CN107881157B

CN107881157B - Double-gene knockout strain of oncocyte virus vSOCS/vTK as well as preparation method and application thereof

Info

Publication number: CN107881157B
Application number: CN201711355686.6A
Authority: CN
Inventors: 何建国; 郭长军; 翁少萍; 林易凡
Original assignee: Sun Yat Sen University
Current assignee: Sun Yat Sen University
Priority date: 2017-12-16
Filing date: 2017-12-16
Publication date: 2021-07-30
Anticipated expiration: 2037-12-16
Also published as: CN107881157A

Abstract

The invention provides a swollen cell virus vSOCS/vTK double-gene deletion strain, a preparation method and application thereof, and relates to an attenuated virus strain prepared by a swollen cell virus strain deletion vSOCS gene and vTK gene. The invention also provides a tumor cell virus vSOCS/vTK double-gene deletion strain with a selection marker, and a preparation method and application thereof, wherein the tumor cell virus vSOCS gene and vTK gene are deleted for the tumor cell virus, and a first selection marker gene and a second selection marker gene are respectively inserted into the gene deletion part through homologous recombination to prepare an attenuated virus strain. The oncocyte virus vSOCS/vTK double-gene deletion strain provided by the invention is a recombinant genetic engineering vaccine with vSOCS and vTK pathogenic genes knocked out, has weak toxicity, cannot cause death of immunized fishes, can achieve a remarkable immune effect by adopting soaking immunization, does not need injection, and has great application value.

Description

Double-gene knockout strain of oncocyte virus vSOCS/vTK as well as preparation method and application thereof

Technical Field

The invention relates to the field of aquaculture disease prevention and control, in particular to a swollen cell virus vSOCS/vTK double-gene knockout strain and a preparation method and application thereof.

Background

The mandarin fish is one of four fresh water famous fishes in China, and is a famous, precious and high-quality economic fish with high economic value. The mandarin fish is popular in the market, and the more and more prominent disease problem becomes a bottleneck for restricting the development of the mandarin fish aquaculture industry while the development prospect of the mandarin fish aquaculture industry is good, so that the enthusiasm of farmers is seriously influenced. A typical example is the fulminant mandarin fish iridovirus cytoplasmosis virus disease in 1994 in my province, which causes the death of cultured mandarin fish in large quantities within a week. At present, the disease still seriously threatens the development of the mandarin fish aquaculture industry.

The iridovirus of the cytomegas is a main pathogen of the fulminant epidemic disease of the cultured mandarin fish and is one of the viral pathogens with the widest epidemic and the strongest pathogenicity in the cultured fish, and huge economic loss is caused to the aquaculture industry every year. Iridovirus (Iridovirus) is a large icosahedral double-stranded DNA virus belonging to Iridoviridae (Iridovirus), and can infect aquatic invertebrates and cold vertebrates, including fishes (such as rare economically cultured fishes like grouper, mandarin fish, turbot, etc.), amphibians (such as frogs and salamanders, etc.) and reptiles (such as turtles, Chinese soft-shelled turtles, snakes, etc.), and fishes capable of being infected with Iridovirus of the cytomegaviruses include mandarin fish (Siniperca chuatsi), genuine sea bream (Pagrus major), turbot (Scophthalmus maximus), catfish (Epinhulus spp.), weever (Lateolabrax sp.), etc.

At present, the intumescence cell Virus belongs to Infectious Spleen and Kidney Necrosis Virus (ISKNV) separated from mandarin fish, and the ISKNV can infect more than 70 kinds of wild and cultivated light and seawater fishes in China, so that hematopoietic tissues of the fishes are infected, the infected fishes have anemia symptoms, gill bleeding swelling is caused, Spleen hypertrophy and color fading are caused, black spots are formed on fins and the body surface, the death rate of the acutely infected mandarin fish is up to 100 percent, and the iridovirus cell intumescence Virus disease generated by the aquaculture fishes causes huge threats to the fish aquaculture industry and is also one of important restriction factors for the transformation and development of the aquaculture fishes.

Many documents now report that the gene-deleted attenuated live vaccine can effectively and safely play a protective role, such as TK gene-deleted vaccines of infectious bovine tracheitis virus and pseudorabies virus, nef gene-deleted vaccines of simian and human immunodeficiency virus, px gene-deleted vaccines of bovine leukemia virus, and the like. The successful double-gene deletion vaccine is constructed, namely 2 genes related to virulence are deleted, such vaccine strains are safer, and for example, the rabies virus generates TK deletion, and then gE/gI gene deletion strains, so that the obtained double-gene deletion vaccine is obtained.

The research team of the applicant establishes the ISKNV cell inactivated vaccine based on the mandarin fish cell line, the protection rate of the ISKNV cell inactivated vaccine to the immune mandarin fish in a laboratory can be stabilized to be more than 90 percent, and related achievements have already applied for national invention patent (application number: 200910038692.8). However, the inactivated vaccine has the disadvantages of short immune period, large dosage, requirement of adjuvant, lack of immune protection of natural infection, large consumption of manpower and material resources, injection of the vaccine to each fish and the like, and is not easy to be popularized and applied in aquaculture in a large scale. In the case of iridovirus, Pallister et al constructed a deletion strain of the eukaryotic transcription initiation factor (eIF2 α) of Rana ornata iridovirus (BIV), indicating that iridovirus is capable of undergoing viral recombination and is technically feasible. Previous research work by the applicant shows that vSOCS and vTK are important pathogenic non-essential genes of the cytomegavirus. The gene containing GFP is substituted for vSOCS gene in ISKNV genome by means of gene engineering principle to create recombinant vSOCS gene deletion virus (ISKNV delta vSOCS). Through a mandarin fish living experiment, the result shows that ISKNV delta vSOCS still has 20% of lethality rate on the mandarin fish, and the immunoprotection rate of the mandarin fish without death on wild virus ISKNV is 100%.

Therefore, there is a need for a tumor cell virus vaccine with good immune effect, convenient use, strong applicability and no need of injection, and a preparation method and application thereof.

Disclosure of Invention

In order to solve the problems, the invention provides the swollen cell virus vaccine which has good immune effect, convenient use and strong applicability and does not need injection, and the preparation method and the application thereof. vTK gene is knocked out on the basis of ISKNV DeltavSOCS, and a vSOCS and vTK double-gene deletion virus (ISKNV DeltavSOCS Delta vTK) is constructed. Compared with an injection immunization mode of an inactivated vaccine, the soaking immunization is the greatest advantage of the gene-deleted vaccine, is a great innovation of the immunization mode of the fish virus vaccine, and has wide application space.

The invention provides a tumor cell virus vSOCS/vTK double-gene deletion strain, which is an attenuated virus strain prepared by deleting vSOCS gene and vTK gene from a tumor cell virus strain.

Preferably, the vSOCS gene sequence is identical to SEQ ID NO: 1, having at least 90%, at least 95%, at least 98%, at least 99% or 100% homology.

Preferably, the vTK gene sequence is identical to SEQ ID NO: 2, or a nucleotide sequence having at least 90%, at least 95%, at least 98%, at least 99% or 100% homology thereto.

In a second aspect, the invention provides a tumor cell virus vSOCS/vTK double-gene deletion strain with a selection marker, which is an attenuated virus strain prepared by deleting vSOCS gene and vTK gene from tumor cell virus and inserting a first selection marker gene and a second selection marker gene into the gene deletion positions through homologous recombination.

Preferably, the vSOCS gene sequence is a nucleotide sequence having at least 90%, at least 95%, at least 98%, at least 99% or 100% homology to the sequence shown in SEQ ID No. 1.

Preferably, the vTK gene sequence is a nucleotide sequence having at least 90%, at least 95%, at least 98%, at least 99% or 100% homology with the sequence shown in SEQ ID NO. 2.

Preferably, the first selection marker gene and the second selection marker gene are different and are respectively and independently selected from the group consisting of an inserted green fluorescent protein gene and a inserted red fluorescent protein gene.

Further preferably, the red fluorescent protein gene is DsRed2 protein gene.

In a third aspect, the invention provides a method for constructing a oncocyte virus vSOCS/vTK double-gene deletion strain, which comprises the following steps: isolating and identifying a swollen cell virus strain; then any step of the step 1) or the step 2) is carried out:

1) deleting vSOCS genes and vTK genes of the swollen cell virus strain by a homologous recombination method to obtain a swollen cell virus vSOCS/vTK double-gene deleted strain;

2) the vTK gene and the vSOCS gene of the swollen cell virus strain are deleted in sequence by a homologous recombination method to obtain a swollen cell virus vSOCS/vTK double-gene deletion strain.

In a fourth aspect, the invention provides a method for constructing a tumor cell virus vSOCS/vTK double-gene deletion strain with a selection marker, which comprises the following steps: isolating and identifying a swollen cell virus strain; then any step of the step 1) or the step 2) is carried out:

1) deleting vSOCS genes and vTK genes of the swollen cell virus strain by a homologous recombination method, and respectively inserting a first screening marker gene and a second screening marker gene into the gene deletion positions to obtain a swollen cell virus vSOCS/vTK double-gene deletion strain;

2) the vTK gene and the vSOCS gene of the swollen cell virus strain are deleted in sequence by a homologous recombination method, and a first screening marker gene and a second screening marker gene are inserted into the gene deletion positions respectively to obtain a swollen cell virus vSOCS/vTK double-gene deletion strain.

Further preferably, the red fluorescent protein gene is DsRed2 protein gene.

Preferably, the step 1) specifically comprises:

a) transformation of screening genes

Cloning a first screening marker gene to a multiple cloning site of a Puc19 vector to obtain a first Puc19 recombinant vector;

cloning the second screening marker gene to the multiple cloning site of the Puc18 vector to obtain a first Puc18 recombinant vector;

b) construction of transfer vectors

b-1) construction of recombinant vTK Gene-deleted Virus transfer vector: using ISKNV strain genome DNA as a template, and obtaining an upper arm gene of vTK and a lower arm gene of vTK by PCR; cloning the obtained vTK upper arm gene and vTK lower arm gene into the first Puc19 recombinant vector prepared in the step a) to obtain a second Puc19 recombinant vector, wherein in the obtained second Puc19 recombinant vector, the first screening marker gene is positioned between vTK upper arm gene and vTK lower arm gene;

b-2) construction of recombinant vSOCS Gene-deleted Virus transfer vector: obtaining an upper arm gene of vSOCS and a lower arm gene of vSOCS by PCR by using ISKNV strain genome DNA as a template; cloning the obtained upper arm gene and lower arm gene of vSOCS into the first Puc18 recombinant vector prepared in the step a) to obtain a second Puc18 recombinant vector, wherein in the obtained second Puc18 recombinant vector, the second screening marker gene is positioned between the upper arm gene and the lower arm gene of vSOCS;

c) homologous recombination

First homologous recombination: transfecting mandarin fish cells by using the constructed second Puc18 recombinant vector, adding ISKNV virus liquid after transfection to counteract virus, and collecting diseased cells to obtain virus liquid containing ISKNV delta vSOCS; purifying the virus liquid by adopting a limiting dilution method to obtain ISKNV delta vSOCS recombinant virus;

second homologous recombination: transfecting mandarin fish cells by using a constructed second Puc19 recombinant vector, adding purified ISKNV delta vSOCS virus liquid after transfection to counteract toxicity, and collecting diseased cells to obtain virus liquid containing ISKNV delta vSOCS delta vTK and ISKNV delta vSOCS; the virus liquid is purified by adopting a limiting dilution method to obtain the oncocyte virus vSOCS/vTK double-gene deletion strain.

Further preferably, in the first homologous recombination in step c), the ISKNV Δ vSOCS recombinant virus is obtained by purifying 5-10 generations by using a limiting dilution method.

Further preferably, in the second homologous recombination in step c), the enlarged cell virus vSOCS/vTK double gene deletion strain is obtained by purifying 5-10 generations by limiting dilution method.

Still more preferably, in the second homologous recombination in step c), the step of purifying 5-10 generations by limiting dilution to obtain the oncocyte virus vSOCS/vTK double-gene deletion strain specifically comprises:

repeatedly freezing and thawing the ISKNV delta vSOCS delta vTK and ISKNV delta vSOCS mixed virus liquid for 3-5 times, filtering and sterilizing by using a filter membrane, infecting healthy mandarin fish cells after dilution, selecting cells expressing a first screening marker gene and a second screening marker gene simultaneously after morbidity, infecting the healthy mandarin fish cells after dilution, and continuously culturing and observing;

after the cultured cells are diseased, selecting cells expressing the first screening marker gene and the second screening marker gene simultaneously, diluting the cells to infect healthy mandarin fish cells, and continuously culturing and observing the cells; the steps are repeated, and the purified oncocyte virus vSOCS/vTK double-gene deletion strain is obtained by purifying 5-10 generations by using a limiting dilution method.

In a fifth aspect, the invention provides a recombinant virus vaccine of the magnovirus vSOCS/vTK double-gene deletion, which comprises the magnovirus vSOCS/vTK double-gene deletion strain of the first aspect or the magnovirus vSOCS/vTK double-gene deletion strain with the screening marker of the second aspect.

Preferably, the oncocyte virus vSOCS/vTK double gene deletion recombinant virus vaccine further comprises a pharmaceutically acceptable diagnostic agent, carrier, excipient or diluent.

In a sixth aspect, the present invention provides a tumor cell virus vSOCS/vTK double-gene deletion strain of the first aspect or a tumor cell virus vSOCS/vTK double-gene deletion strain with a screening marker of the second aspect, wherein the two gene deletion strains are applied by one or more of the following methods:

(1) the oncocyte virus vSOCS/vTK double-gene deletion strain is independently applied;

(2) the oncocyte virus vSOCS/vTK double-gene deletion strain is combined with one or more vaccines for application;

(3) putting the swollen cell virus vSOCS/vTK double-gene deletion strain into a culture water body for application in a soaking mode;

(4) and (3) putting the oncocyte virus vSOCS/vTK double-gene deletion strain into a culture water body for application by adopting a feeding mode.

In a seventh aspect, the invention provides an application of the tumor cell virus vSOCS/vTK double-gene deletion strain of the first aspect or the tumor cell virus vSOCS/vTK double-gene deletion strain with a screening marker of the second aspect in preparing a reagent or a medicament for diagnosing, preventing and treating tumor cell virus diseases.

Preferably, the enlarged cell virus comprises one or more of mandarin fish infectious spleen and kidney necrosis virus, red sea bream iridovirus, striped sea bream iridovirus, sea bass iridovirus, large yellow croaker virus, taiwan rockfish iridovirus and oblique rockfish iridovirus.

The invention has the beneficial effects that:

the invention constructs a delta vSOCS delta vTK double-gene deletion virus strain of mandarin fish Infectious Spleen and Kidney Necrosis Virus (ISKNV), and the virus strain is purified to obtain the recombinant genetic engineering vaccine with immunogenicity.

The recombinant genetic engineering vaccine provided by the invention is an attenuated vaccine with good immunogenicity, has better immunogenicity than an inactivated vaccine, can induce fish to generate immune response better, and has an immune effect. In addition, the recombinant genetic engineering vaccine can induce immunized fishes to effectively generate specific antibodies for a long time, and has the same excellent protection rate compared with an inactivated vaccine. And secondly, compared with other vaccines, the recombinant genetic engineering vaccine has the advantage of high immunity rate, and can achieve better immunity effect in production and application.

More importantly, the recombinant genetic engineering vaccine has certain virological activity, is more convenient and fast in immunization mode, and can be used for enabling viruses to enter the fish body from gills or digestive tracts by adopting a soaking immunization method to exert immunogenicity and induce the fish to generate immune response. Can save a great deal of cost in production and application. Meanwhile, because the vSOCS and vTK pathogenic genes are knocked out by the recombinant genetic engineering vaccine constructed by the invention, the virulence is very weak, and the immunized fish can not be killed, so that the immune effect is achieved.

The preparation method of the recombinant genetic engineering vaccine provided by the invention is simple: on the basis of ISKNV delta vSOCS single-gene deletion virus strain, DsRed2 red fluorescent protein gene is used as a screening marker, a gene engineering technology is utilized to construct a recombinant transfer vector containing vTK gene recombination arms, a transfection technology is utilized to enable the recombinant transfer vector and wild type viruses to carry out homologous recombination in mandarin fish cells, vSOCS genes and vTK genes in wild types are knocked out to obtain virus suspension of ISKNV delta vSOCS delta vTK, ISKNV delta vSOCS delta vTK virus strain is purified through a limiting dilution method, finally, the deletion virus strain is expanded and cultured through a cell culture technology, and the purified recombinant gene engineering vaccine is prepared.

Drawings

FIG. 1 is an electrophoresis diagram of nested PCR detection for verifying whether the TK gene is successfully knocked out by an ISKNV Δ vSOCS Δ vTK double-gene knock-out virus strain, wherein the size of the tag gene obtained by amplification is shown in a box, which indicates that the original TK gene is knocked out;

FIG. 2 is a nested PCR detection double-amplification electrophoretogram for verifying whether the TK gene is successfully knocked out by the ISKNV Δ vSOCS Δ vTK double-gene knock-out virus strain, wherein a box indicates that the TK gene is still not amplified by the double-amplification, which indicates that the TK gene is cleared;

FIG. 3 is a graph plotting ISKNV virus growth curves for detecting virus particle number, wherein the growth rate of the double gene deletion recombinant virus strain is significantly reduced compared with that of the wild type strain;

FIG. 4 is a graph comparing the infectious titer of a double gene deletion recombinant virus with that of a wild-type virus, wherein the infectious titer of the double gene deletion recombinant virus is significantly lower than that of the wild-type strain;

FIG. 5 is a transmission electron microscope image of morphology of a double-gene-deletion recombinant virus and a wild-type virion, wherein the magnification of the left image is 100000X, and the magnification of the right image is 40000X, and the result shows that the morphology of the double-gene-deletion recombinant virus and the wild-type virion is similar;

FIG. 6 is a diagram showing the morphological changes of the spleen of a mandarin fish after the challenge of the double-gene deletion recombinant virus and the wild type virus, wherein the left diagram shows that the spleen is not obviously enlarged after the challenge of the double-gene deletion recombinant virus, and the right diagram shows that the spleen is obviously enlarged when the wild type group is dying;

FIG. 7 is a graph showing the first experimental results of the challenge survival rate of the double-gene deletion recombinant virus, which does not significantly affect the survival of mandarin fish after challenge by the double-gene deletion recombinant virus;

FIG. 8 is a graph showing the first experimental results of the protection rate against the poisoning by the double gene deletion recombinant virus, showing that the mandarin fish has a good immunity against the wild type virus after the double gene deletion recombinant virus is attacked;

FIG. 9 is a graph showing the second experimental result of the survival rate of the double-gene deletion recombinant virus after challenge, which does not significantly affect the survival of the mandarin fish;

FIG. 10 is a graph showing the result of a second experiment on the protection rate against the poisoning by the double gene deletion recombinant virus, which shows that the mandarin fish has a good immunity against wild type viruses after the double gene deletion recombinant virus is attacked;

FIG. 11 shows the time phase for the elimination of the double gene deletion recombinant virus, the boxed portion showing the elimination of the double gene deletion recombinant virus for about 12-15 days;

FIG. 12 is a graph showing the change in IgM expression level in mandarin fish blood after challenge with the double-gene deletion recombinant virus, which shows that the increase in IgM expression level in mandarin fish blood can be effectively stimulated within 12 days after challenge with the double-gene deletion recombinant virus, revealing the cause of the protective effect of the double-gene deletion virus;

FIG. 13 is a graph showing the change in the amount of Mx expression in mandarin fish blood after challenge with the double-gene deletion recombinant virus, which indicates that the increase in the amount of Mx expression in mandarin fish blood can be effectively stimulated within 12 days after challenge with the double-gene deletion recombinant virus, thus revealing the cause of the protective effect of the double-gene deletion virus.

Detailed Description

While the following is a description of the preferred embodiments of the present invention, it will be understood by those skilled in the art that various changes and modifications may be made without departing from the spirit and scope of the invention.

Preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings. The experimental methods in the examples, in which specific conditions are not specified, are generally carried out under conventional conditions. In the examples of the present invention, unless otherwise specified, reagents and consumables used therein are commercially available.

The embodiment of the invention provides a preparation method of a recombinant virus vaccine with deletion of vSOCS and vTK genes of a swollen cell virus, which comprises the following steps:

1. construction of pUC19-Red vector with RFP expression element

1.1 engineering can be used as a marker protein to replace the vTK gene to design primers for the RFP sequence of the pDsRed-Monomer-N1 vector:

RFP-F：ATAGTAATCAATTACGGGGT(SEQ ID NO.3)，

RFP-R：TGATGAGTTTGGACAAACCA(SEQ ID NO.4),

the base sequences of the 9bp to 1590bp of the vector were amplified by PCR using a KodFx polymerase system from Toyobo company, and a 50. mu.L system of PCR reaction was:

the PCR reaction conditions were as follows: denaturation temperature 95 ℃ for 30s, annealing temperature 55 ℃ for 30s, extension temperature 62 ℃ for 1 min, and 30 cycles.

1.2 deleting the original MCS sequence of the RFP sequence obtained in the step 1.1 by using an Overlap method,

designing an Overlap primer:

RFP-OL-F:CAGATCCGCTAGCGCTCGCCACCATGGACAACACCG(SEQ ID NO.5)，

RFP-OL-R:GTTGTCCATGGTGGCGAGCGCTAGCGGATCTGACGG(SEQ ID NO.6)，

the original MCS sequence (base sequence from 591bp to 671 bp) is deleted by using the method of overlapping PCR (overlap) to facilitate the connection of a new recombinant transfer vector.

The first amplification of the Overlap PCR respectively amplifies a 9-591bp sequence by RFP-F/RFP-OL-R and amplifies a 671-1590bp sequence by RFP-OL-F/RFP-R, and the system is as follows:

reagent	Dosage (total 50. mu.L system) units: mu.L
		Kod Fx DNA thermostable polymerase	1
2×Kod Buffer	25
		Sterile water	10
dNTPs	10
		RFP-F/RFP-OL-R	1.5
RFP-OL-F/RFP-R	1.5
		DsRed2 template	1

The PCR reaction conditions were as follows: the denaturation temperature was 95 ℃ for 30s, the annealing temperature was 50 ℃ for 30s, the extension temperature was 62 ℃ for 30s, and the extension time was 30s, for 30 cycles.

The second amplification system takes the PCR products of the two sequences of the first amplification as templates for the second amplification, and the system is as follows:

the conditions for the second amplification reaction were as follows: the denaturation temperature is 95 ℃, the annealing temperature is used for Touchdown PCR, 10 cycles of reduction are carried out from 55 ℃ to 46 ℃, 25 cycles are carried out at 50 ℃, the extension temperature is 62 ℃, and the extension time is 1 minute.

1.3 construction of the 1509bp size RFP expression element

The sequences obtained by the Overlap PCR and linking the 9 th to 590 th bp and 672 th to 1590 th bp were subjected to tailing reaction at 72 ℃ for 20 minutes using the ordinary Taq enzyme of TAKARA, and ligated into the Pmd-19T vector of TAKARA to construct an RFP expression element having a size of 1509 bp.

1.4 ligation of the RFP expression element into the pUC19 vector

Designing primers RFP-K-F and RFP-B-R with enzyme cutting sites, and obtaining the modified RFP with the enzyme cutting sites by PCR amplification by using the same Kod Fx system and T load connected with the modified RFP as a template. Then, the PCR product obtained in the previous step and the Puc19 vector were digested with restriction endonucleases with Kpn I and BamH I, respectively, and the expression element was ligated into pUC19 vector with T4DNA ligase to construct pUC19-Red vector with RFP. The enzyme digestion system is as follows:

reagent	Dosage (50 μ L total system)
		Kpn I restriction endonuclease	2μL
BamHI restriction enzyme	2μL
		10 Xenzyme digestion buffer	5μL
PCR product	2μg
		Sterile water	up to 50μL

The restriction reaction was carried out at 37 ℃ for 12 hours, and the expression element was ligated into pUC19 vector using T4DNA ligase to construct pUC19-Red vector harboring DsRed 2.

2. Construction of vTK Gene deletion recombinant transfer vector

ISKNV DNA was extracted, diluted to 50. mu.g/mL as a template, and vTK upper arm (28441 bp to 29446bp in ISKNV genome) and lower arm (30062 bp to 31140bp in ISKNV genome) were amplified from ISKNV genome and ligated to Puc19-Red vector using EcoRI, Kpn I, BamHI, and HindIII restriction endonucleases, respectively, to construct vTK recombinant transfer vector. The primer sequence is as follows:

TK upper arm-F: GGAATTCTCTGACGGCAACATAAATGGC (SEQ ID NO. 7);

upper arm-R of TK: GGGGTACCCCAGCGACATACAGAGCAATTG (SEQ ID NO. 8);

TK lower arm-F: CGGGATCCTATTAGCCACAAATACAACTGTGGG (SEQ ID NO. 9);

TK lower arm-R: CCCAAGCTTTGCCTTAGGGGGACCTTATGTTAG (SEQ ID NO. 10).

The PCR reaction system is as follows:

reagent	Dosage (total 50. mu.L system) units: mu.L
		Kod Fx DNA thermostable polymerase	1
2×Kod Buffer	25
		Sterile water	10
dNTPs	10
		TK Upper/lower arm-F	1.5
TK Upper/lower arm-R	1.5
		ISKNV template	1

And adding 10 mu L of 6 XDNA electrophoresis Loading Buffer into the PCR product, mixing uniformly, carrying out electrophoresis identification and carrying out gel recovery. The recovered products are respectively cut and recovered by EcoRI, KpnI, BamHI and HindIII restriction endonucleases, and are linked to the Puc19-Red vector constructed in the last step by utilizing T4 ligase to form a vTK recombinant transfer vector. The enzyme digestion system is as follows:

reagent	Dosage (50 μ L total system)
		EcoRI/BamHI restriction enzyme	2μL
KpnI/HindIII restriction endonuclease	2μL
		10 Xenzyme digestion buffer	5μL
PCR product	2μg
		Sterile water	up to 50μL

3, vTK transfection of mandarin fish cell with recombinant transfer vector

Transfecting mandarin fish cells by using the constructed vTK recombinant transfer vector, wherein an electrotransfer method is adopted for transfection, the electrotransfer voltage is 250V, the electric shock is 10ms, ISKNV delta vSOCS virus solution is added according to the copy number of 1.30e +05 viruses per milliliter after 24 hours of transfection, and after 72 hours of virus challenge, cells mixed with culture medium and attacked are collected together to obtain the virus solution mixed with ISKNV delta vSOCS delta vTK and ISKNV delta vSOCS.

4. Selecting pure ISKNV delta vSOCS delta vTK double-gene knockout virus strain

Repeatedly freezing and thawing the mixed virus solution for 3 times, infecting healthy mandarin fish cells according to the proportion of 1:100, observing fluorescence for about 72 hours, poking cells emitting green fluorescence and red fluorescence at the same time, roughly estimating the number of poked cells, adding the cells according to the proportion of 200 mu LDMEM culture medium per cell, and then dividing the cells into 96-well plates seeded with mandarin fish cells, wherein 100 mu L of culture medium is in each plate. Thus, the limited dilution method was used to purify more than 5 generations, and pure ISKNV. DELTA. vSOCS. DELTA. vTK double knockout virus strains were selected.

5. Verifying whether ISKNV delta vSOCS delta vTK double-gene knockout virus strain successfully knocks out TK gene

Carrying out amplification culture on the selected pure ISKNV delta vSOCS delta vTK virus strain, extracting virus DNA, and respectively designing a first amplification primer and a second amplification primer at two sides and inside of vTK gene, wherein the primer sequences are as follows:

TK-outer-F：GGCGGCATAGTATTTACCAC(SEQ ID NO.11)；

TK-outer-R：ACCTGTGGCAATAACAACTC(SEQ ID NO.12)；

TK-middle-F：ATGTGGCGCACTCAAAAAAA(SEQ ID NO.13)；

TK-middle-R：TGTGTAACAATTCAATAAAC(SEQ ID NO.14)。

and (5) performing nested PCR identification. As shown in FIG. 1/2, one amplified outer primer result, boxes indicate the size of the amplified signature gene, indicating that the original TK gene has been knocked out, two amplified middle primer results, boxes indicate that the TK gene is still not amplified, indicating that the TK gene has been cleared.

6. Identification of growth curves and infection titers of ISKNV Δ vSOCS Δ vTK double-gene-deleted recombinant virus strains at cellular level

After obtaining the purified double gene deletion recombinant virus strain, the growth curve and the infectious titer of the virus were identified at the cellular level. Firstly, absolute quantitative PCR detection is carried out by using the double-gene deletion recombinant virus strain and the wild type virus strain, and the physical titer of the virus is calculated. Mandarin fish cells were then cultured, counted and transferred to 12-well and 96-well cell culture plates, respectively, at the same cell concentration. After the cells had grown to log phase, the cells were infected with each of the two virus strains at a physical titer of 1 MOI. The growth curve determination uses a 12-hole plate, cell virus mixed liquor is collected at 2, 4, 8, 12, 24, 48, 72 and 96 hours respectively, the number of virus particles is detected by absolute quantitative PCR after DNA is extracted, two virus growth curve graphs 3 are drawn, and the result shows that the growth speed of the double-gene deletion recombinant virus strain is obviously reduced compared with that of a wild strain, and compared with that of the wild strain at the end, the growth speed is reduced by 38%. The infection titer determination uses a 96-well plate, the Tcid50 indexes of two viruses are determined by a continuous gradient limiting dilution method, each virus is repeated for 3 times, the result is calculated by a Karber method, and the result shows that the Tcid50 of the double-gene deletion recombinant virus strain is 10-4.375/0.1mL, the wild-type virus strain is 10-4.75/0.1mL, and as shown in figure 4, the virus titer of the double-gene deletion recombinant virus strain is obviously lower than that of the wild-type virus strain.

7. Transmission electron microscope observation ISKNV delta vSOCS delta vTK double-gene deletion recombinant virus strain morphology

The mandarin fish cell is used to enrich the ISKNV delta vSOCS delta vTK virus strain, the virus particles are purified by the isopycnic gradient centrifugation method, and the morphology is observed by a transmission electron microscope, as shown in FIG. 5, and the result shows that the virus strain has no obvious change compared with the wild type.

8. Siniperca chuatsi live body challenge experiment

An ISKNV delta vSOCS delta vTK double-gene deletion recombinant virus strain is used for carrying out two in-vivo mandarin fish challenge experiments, and mandarin fish with the average weight of 175g +/-30 g is selected as a sample. FIG. 6 shows that spleen was not significantly enlarged after challenge with the double gene deletion recombinant virus, while spleen was significantly enlarged when the wild type group was dying. In the first experiment, a double-gene deletion recombinant virus experimental group, a wild type virus group and a DMEM control group are arranged, and the number of samples is 33/20/20 respectively. Soaking the experimental group at the concentration of the physical titer of 9.0E3/mL for counteracting the toxin for 3h, and then changing water; wild type virus group was also challenged with 8.0E5/mL, and control group was supplemented with 20mL DMEM medium in water. And (5) after 30 days of culture, attacking the wild strain at the concentration of 8.0E6/mL, and counting the result after 20 days. The results are shown in FIG. 7/8, in which the mortality rate of the experimental group of the double-gene deletion recombinant virus is 0% and the protection rate is 95%. The experiment group of the second time is designed to be the same as the experiment of the first time, the number of samples is 100/20/50 respectively, the experiment group is used for attacking the toxin with the concentration of 5.7E4/mL, the wild type group is used for attacking the toxin with the concentration of 8.0E5/mL, the setting of the contrast group and the attacking method are the same as the experiment of the first time, and the concentration of attacking toxin in the breeding period and the protection period is the same as the experiment of the first time. The statistical result is shown in figure 9/10, the mortality rate of the double gene deletion recombinant virus experimental group is 17%, and the protection rate is 97%. The experimental result also reveals that the attacking concentration of the double-gene deletion recombinant virus should be low in the process of obtaining effective immune protection effect, and the attacking concentration is preferably 1.0E 4/mL.

9. Verification of immune protection effect of ISKNV delta vSOCS delta vTK double-gene deletion recombinant virus strain

In the process of carrying out the second challenge experiment, 30 tails of double-gene deletion recombinant virus groups with the same concentration for challenge are arranged outside the three groups, the concentration for challenge is the same as that of the challenge experiment, 3 tails of double-gene deletion recombinant virus groups which survive without obvious signs are respectively taken every three days after challenge, spleen is taken to extract DNA to detect virus elimination, and blood is taken to extract RNA to detect the expression condition of IgM and antiviral genes Mx in blood. FIG. 11 shows that the double gene deletion recombinant virus is cleared in about 12-15 days. The results of fig. 12/13 show that after the bi-gene deletion recombinant virus is attacked, the expression level of the antibody IgM and the antiviral gene Mx in the mandarin fish blood can be effectively stimulated to be increased within 12 days, and the reason for the protective effect of the bi-gene deletion virus is revealed.

Although the present invention has been described in detail with reference to the preferred embodiments, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the true spirit and scope of the present invention.

Sequence listing

<110> Zhongshan university

<120> enlarged cell virus vSOCS/vTK double-gene knockout strain and preparation method and application thereof

<130> 2017

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 402

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgtgctccc cgacgtcatc ggcacagggt ctgagcgatc atttccctgt cttttcctgc 60

aaagaggact acaacatcat catggacact gtcagacaac tggaacaaag tggcttctac 120

tggggtcctt tgggggtcga ggaggcacat cgtatgctgc gcaactcggc actgggcagc 180

tttctcattc gggatagcag gcaaaaggac gtcttgttca cgctgtcgta tcactctgtg 240

accggacccg tcagtgtgag gattgaatac aaggacaagc aattttcctt ggctgggagc 300

aaacagaggt tttcatcggt ccttctcctg ttggaccatt acatcggtgg gcccaataat 360

actttaggca ttccatatat gaagcgggtg caaacacagt aa 402

<210> 2

<211> 615

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgtggcgca ctcaaaaaaa cataccccag gtatgcgcat atgacaaaat ggctcctgta 60

tatactgtgt ttggccatgt gggcgtgggt aagtcgagcc tgctgcgcag cctcgcaaac 120

actggcatta acgtcgtgct tgagcccaca gacacatggg agccgttctt ccaattgtac 180

tacaaagatc ccgtgcgatg ggcggcggcg ttccaaatga cggtgatacg cagctacagt 240

cacatataca gcgctaataa agataaccca ctgccaactg tagtcgagcg gtccccacag 300

tgctgccgcg cctttgttgc atggctgtat gccaccggtc agttagacac cgtgtcgcac 360

gacaccatca acacctacat agcggcggtg ccatggttca gcaatgtgac ccaagtctat 420

ttgcgttgca gccccacagt ggccgctgca cgtgcgttgg cgcgcccgaa cgaactcaac 480

ccatgcgcgc cagactacat ggccttccta cacacgcaat gggaggctag agtaacccca 540

gacaccataa taattgatgc agaacaagat atggacactg taagacggca gtttattgaa 600

ttgttacaca tataa 615

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atagtaatca attacggggt 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tgatgagttt ggacaaacca 20

<210> 5

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cagatccgct agcgctcgcc accatggaca acaccg 36

<210> 6

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gttgtccatg gtggcgagcg ctagcggatc tgacgg 36

<210> 7

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ggaattctct gacggcaaca taaatggc 28

<210> 8

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ggggtacccc agcgacatac agagcaattg 30

<210> 9

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

cgggatccta ttagccacaa atacaactgt ggg 33

<210> 10

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

cccaagcttt gccttagggg gaccttatgt tag 33

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ggcggcatag tatttaccac 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

acctgtggca ataacaactc 20

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

atgtggcgca ctcaaaaaaa 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

tgtgtaacaa ttcaataaac 20

Claims

1. A mandarin fish infectious spleen and kidney necrosis virus vSOCS/vTK double-gene deletion strain is characterized in that the mandarin fish infectious spleen and kidney necrosis virus vSOCS/vTK double-gene deletion strain is an attenuated virus strain prepared by mandarin fish infectious spleen and kidney necrosis virus strain deletion vSOCS gene and vTK gene.

2. A mandarin fish infectious spleen and kidney necrosis virus vSOCS/vTK double-gene deletion strain with a screening marker is characterized in that the mandarin fish infectious spleen and kidney necrosis virus vSOCS gene and vTK gene are deleted, and a first screening marker gene and a second screening marker gene are respectively inserted into the gene deletion position through homologous recombination to prepare an attenuated virus strain.

3. The screen-labeled Siniperca chuatsi infectious spleen and kidney necrosis virus vSOCS/vTK double-gene-deleted strain of claim 2, wherein the first and second screening marker genes are different and are independently selected from the group consisting of an insertion of a green fluorescent protein gene and an insertion of a red fluorescent protein gene.

4. A mandarin fish infectious spleen and kidney necrosis virus vSOCS/vTK double-gene deletion recombinant virus vaccine, which comprises the mandarin fish infectious spleen and kidney necrosis virus vSOCS/vTK double-gene deletion strain of claim 1 or the mandarin fish infectious spleen and kidney necrosis virus vSOCS/vTK double-gene deletion strain with a screening marker of claim 2.

5. The Siniperca Chuatsi infectious splenorenal necrosis virus vSOCS/vTK double-gene-deleted recombinant virus vaccine of claim 4, wherein the Siniperca Chuatsi infectious splenorenal necrosis virus vSOCS/vTK double-gene-deleted recombinant virus vaccine further comprises a pharmaceutically acceptable diagnostic agent, carrier, excipient or diluent.

6. Use of the mandarin fish infectious spleen and kidney necrosis virus vSOCS/vTK double-gene-deleted strain of claim 1 or the screening-labeled mandarin fish infectious spleen and kidney necrosis virus vSOCS/vTK double-gene-deleted strain of claim 2 in the preparation of an agent or a medicament for preventing infectious spleen and kidney necrosis virus diseases.