211> 1529

<212> DNA

<213> porcine epidemic diarrhea virus

<400> 13

agtggcaggg tggtacaaaa agggtctttt attgaagacc tgctttttaa taaagtggtt 60

actaatggcc ttggtactgt tgatgaagac tataagcgct gttctaatgg tcgctctgtg 120

gcagatctag tctgtgcgca gtattactct ggtgtcatgg tactacctgg cgttgttgac 180

gctgagaagc ttcacatgta tagtgcgtct ctcatcggtg gtatggcgct aggaggtctt 240

actactgcag cggcattgcc ttttagccat gctgttcaag cgaggctcaa ttatcttgct 300

ttacagacgg atgttctaca gcgcaaccag caattgcttg ctgagtcttt taactctgct 360

attggtaata taacttcagc ctttgagagt gttaaagagg ctattagtca aacttccaat 420

ggtttgaaca ctgtggctca tgcgcttact aaggttcaag aggttgttaa ttcgcagggt 480

tcagctttga cccaacttac catacagctg caacacaact tccaagccat ttctagttct 540

attgatgaca tttactcccg actggacatt ctttcagccg atgttcaggt tgatcgtctc 600

atcaccggca gattatcagc acttaatgct tttgttgctc aaaccctcac taagtatact 660

gaggttcagg ctagcaggaa gctagcacag caaaaggtta atgagtgcgt caaatcgcaa 720

tctcagcgtt atggtttttg tggtggtgat ggcgagcaca tcttctctct ggtacaggcc 780

gcacctcagg gcctgctgtt cttacataca gtacttgtac cgggtgattt tgtaaatgtt 840

attgccatcg atggcttatg cgttaatggt gatattgcct tgactctacg tgagcctggc 900

ttagtcttgt ttacgcatga acttcaaaat catactgcga cggaatattt tgtttcatcg 960

cgacgtatgt ttgaacctag aaaacctacc gttagtgatt ttgttcaaat tgagaggtgt 1020

gtggtcacct atgtcaatct gactagcgac caactaccag atgtaatccc agattacatc 1080

gatgttaaca aaacacttga tgagattcta gcttctctgc ccaatagaat tggtcctagt 1140

cttcccctag atgtttttaa tgccacttat cttaatctca ctggtgaaat tgcagattta 1200

gagcagcgtt cagagtctct ccgtaatact acagaagagc tccgaagtct catatataat 1260

atcaacaaca cacttgttga ccttgagtgg ctcaaccgag ttgagacata tatcaagtgg 1320

ccgtggtggg tttggttgat tatttttatt gttctcatct ttgttgtgtc attattagtg 1380

ttctgctgca tttccacggg ttgttgtgga tgctgcggtt gttgcggtgc ttgtttttca 1440

ggttgttgta ggggtcctag acttcaacct tacgaagctt ttgaaaaggt ccacgtgcag 1500

tgatgtttct tggacttttt caatacacg 1529

<210> 14

<211> 4160

<212> DNA

<213> Artificial sequence

<220>

<221> sequence S2' of strain JS2008

<222> (2680)..(4160)

<400> 14

atgaagtctt taacctactt ctggttgttc ttaccagtac tttcaacact tagcctacca 60

caagatgtca ccaggtgctc agctaacact aattttaggc ggttcttttc aaaatttaat 120

gttcaggcgc ctgcagttgt tgtactgggc ggttatctac ctattggtga aaaccagggt 180

gtcaattcaa cttggtactg tgctggccaa catccaactg ctagtggcgt tcatggtatc 240

tttcttagcc atattagagg tggtcatggc tttgagattg gcatttcgca agagcctttt 300

gaccctagtg gttaccagct ttatttacat aaggctacta acggtaacac taatgctact 360

gcgcgactgc gcatttgcca gtttcccagc attaaaacat tgggccccac tgctaataat 420

gatgttacaa caggtcgtaa ctgcctattt aacaaagcca tcccagctca tatgagtgaa 480

catagtgttg tcggcataac atgggataat gatcgtgtca ctgtcttttc tgacaagatc 540

tattattttt attttaaaaa tgattggtcc cgtgttgcga caaagtgtta caacagtgga 600

ggttgtgcta tgcaatatgt ttacgaaccc acttactaca ttcttaatgt tactagtgct 660

ggtgaggatg gtatttctta tcaaccctgt acagctaatt gcattggtta tgctgccaat 720

gtatttgcta ctgagcccaa tggccacata ccagaaggtt ttagttttaa taattggttt 780

cttttgtcca atgattccac tttggtgcat ggtaaggtgg tttccaacca accattgttg 840

gtcaattgtc ttttggccat tcctaagatt tatggactag gccaattttt ctcctttaat 900

caaacgatcg atggtgtttg taatggagct gctgtgcagc gtgcaccaga ggctctgagg 960

tttaatatta atgacacctc tgtcattctt gctgaaggct caattgtact tcatactgct 1020

ttaggaacaa atttttcttt tgtttgcagt aattcctcag aacctcactt agccaccttt 1080

gccatacctc tgggtgctat ccaagtaccc tattattgtt ttcttaaagt ggatacttac 1140

aactccactg tttataaatt cttggctgtt ttacctccta ccgtcaggga aattgtcatc 1200

accaagtatg gtgatgttta tgtcaatggg tttggctact tgcatctcgg tttgttggat 1260

gctgtcacaa ttaatttcac tggtcatggc actgacgatg acgtttctgg tttttggacc 1320

atagcatcga ctaattttgt tgatgcactt atcgaagttc aaggaactgc cattcagcgt 1380

attctttatt gtgatgatcc tgttagccaa ctcaagtgtt ctcaggttgc ttttgacctt 1440

gacgatggtt tttaccgtat ttcctctaca aaccttctga gtcatgaaca gccaacttct 1500

tttgttactt tgccatcatt taatgatcat tcttttgtta atattactgt ctctgctgct 1560

tttggtggtc atagtggtgc caaccttatt gcatctgaca ctactatcaa tgggtttagt 1620

tctttctgtg ttgacactag acaatttacc atttcactgt tttataacgt tacaaacagt 1680

tatggttacg tgtctaaatc acaggacagt aattgccctt ttaccttgca atctgttaat 1740

gattatctgt cttttagcaa attttgtgtt tctaccagcc ttttggctag tgcctgtacc 1800

atagatcttt ttggttaccc tgagtttggt agtggtgtta agttcacgtc cctttacttt 1860

caattcacaa agggtgagtt gattactggc acgcctaaac cacttgaagg tgttacggac 1920

gtttctttta tgactctgga tgtgtgtacc aagtatacta tctatggctt taaaggtgag 1980

ggtatcatta cccttacaaa ttctagcttt ttggcaggtg tttattatac atctgattct 2040

ggacagttgt tagcttttaa gaatgtcact agtggtgctg tttattctgt tacgccatgt 2100

tctttttcag agcaggctgc atatgttgat gatgatatag tgggtgttat ttctagtttg 2160

tctagctcca cttttaacag tactagggag ttgcctggtt tcttctacca ttctaatgat 2220

ggctctaatt gtacagagcc tgtgttggtg tatagtaaca taggtgtttg taaatctggc 2280

agtattggct atgtccgatc tcagtctggc caagtcaaga ttgcacccac ggttactggg 2340

aatattagta ttcccaccaa ctttagtatg agtattagga cagaatattt acagctttac 2400

aacacgcctg ttattgttga ttgtgctaca tatgtttgta atggtaactc tcgttgtaaa 2460

caattactca cccagtacac tgcagcatgt aagaccatag agtcagcatt acaactcagc 2520

gctaggcttg agtctgctga agtcaactct atgcttacta tttctgaaga ggctctacag 2580

ttagctacca tcagttcgtt taatggtgat ggatataatt ttactaatgt gctgggtgtt 2640

tccgtgtatg accctgcaag tggcagggtg gtacaaaaag ggtcttttat tgaagacctg 2700

ctttttaata aagtggttac taatggcctt ggtactgttg atgaagacta taagcgctgt 2760

tctaatggtc gctctgtggc agatctagtc tgtgcgcagt attactctgg tgtcatggta 2820

ctacctggcg ttgttgacgc tgagaagctt cacatgtata gtgcgtctct catcggtggt 2880

atggcgctag gaggtcttac tactgcagcg gcattgcctt ttagccatgc tgttcaagcg 2940

aggctcaatt atcttgcttt acagacggat gttctacagc gcaaccagca attgcttgct 3000

gagtctttta actctgctat tggtaatata acttcagcct ttgagagtgt taaagaggct 3060

attagtcaaa cttccaatgg tttgaacact gtggctcatg cgcttactaa ggttcaagag 3120

gttgttaatt cgcagggttc agctttgacc caacttacca tacagctgca acacaacttc 3180

caagccattt ctagttctat tgatgacatt tactcccgac tggacattct ttcagccgat 3240

gttcaggttg atcgtctcat caccggcaga ttatcagcac ttaatgcttt tgttgctcaa 3300

accctcacta agtatactga ggttcaggct agcaggaagc tagcacagca aaaggttaat 3360

gagtgcgtca aatcgcaatc tcagcgttat ggtttttgtg gtggtgatgg cgagcacatc 3420

ttctctctgg tacaggccgc acctcagggc ctgctgttct tacatacagt acttgtaccg 3480

ggtgattttg taaatgttat tgccatcgat ggcttatgcg ttaatggtga tattgccttg 3540

actctacgtg agcctggctt agtcttgttt acgcatgaac ttcaaaatca tactgcgacg 3600

gaatattttg tttcatcgcg acgtatgttt gaacctagaa aacctaccgt tagtgatttt 3660

gttcaaattg agaggtgtgt ggtcacctat gtcaatctga ctagcgacca actaccagat 3720

gtaatcccag attacatcga tgttaacaaa acacttgatg agattctagc ttctctgccc 3780

aatagaattg gtcctagtct tcccctagat gtttttaatg ccacttatct taatctcact 3840

ggtgaaattg cagatttaga gcagcgttca gagtctctcc gtaatactac agaagagctc 3900

cgaagtctca tatataatat caacaacaca cttgttgacc ttgagtggct caaccgagtt 3960

gagacatata tcaagtggcc gtggtgggtt tggttgatta tttttattgt tctcatcttt 4020

gttgtgtcat tattagtgtt ctgctgcatt tccacgggtt gttgtggatg ctgcggttgt 4080

tgcggtgctt gtttttcagg ttgttgtagg ggtcctagac ttcaacctta cgaagctttt 4140

gaaaaggtcc acgtgcagtg 4160

Claims

1. A porcine epidemic diarrhea virus variant strain independent of pancreatin, characterized in that the protection of the porcine epidemic diarrhea virus variant strainV202206 with the Tibetan number of CCTCC NO, and is classified and named as porcine epidemic diarrhea virus recombinant strain PEDV rAJ1102-S2' _JS2008 。

2. A method of constructing a variant strain of porcine epidemic diarrhea virus independent of pancreatin according to claim 1, comprising:

(1) designing two sgRNA primers which target the upstream and downstream of S gene S2' subunit of PEDV AJ1102 strain, wherein the sequences of the upstream and downstream sgRNA primers are shown as SEQ ID NO.1 and SEQ ID NO. 2, the sgRNA primers and a scaffold oligo with the sequence of the primer shown as SEQ ID NO. 3 are respectively subjected to overlap extension PCR amplification to obtain a sgRNA-S2' a with the sequence shown as SEQ ID NO. 4 and a transcription template of sgRNA-S2' b with the sequence shown as SEQ ID NO. 5, and in vitro transcription is carried out to obtain sgRNA-S2' a and sgRNA-S2' b;

(2) cutting BAC plasmid pBAC-AJ1102 containing PEDV AJ1102 strain full-length cDNA by using a CRISPR/Cas9 system, and recovering by using a kit to obtain a linearized recombinant BAC plasmid;

(3) PEDV-S2 ' F and PEDV-S2 ' with PEDV AJ1102 strain cDNA as a template and primer sequences shown as SEQ ID NO. 6 and SEQ ID NO. 7 respectively ' _JS2008 -R amplifying a fragment upstream of the template replaced by PEDV S2' having the sequence shown in SEQ ID NO. 12; PEDV-S2 ' R and PEDV-S2 ' with PEDV JS2008 strain cDNA as template and primer sequences shown in SEQ ID NO 8 and SEQ ID NO 9 respectively ' _JS2008 F amplifying a fragment downstream of the substitution template of PEDV S2' with the sequence shown in SEQ ID NO. 13; after the PCR amplification is finished, the recovered product is used as a template, fusion PCR amplification is carried out by using primers PEDV-S2 ' F and PEDV-S2 ' R, a fusion fragment sequence of replacing PEDV AJ1102 strain S2' subunit with JS2008 strain S2' subunit is obtained through the fusion PCR amplification, and the fusion fragment sequence and the linearized recombinant BAC plasmid respectively comprise 20bp homologous arms at the upstream and downstream and contain S2' _JS2008 The S gene sequence of the replacement segment is shown as SEQ ID NO. 14;

(4) homologous recombination is carried out on the linearized recombinant BAC plasmid in the step (2) and the fusion fragment in the step (3), and an infectious clone plasmid pBAC-AJ1102-S2 'with the subunit sequence of the AJ 1102S gene S2' replaced by the subunit sequence of the JS 2008S gene S2 'is obtained' _JS2008 ；

(5) Mixing pBAC-AJ1102-S2' _JS2008 Transforming competent cells, screening positive clones by PCR and sequencing, and extracting plasmids after carrying out amplification culture on the positive clones with correct sequencing;

(6) mixing pBAC-AJ1102-S2' _JS2008 The positive clone transfects Vero cells, and the porcine epidemic diarrhea virus recombinant strain PEDV rAJ1102-S2 'is obtained through rescue' _JS2008 。

3. Use of a porcine epidemic diarrhea virus variant strain independent of pancreatin as defined in claim 1 for the preparation of a porcine epidemic diarrhea vaccine.

4. The use according to claim 3, wherein the porcine epidemic diarrhea vaccine is an inactivated vaccine.