CN108384763B

CN108384763B - Infectious spleen and kidney necrosis virus ORF074 gene deletion strain and preparation method and application thereof

Info

Publication number: CN108384763B
Application number: CN201810209600.7A
Authority: CN
Inventors: 郭长军; 何建国; 曾若云; 林易凡; 翁少萍; 何键
Original assignee: Sun Yat Sen University
Current assignee: Sun Yat Sen University
Priority date: 2018-03-14
Filing date: 2018-03-14
Publication date: 2022-02-11
Anticipated expiration: 2038-03-14
Also published as: CN108384763A

Abstract

The invention provides an infectious spleen and kidney necrosis virus ORF074 gene deletion strain, a preparation method and application thereof, and relates to an attenuated virus strain prepared after the infectious spleen and kidney necrosis virus strain is deleted of ORF074 gene. The invention also provides an infectious spleen and kidney necrosis virus ORF074 gene deletion strain with a screening marker, a preparation method and an application thereof, wherein the infectious spleen and kidney necrosis virus ORF074 gene is deleted, and the screening marker gene is inserted into the gene deletion part through homologous recombination to prepare an attenuated virus strain. The infectious spleen and kidney necrosis virus ORF074 gene deletion strain provided by the invention is a recombinant genetic engineering vaccine with ORF074 gene knocked out, is weak in toxicity, greatly reduces morbidity and mortality of immunized fishes, can achieve a remarkable immune effect by adopting soaking immunization, does not need injection, and has a great application value.

Description

Infectious spleen and kidney necrosis virus ORF074 gene deletion strain and preparation method and application thereof

Technical Field

The invention relates to the field of aquaculture disease prevention and control, and in particular relates to an infectious spleen and kidney necrosis virus ORF074 gene deletion strain and a preparation method and application thereof.

Background

Mandarin fish, also called Osmanthus fragrans, is one of the main famous and superior cultured fishes in fresh water in China due to its advantages of fast growth, excellent quality and delicious taste. Siniperca chuatsi iridovirus disease caused by Infectious Spleen and Kidney Necrosis Virus (ISKNV) is a main epidemic disease of mandarin fish culture, so that the death rate of the mandarin fish is close to 100 percent, and the mandarin fish becomes a main bottleneck for restricting the development of the mandarin fish culture industry.

Infectious Spleen and Kidney Necrosis Virus (ISKNV) is a representative species of the genus megavirus, and the whole gene group nucleic acid sequence of the Infectious Spleen and Kidney Necrosis Virus (ISKNV) is determined, has the full length of 111362bp, has the content of G + C of 54.78 percent, contains 124 potential Open Reading Frames (ORF) and codes for 40 to 1208 amino acids. By sequence analysis, ORF006L is currently presumed to be the major capsid protein; ORF19R, ORF46L, ORF27L and ORF63L are involved in DNA replication, modification and processing; ORF24, ORF28L, ORF34R, ORF64L and ORF87R are involved in transcription and nucleotide metabolism; ORF111L and ORF048R are involved in host interactions; ORF12, ORF65, ORF66, ORF99 and ORF111L encode a ring finger protein.

The ISKNV vaccine for preventing and controlling the infectious spleen and kidney necrosis virus at present is mainly a cell inactivated vaccine, and the cell inactivated vaccine has the advantages of high safety, strong immunogenicity, high protection rate, short development period and the like, and becomes the most common vaccine type, but the inactivated vaccine can only cause humoral immunity, the immune response type is single, the immune maintenance time is short, multiple vaccinations are needed, the inoculation amount is large, and the like. Many documents report that the gene deletion attenuated live vaccine can effectively and safely play a role in protection, the attenuated live vaccine can induce humoral immunity and cellular immunity, and the advantages of comprehensive immune response types, long immune maintenance time, small inoculation frequency, small inoculation amount and the like become a new research hotspot of the conventional ISKNV vaccine. However, the study of ISKNV ORF074 gene deletion strain as a gene deletion attenuated live vaccine has not been reported.

Disclosure of Invention

In view of the above, the invention provides an infectious spleen and kidney necrosis virus vaccine which has a good immune effect, is convenient to use, has strong applicability and does not need to be injected, and a preparation method and application thereof. The ORF074 gene was knocked out from the genome of the wild-type infectious spleen and kidney necrosis virus, and an ORF074 gene-deleted virus (ISKNV. DELTA. ORF 074) was constructed. Compared with the traditional vaccine immunization mode, the soaking immunization is the greatest advantage of the gene-deleted vaccine, is a great innovation of the fish virus vaccine immunization mode, and has wide application space.

The invention provides an infectious spleen and kidney necrosis virus ORF074 gene deletion strain, which is an attenuated virus strain prepared after the infectious spleen and kidney necrosis virus strain lacks ORF074 gene.

Preferably, the ORF074 gene sequence is identical to SEQ ID NO: 1, having at least 90%, at least 95%, at least 98%, at least 99% or 100% homology.

In a second aspect, the invention provides an infectious spleen and kidney necrosis virus ORF074 gene deletion strain with a selection marker, wherein the infectious spleen and kidney necrosis virus ORF074 gene is deleted, and the first selection gene and the second selection gene are respectively inserted into the positions of the deleted genes through homologous recombination to prepare an attenuated virus strain.

Preferably, the ORF074 gene sequence is a nucleotide sequence having at least 90%, at least 95%, at least 98%, at least 99% or 100% homology with the sequence shown in SEQ ID No. 1.

Preferably, the first selection gene and the second selection gene are different and are respectively and independently selected from the group consisting of an inserted red fluorescent protein gene and a resistance selection gene.

Further preferably, the red fluorescent protein gene is DsRed2 protein gene.

Further preferably, the resistance selection gene is a puromycin resistance selection gene.

In a third aspect, the invention provides a method for constructing an infectious spleen and kidney necrosis virus ORF074 gene deletion strain, which comprises the following steps: isolating and identifying infectious spleen and kidney necrosis virus strains; then deleting the ORF074 gene of the infectious spleen and kidney necrosis virus strain by a homologous recombination method to obtain an infectious spleen and kidney necrosis virus ORF074 gene deletion strain;

In a fourth aspect, the invention provides a method for constructing an infectious spleen and kidney necrosis virus ORF074 gene deletion strain with a selection marker, which comprises the following steps: isolating and identifying infectious spleen and kidney necrosis virus strains; and deleting the ORF074 gene of the infectious spleen and kidney necrosis virus strain by a homologous recombination method, and respectively inserting a first screening gene and a second screening gene into the gene-deleted positions to obtain the infectious spleen and kidney necrosis virus ORF074 gene-deleted strain.

Further preferably, the red fluorescent protein gene is DsRed2 protein gene.

Preferably, the construction method specifically comprises:

a) transformation of screening genes

Cloning the first screening gene to a multiple cloning site of a Puc19 vector to obtain a first Puc19 recombinant vector; cloning the second screening gene to the multiple cloning site of the first Puc19 recombinant vector to obtain a second Puc19 recombinant vector;

b) construction of transfer vectors

Construction of recombinant ORF074 gene-deleted virus transfer vector: obtaining an upper arm gene of ORF074 and a lower arm gene of ORF074 by PCR using ISKNV strain genome DNA as a template; cloning the obtained upper arm gene of ORF074 and the obtained lower arm gene of ORF074 into the second Puc19 recombinant vector prepared in step a) to obtain a third Puc19 recombinant vector, wherein in the obtained third Puc19 recombinant vector, the first screening gene and the second screening gene are positioned between the upper arm gene of ORF074 and the lower arm gene of ORF 074;

c) homologous recombination

Transfecting mandarin fish cells by using the constructed ORF074 recombinant transfer vector, adding ISKNV virus solution after transfection to counteract toxicity, and collecting diseased cells to obtain virus solution containing ISKNV delta ORF074 and wild type ISKNV; purifying the virus liquid by adopting a limiting dilution method to obtain an ISKNV delta ORF074 recombinant virus;

further preferably, said step c) is performed by purifying 5-10 generations by limiting dilution to obtain the ISKNV Δ ORF074 recombinant virus.

Still more preferably, the step c) of purifying 5-10 generations by limiting dilution method to obtain ISKNV delta ORF074 gene deletion strain specifically comprises:

repeatedly freezing and thawing the ISKNV delta ORF 074-containing mixed virus solution and wild ISKNV for 3-5 times, filtering with a filter membrane for sterilization, diluting to infect healthy mandarin fish cells, selecting cells expressing the first screening gene and the second screening gene simultaneously after morbidity, diluting to infect healthy mandarin fish cells, and continuously culturing and observing;

after the cultured cells are diseased, selecting cells expressing the first screening gene and the second screening gene simultaneously, diluting the cells to infect healthy mandarin fish cells, and continuously culturing and observing the cells; this was repeated, and 5 to 10 generations were purified by limiting dilution to obtain a purified ISKNV. DELTA. ORF074 gene-deleted strain.

In a fifth aspect, the invention provides an infectious spleen and kidney necrosis virus ORF074 gene deletion recombinant virus vaccine, which comprises the infectious spleen and kidney necrosis virus ORF074 gene deletion strain of the first aspect or the infectious spleen and kidney necrosis virus ORF074 gene deletion strain with a screening marker of the second aspect.

Preferably, the infectious spleen and kidney necrosis virus ORF074 gene deletion recombinant virus vaccine further comprises a pharmaceutically acceptable diagnostic agent, carrier, excipient or diluent.

In a sixth aspect, the present invention provides an infectious spleen and kidney necrosis virus ORF074 gene deleted strain of the first aspect or an infectious spleen and kidney necrosis virus ORF074 gene deleted strain with a selection marker of the second aspect, wherein the strain is applied by one or more of the following methods:

(1) the infectious spleen and kidney necrosis virus ORF074 gene deletion strain is independently applied;

(2) the infectious spleen and kidney necrosis virus ORF074 gene deletion strain is combined with one or more vaccines for application;

(3) putting the infectious spleen and kidney necrosis virus ORF074 gene deletion strain into a culture water body for application in a soaking mode;

(4) and putting the infectious spleen and kidney necrosis virus ORF074 gene deletion strain into a culture water body for application by adopting a feeding mode.

In a seventh aspect, the invention provides an infectious spleen and kidney necrosis virus ORF074 gene deletion strain of the first aspect or an infectious spleen and kidney necrosis virus ORF074 gene deletion strain with a screening marker of the second aspect for use in preparing an agent or a medicament for diagnosing, preventing and treating a swollen cell virus disease.

Preferably, the enlarged cell virus comprises one or more of mandarin fish infectious spleen and kidney necrosis virus, red sea bream iridovirus, striped sea bream iridovirus, sea bass iridovirus, large yellow croaker virus, taiwan rockfish iridovirus and oblique rockfish iridovirus.

The invention has the beneficial effects that:

the invention constructs an infectious spleen and kidney necrosis virus ORF074 gene deletion strain, and the strain is purified to obtain the recombinant genetic engineering vaccine with immunogenicity.

The recombinant genetic engineering vaccine provided by the invention is an attenuated vaccine with good immunogenicity, can induce fish to generate immune response better, and has an immune effect. In addition, the recombinant genetic engineering vaccine can induce the immunized fish to effectively produce specific antibodies for a long time. And secondly, compared with other vaccines, the recombinant genetic engineering vaccine has the advantage of high immunity rate, and can achieve better immunity effect in production and application.

More importantly, the recombinant genetic engineering vaccine has certain virological activity, is more convenient and fast in immunization mode, and can be used for enabling viruses to enter the fish body from gills or digestive tracts by adopting a soaking immunization method to exert immunogenicity and induce the fish to generate immune response. Can save a great deal of cost in production and application. Meanwhile, the ORF074 gene is knocked out by the recombinant genetic engineering vaccine constructed by the invention, so that the toxicity is weakened, and the probability of death of immunized fishes caused by diseases is reduced, thereby achieving better immune effect.

The preparation method of the recombinant genetic engineering vaccine provided by the invention is simple: on the basis of ISKNV wild virus strains, DsRed2 red fluorescent protein gene and puromycin resistance screening gene are used as screening markers, a recombinant transfer vector containing ORF074 gene recombination arms is constructed by using a gene engineering technology, the recombinant transfer vector and wild viruses are subjected to homologous recombination in mandarin fish cells by using a transfection technology, ORF074 genes in wild types are knocked out, virus suspension of ISKNV delta ORF074 is obtained, ISKNV delta ORF074 virus strains are purified by using a limiting dilution method, finally, deleted virus strains are subjected to expanded culture by using a cell culture technology, and the deleted virus strains are purified to prepare the recombinant gene engineering vaccine.

Drawings

FIG. 1 is a map of ORF074 recombinant transfer vector Puc 19-RP;

FIG. 2 shows the identification result of ORF074 recombinant transfer vector Puc19-RP, wherein each lane is 1: 1kb marker, 2: the double restriction enzyme identification result of DsRed2 gene-puro gene, 3: the result of double enzyme digestion identification of the upper arm of ORF074, 4: the double enzyme digestion identification result of the lower arm of ORF 074;

FIG. 3 is an inverted fluorescence microscope with 100-fold magnification for observing red light luminescence of IKSNV delta ORF074 infected mandarin fish cells;

FIG. 4 shows the result of PCR identification of the ORF074 gene of the recombinant virus, wherein the lanes from left to right are: lane 1: ISKNV MCP negative control, lane 2: ISKNV MCP positive control, lane 3: the amplification of MCP from the ORF074 knock-out strain, lane 4: DS2000 marker, lane 5: ISKNV ORF074 negative control, lane 6: ISKNV ORF074 positive control, lane 7: detecting the result of the ORF074 knockout strain;

FIG. 5 shows the result of the second amplification of the ORF074 gene of the recombinant virus identified by PCR; the lanes from left to right are: lane 1: DS2000 marker, lane 2: ISKNV ORF074 negative control, lane 3: ISKNV ORF074 positive control, lane 4: detecting the result of the ORF074 knockout strain;

FIG. 6 is a graph showing the result of an experiment on the virus-attacking survival rate of ORF074 gene-deleted recombinant viruses, which shows that the virus-attacking toxicity of the gene-deleted recombinant viruses is significantly reduced compared with that of wild-type viruses;

FIG. 7 is a graph of the experimental results of the toxicity attacking protection rate of ORF074 gene-deficient recombinant viruses, which shows that the mandarin fish has better immunity to wild type viruses after the ORF074 gene-deficient recombinant viruses attack.

Detailed Description

While the following is a description of the preferred embodiments of the present invention, it will be understood by those skilled in the art that various changes and modifications may be made without departing from the spirit and scope of the invention.

Preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings. The experimental methods in the examples, in which specific conditions are not specified, are generally carried out under conventional conditions. In the examples of the present invention, unless otherwise specified, reagents and consumables used therein are commercially available.

The embodiment of the invention provides a preparation method of an infectious spleen and kidney necrosis virus ORF074 gene deletion recombinant virus vaccine, which comprises the following steps:

1. construction of pUC19-Red vector carrying DsRed2 Gene

By using pDsRed-Monomer-N1 Vector, respectively designing:

left and right primers:

RFP-F：ATAGTAATCAATTACGGGGT（ SEQ ID NO.2），

RFP-R：TGATGAGTTTGGACAAACCA（ SEQ ID NO.3），

overlapping pcr (overlap) primers:

RFP-OL-F：CAGATCCGCTAGCGCTCGCCACCATGGACAACACCG（SEQ ID NO.4），

RFP-OL-R:GTTGTCCATGGTGGCGAGCGCTAGCGGATCTGACGG（SEQ ID NO.5），

the Overlap technology is used for deleting a multiple cloning site sequence (a base sequence from 591bp to 671bp is convenient for connecting a new recombinant transfer vector) in the original DsRed2 vector. The first amplification of the Overlap PCR amplified two sequences of DsRed2 vector base numbers 9-591bp and 671-1590bp respectively. The Kod Fx polymerase system of TOYOBO company is used, and the PCR system is specifically as follows:

reagent	Dosage (total 50. mu.L system) units: mu.L
		Kod Fx DNA thermostable polymerase	1
2×Kod Buffer	25
		Sterile water	10
dNTPs	10
		RFP-F/RFP-OL-R	1.5
RFP-OL-F/RFP-R	1.5
		DsRed2 template	1

30 cycles of denaturation at 95 ℃ for 30s, annealing at 50 ℃ for 30s, extension at 62 ℃ for 30 s.

And adding 10 mu L of 6 XDNA electrophoresis Loading Buffer into the PCR product, mixing uniformly, carrying out electrophoresis identification and carrying out gel recovery. Then, taking the recovered product of the first amplification as a template to carry out second amplification, wherein the second amplification system is as follows:

reagent	Dosage (total 50. mu.L system) units: mu.L
		Kod Fx DNA thermostable polymerase	1
2×Kod Buffer	25
		Sterile water	9
dNTPs	10
		RFP-F	1.5
RFP-R	1.5
		First amplification product (two types in total)	1/1

Touchdown PCR was used, denaturation temperature 95 ℃, first round annealing temperature was decreased from 55 ℃ to 46 ℃ for 10 cycles, denaturation 30s, annealing 30s, extension temperature 62 ℃, extension time 1 min. Then, the annealing temperature of 50 ℃ is used for 25 cycles, and the denaturation, annealing and extension time is unchanged.

PCR products obtained by Overlap PCR and obtained by connecting the 9bp to 590bp and the 672bp to 1590bp of the DsRed2 base sequence are added into 10 mu L of 6 XDNA electrophoresis Loading Buffer, evenly mixed, subjected to electrophoresis identification and glue recovery. The recovered product was subjected to tailing reaction using Taq enzyme of TAKARA at 72 ℃ for 20 minutes.

A ligation reaction was performed using pmd 19T vector system of TAKARA, DH 5. alpha. E.coli competent cells were transformed, plated, cultured for 12-16h, and then subjected to sequencing by selection to clone an expression element of DsRed2 having a size of 1509 bp.

Designing primers RFP-K-F and RFP-B-R with Kpn I and BamHI restriction enzyme cutting sites respectively, utilizing the same Kod Fx polymerase system as before, taking T load connected with the modified DsRed photoprotein as a template, and obtaining the modified Red photoprotein with the Kpn I and BamHI restriction enzyme cutting sites through PCR amplification. Then, the PCR product obtained in the last step and the Puc19 vector are subjected to enzyme digestion reaction by using Kpn I and BamH I restriction endonucleases respectively, wherein the enzyme digestion system is as follows:

reagent	Dosage (50 μ L total system)
		Kpn I restriction endonuclease	2μL
BamHI restriction enzyme	2μL
		10 Xenzyme digestion buffer	5μL
PCR product	2μg
		Sterile water	up to 50 μL

The restriction reaction was carried out at 37 ℃ for 12 hours, and the expression element was ligated into pUC19 vector using T4 DNA ligase to construct pUC19-Red vector harboring DsRed 2.

2. Construction of pUC19-Red vector for puro Gene

The puro gene was inserted into pUC19-Red vector, and the following overlap primers were synthesized:

rp-ol-1	GGGGTACCTAGTTATTAATAGTAATCAA（SEQ ID NO.6）
		rp-ol-2	GTGGGCTTGTACTCGGTCATAGCGCTAGCGGATCTGACGG（SEQ ID NO.7）
rp-ol-3	CCGTCAGATCCGCTAGCGCTATGACCGAGTACAAGCCCAC（SEQ ID NO.8）
		rp-ol-4	CGGTGTTGTCCATGGTGGCGTCAGGCACCGGGCTTGCGGG（SEQ ID NO.9）
rp-ol-5	CCCGCAAGCCCGGTGCCTGACGCCACCATGGACAACACCG（SEQ ID NO.10）
		rp-ol-6	CGGGATCCGCAGTGAAAAAAATGCTTTA（SEQ ID NO.11）

respectively using rp-ol-1/rp-ol-2, rp-ol-3/rp-ol-4 and rp-ol-5/rp-ol-6 primers P to obtain fragments overlap1, overlap2 and overlap3, wherein the PCR system is as follows:

	unit: mu.L
		Template
	1
		Primer forward	1.5
Primer reverse	1.5
		Kod Fx	1
Kod Buffer	25
		ddH2O	20

The denaturation temperature was 95 ℃ for 30s, the annealing temperature was 55 ℃ for 30s, the extension temperature was 68 ℃ for 1min, and 30 cycles were performed.

After completion of the PCR, the Gel recovery was carried out using a Gel Extraction Kit supplied from E.D.Z.A., to carry out agarose Gel electrophoresis identification of 1% and obtain Gel recovery products of overlap1, overlap2 and overlap 3.

Connecting the recovered products of the gel, namely overlap1 and overlap2, wherein an overlap PCR system comprises the following steps:

	unit: mu.L
		Overlap1
	1
		Overlap2	1
Primer rp-ol-1	1
		Primer rp-ol-4	1
Kod Fx	1
		Kod Buffer	25
ddH2O	20

The denaturation temperature is 95 ℃, the time is 30s, the annealing temperature is 50 ℃, the time is 30s, the extension temperature is 68 ℃, the extension time is 1min, and 30 cycles are carried out.

After completion of PCR, 1% of the DNA was run and subjected to agarose Gel electrophoresis, and a band of about 1500bp was recovered using Gel Extraction Ki provided by E.D.Z.A., to obtain a Gel recovery product overlap 1/2. In the same way, overlap2 and overlap3 are used for connection to obtain overlap 2/3. And then, overlapping 1/2 and overlapping 2/3 are connected by using an overlapping PCR method to obtain overlapping 1/2/3.

The pUC19-red vector and overlap1/2/3 are subjected to enzyme digestion by Kpn1 and BamH1 restriction enzymes, the enzyme digestion products are connected to obtain an improved recombinant transfer vector pUC19-RP, and the vector map is shown in figure 1.

3. Construction of ORF074 recombinant transfer vector

The upper and lower arms of ORF074 were ligated into vector pUC 19-RP: ISKNV DNA was extracted using Invitrogen PureLink Viral DNA/RNA Kit and diluted to 50. mu.g/mL as template. Primers with restriction endonuclease sites EcoRI, KpnI and BamHI, HindIII were used:

ORF074 upper arm-F: AAGCTTCTGGAACGCAAGCGGCAGTA (SEQ ID NO. 12),

ORF074 upper arm-R: GGATCCTCAGACAGGTGTTTTGACCA (SEQ ID NO. 13),

ORF074 lower arm-F: GGTACCTAAAAGTGTTGCCGGCGTCT (SEQ ID NO. 14),

ORF074 lower arm-R: GAATTCAACAGTATGTCAAGCCGTGT (SEQ ID NO. 15).

The upper arm (68641 bp to 69668bp in the I ISKNV genome) and the lower arm (70683 to 71760bp in the ISKNV genome) of ORF074 were obtained by PCR from the ISKNV genome using the Kod Fx polymerase system, and the PCR reaction was as follows:

reagent	Dosage (total 50. mu.L system) units: mu.L
		Kod Fx DNA thermostable polymerase	1
2×Kod Buffer	25
		Sterile water	10
dNTPs	10
		ORF074 Upper/lower arm-F	1.5
ORF074 Upper/lower arm-R	1.5
		ISKNV template	1

And adding 10 mu L of 6 XDNA electrophoresis Loading Buffer into the PCR product, mixing uniformly, carrying out electrophoresis identification and carrying out gel recovery. And (3) respectively using EcoRI, KpnI, BamHI and HindIII restriction endonucleases to carry out enzyme digestion and recovery on the recovered products, and then utilizing T4 ligase to connect the recovered products to the Puc19-Red vector constructed in the last step to form an ORF074 recombinant transfer vector. The enzyme digestion system is as follows:

reagent	Dosage (50 μ L total system)
		EcoRI/BamHI restriction enzyme	2μL
KpnI/HindIII restriction endonuclease	2μL
		10 Xenzyme digestion buffer	5μL
PCR product	2μg
		Sterile water	up to 50 μL

The recombinant transfer vector was identified by double digestion, and the results are shown in FIG. 2.

4. Intracellular homologous recombination

Transfecting mandarin fish cells with the constructed ORF074 recombinant transfer vector, transfecting a Promega-FuGENE-HD Transfection Reagent with Promega at a Transfection amount of 5. mu.g, and transfecting at 2X 10⁷And (4) cells.

After 24h of transfection, ISKNV virus solution was added at 1.30e +05 virus copies per ml. After 72 h of virus challenge, collecting diseased cells to obtain virus liquid mixed by ISKNV delta ORF074 and wild ISKNV.

5. Purification of recombinant viruses

Repeatedly freezing and thawing ISKNV delta ORF074 and wild ISKNV mixed virus liquid for 3-5 times, filtering and sterilizing with 0.22 μm filter membrane, and infecting healthy mandarin fish cells at a ratio of 1: 1000.

Fluorescence was observed under an inverted fluorescence microscope after initiation of the disease for about 72 hours, and if red fluorescence was observed, puromycin (puromycin) was added at a concentration of 2 ng/. mu.l to kill the cells in which wild-type ISKNV was infected. After 24h, the supernatant was aspirated and washed 3 times with PBS before adding fresh DMEM medium. After about 48h, the cells infected by wild ISKNV die, and are collected, frozen and thawed repeatedly for 3-5 times, and a filter membrane with the diameter of 0.22 mu m is used for filtration and sterilization, so that ISKNV delta ORF074 screened by puromycin (puromycin) and wild ISKNV mixed virus liquid are obtained. Re-infecting the virus liquid with healthy mandarin fish cell and repeating the screening steps. After multiple repetitions, a purified ISKNV Δ ORF074 virus strain is finally obtained.

Luminescence of IKSNV Δ ORF074 infected cells under an inverted fluorescence microscope is shown in figure 3.

6. PCR identification of recombinant virus purity

Extracting virus DNA, respectively designing detection primers at both sides/inside of ORF074 gene, and performing PCR identification. PCR identification was carried out using the rTaq system from TAKARA, as follows:

reagent	Dosage (20. mu.L system total) units: mu.L
		2×rTaq	10
Sterile water	7
		ORF074 detection-F	1
ORF074 detection-R	1
		Recombinant virus genome template	1

Denaturation temperature 95 ℃ 30s, annealing temperature 55 ℃ 30s, extension temperature 72 ℃ 90s, 25 cycles.

And then using the product of the first amplification as a template, carrying out second amplification by the same system, and identifying the purity of the recombinant virus. The results of the identification are shown in FIGS. 4 and 5.

7. Siniperca chuatsi live body challenge experiment

An ISKNV delta ORF074 gene deletion recombinant virus strain is used for carrying out a mandarin fish living body challenge experiment, and mandarin fish with the average weight of 175g +/-30 g is selected as a sample in the experiment. The experiment sets an ISKNV delta ORF074 gene deletion recombinant virus experimental group, a wild type virus group and a DMEM control group, and the number of samples is 43/20/20 respectively. Soaking the experimental group at the concentration of the physical titer of 9.0E3/mL for counteracting the toxin for 3h, and then changing water; wild type virus group was also challenged with 8.0E5/mL, and control group was supplemented with 20mL DMEM medium in water. After 20 days of cultivation, the survival rate is counted every day, the result is shown in fig. 6, the survival rate of an experimental group of the ISKNV delta ORF074 gene deletion recombinant virus after 20 days of cultivation is 44.19%, and the wild type virus group dies completely within 11 days, which shows that the ISKNV delta ORF074 gene deletion recombinant virus has reduced toxicity compared with the wild type virus, and the detailed data can be seen in the following table:

and (3) attacking the wild strain of the mandarin fish surviving in the recombinant virus experimental group at the concentration of 8.0E6/mL, setting a control group with 20 tails, culturing for 20 days, and counting the protection rate every day. The results are shown in fig. 7, the protection rate of the ISKNV delta ORF074 gene deletion recombinant virus experimental group is 44.44%, while the 20 mandarin fish in the control group, which is not immunized by attenuated vaccine, all die within 12 days after wild strain challenge, which shows that effective immunoprophylaxis effect can be obtained by immunizing mandarin fish by the ISKNV delta ORF074 gene deletion recombinant virus strain, and detailed data can be shown in the following table:

in conclusion, the ISKNV delta ORF074 gene deletion recombinant virus strain can be ideally selected as an attenuated vaccine for preventing the infectious spleen and kidney necrosis virus.

Although the present invention has been described in detail with reference to the preferred embodiments, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the true spirit and scope of the present invention.

Sequence listing

<110> Zhongshan university

<120> infectious spleen and kidney necrosis virus ORF074 gene deletion strain, and preparation method and application thereof

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1014

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgatgtcta gcctgctgct gctgctgctg ctgcctgccc tagcccattc cggccccagg 60

catcctgatg ctgactcgtg tcagttcagg catctgatga tgcgccgtgg ggtcagccgc 120

cgaatgcttg ccgaacggat gtacaccatc ttgcacacct gcccgaacga cagggacgaa 180

gtcaccaaag tggcgtgtga tgtcatcgac ggaggcttct tccacaaagc cttgaccaac 240

atgggtgtgg acatggccgc cgaatgcttg aacttcagga cacgctattg ccatacatcg 300

cctgtgctga gcaacacact gtacagtccg caaggaatgg ccagtgctgt gtttggactg 360

gcgtctcact gcccggcgga gctaaccacc ctgatgtact acatgtgtgc tccggaaagg 420

cacgagcacc gtgtggccat gatgaccatg tttccgtatg gccgcaatat aatcactgca 480

atgtgtacca actacagaga tctcttcagg gcacagcaca cacagtctgc ggcggcagcg 540

tgcactgtgc gagctcgacg ccctgaggag attgctgcta cgtccaaacc gtgctacatg 600

gacatgtgtg aaccggatga cgccaccttt gcgtacgaag catgcaacac agccaatgac 660

accgaggcct acatgtatgt cggcgaccgc cttgtcgcca cgattgcgcc tgacagttgt 720

gtgggtattc aggagcctgc gcaatgcagg cccaacgtcc cctttacaga ctggcgcagg 780

gagcacttca ccgacatcga caaggtcatc tacaacggct tcaagtgttt caccgtgtac 840

gaccacaaca ccctcaagcg ctttgggcaa atcaacaggc aagagatcag ccaaatgtgc 900

atgtttggta gcaacggcac atatgccaag cttaacttta aacatagctc ctctgaccta 960

acgccctgtc aggcgcctgt cagtatatca cagtgtcctg atatctatgg ctaa 1014

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atagtaatca attacggggt 20

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tgatgagttt ggacaaacca 20

<210> 4

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cagatccgct agcgctcgcc accatggaca acaccg 36

<210> 5

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gttgtccatg gtggcgagcg ctagcggatc tgacgg 36

<210> 6

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ggggtaccta gttattaata gtaatcaa 28

<210> 7

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gtgggcttgt actcggtcat agcgctagcg gatctgacgg 40

<210> 8

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ccgtcagatc cgctagcgct atgaccgagt acaagcccac 40

<210> 9

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

cggtgttgtc catggtggcg tcaggcaccg ggcttgcggg 40

<210> 10

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

cccgcaagcc cggtgcctga cgccaccatg gacaacaccg 40

<210> 11

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

cgggatccgc agtgaaaaaa atgcttta 28

<210> 12

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

aagcttctgg aacgcaagcg gcagta 26

<210> 13

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ggatcctcag acaggtgttt tgacca 26

<210> 14

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ggtacctaaa agtgttgccg gcgtct 26

<210> 15

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gaattcaaca gtatgtcaag ccgtgt 26

Claims

1. The ORF074 gene deletion recombinant virus vaccine for preventing the infectious spleen and kidney necrosis viruses of the mandarin fish is characterized in that the active component of the vaccine is an attenuated virus strain prepared after the infectious spleen and kidney necrosis viruses have deletion of ORF074 genes, and the ORF074 gene sequence is shown as SEQ ID NO: 1 is shown.

2. The ORF074 gene deletion recombinant virus vaccine with the screening marker for preventing the infectious spleen and kidney necrosis viruses of mandarin fish is characterized in that the active component of the vaccine is an attenuated virus strain prepared by inserting a first screening gene and a second screening gene into a gene deletion part through homologous recombination, wherein the ORF074 gene sequence is shown as SEQ ID NO: 1 is shown.

3. The ORF074 gene-deleted recombinant virus vaccine according to claim 1 or 2, further comprising a pharmaceutically acceptable diagnostic agent, carrier, excipient or diluent.

4. Use of the ORF074 gene-deleted recombinant virus vaccine as claimed in claim 1 or 2 for the preparation of an agent or medicament for the prevention of infectious spleen and kidney necrosis virus of mandarin fish.