CN112063634A

CN112063634A - Attenuated African swine fever virus strain with gene deletion and application thereof

Info

Publication number: CN112063634A
Application number: CN202010368676.1A
Authority: CN
Inventors: 郑海学; 李丹; 李攀; 齐晓兰; 茹毅; 张克山; 张敬; 冯涛; �田宏; 杨帆; 杨吉飞; 刘志杰; 郭建宏; 孙研; 殷宏; 党文; 刘湘涛
Original assignee: Lanzhou Veterinary Research Institute of CAAS
Current assignee: Lanzhou Veterinary Research Institute of CAAS
Priority date: 2020-05-01
Filing date: 2020-05-01
Publication date: 2020-12-11
Also published as: CN113025629A

Abstract

The invention belongs to the technical field of bioengineering, and particularly relates to an attenuated African swine fever virus strain with a natural immune suppression gene deletion and application thereof. The invention discovers that ASFV MGF-505-7R can inhibit the generation of interferon; the ASFV MGF-505-7R gene is deleted from the original African swine fever strain, so that an attenuated African swine fever virus strain with better safety is obtained, and theoretical basis and practical reference are provided for successfully preparing the African swine fever vaccine in the future. Furthermore, researchers may simultaneously knock-out ASFV MGF-505-7R and one or more virulence genes disclosed (e.g., CD 2)_VMGF360-12L, MGF360-13L, MGF360-14L, MGF360-505R and the like) to finally prepare safe and effective African swine feverVaccine candidate strains.

Description

Attenuated African swine fever virus strain with gene deletion and application thereof

Technical Field

The invention belongs to the technical field of bioengineering, and particularly relates to a gene-deleted attenuated African swine fever virus strain and application thereof.

Background

African Swine Fever (ASF) is an acute virulent infectious disease characterized by Fever of pigs and organ bleeding of the whole body of pigs caused by African Swine Fever Virus (ASFV), and the death rate of domestic pigs is as high as 100%. The disease first outbreaks in kenya 1921 and then is widely prevalent in domestic and wild pigs throughout africa. The 20 th century was introduced into europe in the 50 s, and the disease was cured for 40 years throughout europe. However, the disease was again introduced into grurgia from eastern africa in 2007, and then widely disseminated in eastern europe and introduced into elocusk, the far east russia, 2017. At the beginning of 8 months in 2019, a Hurongrong researcher reports the epidemic situation of the African swine in the first instance of China, and the disease spreads to 30 provinces and municipalities in China within a short time of one year, so that the disease continues to threaten the pig industry, wherein compared with 8 months in 2018, the yield of the domestic pig in 9 months in 2019 is reduced by 40%, the price of pork is doubled since 8 months in 2019, the yield is reduced by more than 40% in China, and the loss is serious.

Because no proper vaccine is available at present, once the epidemic situation of the African swine fever occurs, the African swine fever can be eradicated completely only by killing means according to the previous experience of prevention and control on the African swine fever. But this approach not only results in economic losses but also takes a long time. Therefore, vaccines are the most effective and economical means for preventing and controlling viral infections, and are important for the prevention and treatment of African swine fever.

The preparation of the vaccine for African swine fever is mainly carried out by two ways: firstly, directly inactivating original African swine fever viruses to obtain an inactivated vaccine; and secondly, knocking out virulence genes by adopting a gene deletion method to obtain the recombinant virus vaccine. The first method is the most common and direct method for preparing the virus vaccine, but the African swine fever virus is a double-stranded DNA virus, has an oversized genome, can encode 150-167 proteins and has a complex immune escape mechanism; and African swine fever is generally acted by a plurality of virulence genes. Therefore, the inactivated vaccine prepared by an inactivation mode has residues of various virulence genes, so that the toxicity effect of the inactivated vaccine is greater than the prevention effect, and the death of pigs is easily caused after the inactivated vaccine is inoculated. In order to obtain an african swine fever vaccine which has immunogenicity, can reduce toxicity and keep pigs alive, currently, attenuated vaccines are generally prepared by adopting a gene deletion mode, for example, chinese patent CN110551695A provides a four-gene deletion low virulent strain of african swine fever virus, which is a four-gene deletion low virulent strain of SY18 isolate of african swine fever virus, and functional proteins of the following genes are deleted: CD2v gene coding products and three polygene family genes (MGF360-12L, MGF360-13L, MGF360-14L) coding products, after the piglets are immunized for 28 days, the piglets are subjected to a challenge test by using ASFV original virus, and as a result, the immunized swinery is completely protected; chinese patent CN110093324B also discloses a gene-II African swine fever virus MG F360-505R deletion and CD2V and MGF360-505R combined deletion gene deletion virus, both strains can provide 100% immune protection for African swine fever Chinese epidemic virulent strains, and the two strains can provide sufficient virulent attack protection 21 days after the immunization.

In summary, the impact on immune response and pathogenicity and safety performance are both considered for the knockout of the virulence genes of the hog cholera virus. However, the hog cholera virus virulence gene knockout vaccine in the prior art still has the following problems: the different strains have different effects caused by the deletion of the same gene, the immune side reaction caused by insufficient deletion and the over weakening caused by the deletion of multiple genes, the virus titer is low, and the risk of reducing the immunogenicity or the protective action of the attenuated strains and the like can also be caused; secondly, the knocked-out virulence genes are more, the operation is complex, the cost is high, whether the gene is knocked out successfully or not is a problem which needs to be considered, the more the knocked-out genes are, the lower the success rate of gene knockout is easily caused, and once the gene knockout is incomplete, the safety problem is caused; ③ the complete genome sequencing work of the African swine fever is completed, but the number of the regulatory genes and the structural genes which form the African swine fever virus is more than 150, although the comprehensive research on the functions of each regulatory gene and each structural gene is very important for the pathogenesis and the vaccine development, the engineering is larger, and the great investment of labor and financial resources is needed.

Therefore, in the preparation process of the attenuated vaccine of the African swine fever, the identification of the gene function is also important for the selection of the knockout gene, and the construction of the gene deletion recombinant virus is also a key step for preparing the attenuated vaccine. The invention firstly discovers that the A SFV MGF-505-7R can inhibit natural immunity and further inhibit the generation of interferon; in African swine fever original strainThe ASFV MGF-505-7R gene is deleted, so that an attenuated African swine fever virus strain with better safety is obtained, and theoretical basis and practical reference are provided for successfully preparing the African swine fever vaccine in the future. Furthermore, researchers may simultaneously knock-out ASFV M GF-505-7R and one or more virulence genes disclosed (e.g., CD 2)_VMGF360-12L, MGF360-13L, MG F360-14L, MGF360-505R and the like) to finally prepare safe and effective candidate strains of the African swine fever vaccine.

Disclosure of Invention

Aiming at the technical problems, the invention aims to provide an ASFV MGF-505-7R gene, the nucleotide sequence of which is shown in SEQ ID NO. 1.

Another objective of the invention is to provide an application of reducing the immunosuppression and pathogenicity of a strain by deleting or mutating ASFV MGF-505-7R gene in African swine fever virus. The ASFV MGF-505-7R gene has the function of natural immunosuppression and can inhibit the production of interferon.

Another object of the present invention is to provide an application of an African swine fever attenuated virus strain prepared by deleting or mutating ASFV MGF-505-7R gene in African swine fever virus. The prepared African swine fever attenuated virus strain can be independently deleted or mutated in ASF V MGF-505-7R gene, or simultaneously deleted or mutated in ASFV MGF-505-7R gene and other virulence genes, such as CD2_VMGF360-12L, MGF360-13L, MGF360-14L or MGF 360-505R.

Another object of the present invention is to provide an application of an African swine fever attenuated virus strain prepared by deleting ASFV MGF-505-7R gene in African swine fever virus. The prepared African swine fever attenuated virus strain can be independently deleted of ASFV MGF-505-7R gene, or simultaneously deleted of ASFV MGF-505-7R gene and one or more other virulence genes, such as CD2_VMGF360-12L, MGF360-13L, MGF360-14L or MGF 360-505R.

The invention also aims to provide an application of the ASFV MGF-505-7R gene in preparing the African swine fever vaccine by deletion or mutation in the African swine fever virus. The prepared African swine fever vaccine can be independently deleted ASFV MGF-505-7R gene, ASFV MGF-505-7R gene and one or more other virulence genes, such as CD2_VMGF360-12L, MGF360-13L, MGF360-14L or MGF 360-505R.

The invention also aims to provide an application of the African swine fever vaccine prepared by deleting ASFV MGF-505-7R gene in African swine fever virus. The prepared African swine fever vaccine can be independently deleted of ASFV MGF-505-7R gene, and can also be simultaneously deleted of ASFV MGF-505-7R gene and one or more other virulence genes, such as CD2_VMGF360-12L, MGF360-13L, MGF360-14L or MGF 360-505R.

Preferably, the African swine fever virus is gene II African swine fever virus.

Preferably, the African swine fever virus is an African swine fever virus CN/GS/2018 isolate.

The invention also aims to provide a method for preparing the attenuated African swine fever virus strain, which is characterized in that the ASFV MGF-505-7R gene sequence of the original strain is deleted by genetic engineering means, and the ASFV MGF-505-7R gene sequence can be completely deleted or partially deleted; preferably, the nucleotide sequence of the ASFVMG GF-505-7R gene is shown in SEQ ID NO. 1.

Preferably, the deletion method of the ASFV MGF-505-7R gene sequence comprises the following steps:

(1) pX330 optimization; removing nuclear localization signals NLS at two ends of Cas9 enzyme of pX330 by a Clonexpress II one-step cloning method, and naming the NLS as pX330 delta N;

(2) designing targeting oligonucleotides MGF5057R-gRNA-LF and MGF5057R-gRNA-RF aiming at ASFV MGF-505-7R gene, inserting the oligonucleotides into a pX 330-delta N vector in a pairing way, and preparing positive clone plasmids pX330 delta N-7RL and pX330 delta N-7 RR; wherein the nucleotide sequence of MGF5057R-gRNA-LF is shown in SEQ ID NO.3, and the nucleotide sequence of MGF5057R-gRNA-RF is shown in SEQ ID NO. 4;

(3) designing upstream and downstream sequences of ASFV MGF-505-7R gene each 1.0kb as homologous recombination arms, and cloning into pUC19 vector to obtain ASFV MGF-505-7R recombination transfer vector;

(4) inserting eGFP screening expression box gene fragment p72-eGFP-SV40poly in the middle of gene sequences of the left arm and the right arm of an ASFV MGF-505-7R recombinant transfer vector to obtain a homologous recombinant transfer vector p7 RLR-eGFP;

(5) homologous recombination transfer vectors p7RLR-eGFP, pX 330. delta. N-7RL, pX 330. delta. N-7RR and

-Ma crophage DNA transfection reagent is thoroughly mixed, cotransfected to BMDM cells taken from 2-4 month old healthy SPF bama piglets, and directly infected with the original strain of african swine fever;

(6) virus strain screening: screening the recombinant virus strain by using a 7R-check-F/R primer pair to obtain an attenuated African swine fever virus strain MGF-delta 7R with a deleted ASFV MGF-505-7R gene sequence, wherein the nucleotide sequence of the 7R-check-F/R primer pair is shown in SEQ ID NO. 13-14.

Preferably, the original strain is African swine fever virus CN/GS/2018 isolate.

Preferably, the attenuated African swine fever virus strain MGF-delta 7R lacks the nucleotide at position 40695-42269 compared with the full-length sequence of the African swine fever virus CN/GS/2018 isolate, and the deleted nucleotide sequence is shown as SEQ ID NO. 2.

Another object of the present invention is to provide an attenuated African swine fever virus strain prepared according to the above method.

Another object of the present invention is to provide an African swine fever vaccine prepared according to the above method.

The invention also aims to provide an African swine fever vaccine with ASFV MGF-505-7R gene deletion or mutation.

Preferably, the African swine fever vaccine simultaneously deletes or mutates CD2 in addition to the ASFV MGF-505-7R gene_VMGF360-12L, MGF360-13L, MGF360-14L or MGF 360-505R.

The invention has the beneficial effects that: the invention reduces the immunosuppression and pathogenicity of African swine fever virus strain and promotes the generation of interferon by deleting ASFV MGF-505-7R gene; ② Hair washingAn attenuated African swine fever virus strain is obtained by only deleting ASFV MGF-505-7R gene; thirdly, the attenuated African swine fever virus strain has obviously weakened virulence and good safety performance, and provides theoretical basis and practical reference for successfully preparing the African swine fever vaccine in the future; the researchers can knock out ASFV MGF-505-7R and one or more disclosed virulence genes (such as CD 2)_VMG F360-12L, MGF360-13L, MGF360-14L, MGF360-505R and the like) to finally prepare the safe and effective African swine fever vaccine.

Drawings

FIG. 1 is a schematic diagram of an ASFV MGF-505-7R gene knockout strategy;

FIG. 2 is a fluorescent image of suspected recombinant virus infected cells after cotransfection and inoculation of CN/GS/2018 isolate and culture for 48 h;

FIG. 3 is a photograph of fluorescent images of single GFP positive cells inoculated with PAM cells in a 96-well plate for 72 h;

FIG. 4 is a graph showing the results of construction of attenuated African swine fever virus strain MGF-. DELTA.7R;

FIG. 5 is a graph showing the results of inhibition of cGAS-MITA by the ASFV MGF-505-7R gene to induce IFN-. beta.expression; wherein, the abscissa is different plasmids, Ev is an empty plasmid PCMV, con is a transfection IFN-beta reporter plasmid and an internal reference plasmid TK, the "-" indicates that no cGAS + MITA plasmid is contained, and the "+" indicates that the cGAS + MITA plasmid is contained; the ordinate represents the fluorescence intensity of the reporter gene;

FIG. 6 is a graph showing the lethal results of the ASFV MGF-505-7R gene-deleted virus strain MGF- Δ 7R challenge test, in which the abscissa is the time after challenge and the ordinate is the survival rate;

FIG. 7 is a comparison of the expression results of IFN-. beta.after cell infection with African swine fever virus CN/GS/2018 isolate and ASFV MGF-505-7R gene deletion virus strain MGF-. DELTA.7R, wherein the abscissa shows different virus strains, MOCK shows a PAM cell without virus strain infection, and ASFV shows an African swine fever virus CN/GS/2018 isolate; the ordinate is the relative expression level of IFN- β mRNA.

Detailed Description

In order to make the technical means, the creation characteristics, the achievement purposes and the effects of the invention easy to understand, the invention is further described with the specific embodiments. The scope of the invention is not limited to the examples described below.

Definition of

The term "gene deletion" refers to the phenomenon that a certain segment on a chromosome and a gene carried by the segment are lost together to cause mutation, and the attenuated African swine fever recombinant virus is obtained by deleting ASFV MGF-505-7R gene, so that the toxicity of an original strain is reduced, wherein the deleted gene sequence is the whole or partial nucleotide sequence of the ASFV MGF-505-7R gene.

The term "gene mutation" refers to a gene mutation, which means that the base pair composition or arrangement sequence of the gene is changed in structure, i.e., a new gene suddenly appears at a site, instead of the original gene, and the gene is called a mutant gene, and the gene mutation causes the expression of a progeny to suddenly appear with a new character which never exists. According to the invention, the attenuated African swine fever recombinant virus is obtained by deleting ASFV MGF-505-7R gene, and on the basis of reducing the toxicity of the original strain, the technical personnel in the field can also make the original performance of the ASFV MGF-505-7R gene disappear by mutating the ASFV MGF-505-7R gene, so that the construction of the African attenuated swine fever recombinant virus is realized.

The gene deletion method generally refers to gene knockout, and is an exogenous DNA introduction technology in which a DNA fragment containing a certain known sequence is subjected to homologous recombination with a gene having the same or similar sequence in a recipient cell genome, is integrated into the recipient cell genome, and is expressed. Methods of gene knockout generally include: homologous recombination technology, random insertion mutation technology and RNA interference technology;

wherein, the homologous recombination technique is also called gene targeting, which means that the recombination occurs between the homologous sequence on the exogenous DNA and the chromosome DNA of the receptor cell, and the homologous sequence is integrated to a predetermined position, thereby changing some genetic characteristics, and the recombination aims at knocking out a certain gene; random insertion mutation technology is that certain viruses, bacteria or other gene vectors capable of randomly inserting gene sequences are utilized to carry out random insertion mutation on a cell bank in a target cell genome, and then corresponding gene knockout cells are obtained by screening through corresponding markers; the RNA interference technology refers to a reverse genetics technology which leads to the expression silencing of a target gene by the target mRNA degradation specifically initiated by double-stranded RN A homologous with the target gene mRNA endogenous to an organism.

Although the ASFV MGF-505-7R gene is knocked out only by the homologous recombination technique, the ASFV MGF-505-7R gene can be knocked out by the random insertion mutation technique and the RNA interference technique.

The term "vaccine" refers to a biological agent capable of providing a protective response in an animal, wherein the vaccine has been delivered and is not capable of causing serious disease. The vaccines of the present invention are genetically engineered gene-deleted attenuated virus vaccines in which the deleted gene is ASFV MGF-505-7R, it being understood that the deleted gene may also include a virulence gene (e.g., CD 2)_VMGF360-12L, MGF360-13L, MGF360-14L, MGF360-505R, etc.);

mutations are understood as changes in the genetic information of the wild-type or unmodified ASFV MGF-505-7R gene in the original CN/GS/2018ASFV strain. It is understood that the recombinant mutant obtained by mutation of the ASFV MGF-505-7R gene may also be used as an attenuated virus vaccine.

The experiments described in the following examples obtain biosafety permits and african swine fever laboratory activity permits:

according to the related requirements of biosafety of a Lanzhou veterinary research institute of the Chinese agricultural academy of sciences, a biological safety 3-level laboratory (BSL-3) and related biological safety of African swine fever, the Lanzhou veterinary research institute biological safety committee, the laboratory animal ethics committee, the Chinese agricultural academy of sciences biological safety committee, the Lanzhou veterinary research institute experimental animal ethics committee and the Lanzhou veterinary research institute biological safety committee report step by step, the permission of developing highly pathogenic ASFV pathogens and animal research is obtained by the agricultural department, and the permission is recorded by the agricultural rural department and meets the requirements of national biological safety level.

Experimental cell, viral and plasmid sources described in the following examples:

primary Porcine Alveolar Macrophage (PAM) andprimary bone marrow macrophages (BMDM) were obtained from 2-4 month old healthy long white pigs, harvested cells aseptically, lysed with red blood cells (Biosharp), red blood cells were removed, centrifuged at low speed, the supernatant was discarded, and the cell pellet was resuspended in RPMI 1640 complete medium (Gibco) containing 10% FBS (PAN), placed at 37 ℃ and 5% CO₂Culturing in an incubator. BMDM cell culture was supplemented with additional 10ng/mL final concentration of recombinant porcine GM-CSF (purchased from R) in RPMI 1640 complete medium&D Systems Co.), at 37 ℃ and 5% C O₂Inducing in an incubator, washing once every 2-3 days, centrifuging the nonadherent cells, adding into a new cell dish again, changing the liquid for continuous induction, and freezing for 3-7 days or using. ASFV is amplified by PAM cells, and the virus content is titrated, and BMD M cells are used for plasmid transfection and virus recombination experiments.

The ASFV CN/GS/2018 isolate is a African swine fever regional laboratory isolate of Lanzhou veterinary research institute of Chinese academy of agricultural sciences, belongs to the gene II type, and has the virus titer of 5 multiplied by 10⁷TCID₅₀and/mL, which is the 4 th generation virus after PAM cell propagation, and is subpackaged and stored at-80 ℃ for later use.

The pX330 vector, the peGFP-N1 vector and the pUC19 vector were all purchased from Ribo Lai Biotech, Inc., Lanzhou; endotoxin-free plasmid extraction kit, purchased from OMEGA.

HEK293 cells, purchased from ATCC company; ELISA kit (SEKP-0046) purchased from Solebao corporation; lipo fectamine TM 2000, available from Invitrogen; HT-DNA, purchased from Sigma.

Other materials in the experiment are not specified to be commercial products, and other operations are known in the art if not specified.

Example 1 construction and purification identification of recombinant Virus MGF-. DELTA.7R

CRISPR/Cas9 vector construction

(1) pX330 vector optimization: since the african swine fever virus is mainly replicated in a cytoplasmic virus factory, when constructing the p CRISPR/Cas9 vector, pX330 is optimized first; the Nuclear Localization Signal (NLS) at both ends of the Ca s9 enzyme was removed by the Clonexpress II one-step cloning method and named as pX 330. delta.N.

(2) Designing targeting gRNAs aiming at ASFV MGF-505-7R gene, wherein the oligonucleotide names and sequences are respectively: MGF 5057R-gRNA-LF: AAAATCACTTGGAAGGAAGAAGG (shown in SEQ ID NO. 3) and MGF 5057R-gRNA-RF: CATGGCATACTCCAAAGCATAGG (shown in SEQ ID NO. 4).

(3) Referring to the cloning methods recommended in the literature (Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. genome engineering using the CRISPR-Cas9system. NatProtoc.2013; 8(11):2281-2308), oligonucleotides MGF5057R-gRNA-LF and MGF5057R-gRNA-RF were inserted into pX 330-. DELTA.N vector, plasmid DNAs were extracted, and after correct sequencing, positive clones were named: pX 330. DELTA.N-7 RL and pX 330. DELTA.N-7 RR. Extracting DNA with endotoxin-free plasmid extraction kit, measuring concentration, and storing at-20 deg.C.

2. Screening expression cassette construction

In order to facilitate screening, a set of expression cassettes for screening marker genes are constructed, namely an enhanced Green fluorescent protein (eGFP) gene screening expression cassette is constructed:

reference is made to the literature (O' Donnell V, Holinka LG, Krug PW, Gladue DP, Carlson J, Sanford B, Alfa no M, Kramer E, Lu Z, Arzt J, Reese B, Carrilo C, Risatti GR, BorcaMV. African Swine Virus Georgia 2007with a Deletion of video-Associated Gene 9GL (B119L), we n added modified Low gases, Leads to videos extension in Swine and industries effect detection acquisition of video from Homologous Change JV. 2015; 89(16):8556-66), amplification of the p72 promoter (from p72 Gene upstream-196 to +17, previous sequence; the amplification primers are as follows: a forward primer 5'-TT ATAAAACATATGTTCATAAAAAGGGTCGCCGGAGGAAAAGTC-3' (shown as SEQ ID NO. 5) and a reverse primer 5'-CTCCTCGCCCTTGCTCACCATATATAATGTTATAAAAATAATT-3' (shown as SEQ ID number 56); and (3) amplifying the eGFP gene by using a peGFP-N1 vector as a template for later use, wherein amplification primers are as follows: a forward primer 5'-AT GGTGAGCAAGGGCGAGGAG-3' (shown in SEQ ID NO. 7) and a reverse primer 5'-ACCACAACTAGAA TGCAGTG-3' (shown in SEQ ID NO. 8);

according to the literature (Borca MV, Holinka LG, Berggren KA, Gladeu DP. CRISPR-Cas9, a tool to effect amplification of the expression of recombinant African swine viruses rep.2018; 8(1):3154.), the two genes of the p72 promoter and the eGFP obtained by the amplification of the steps are connected by a fusion PCR method to obtain an eGFP screening expression cassette gene fragment which is named as p72-eGFP-SV40polyA and contains an SV40p olyA termination sequence.

3. Construction of homologous recombination transfer vector

A pUC19 vector is used as a framework vector to construct an ASFV MGF-505-7R gene knockout homologous recombination transfer vector, the ASFV MGF-505-7R gene is a nucleotide sequence (shown in SEQ ID NO. 1) of a full gene sequence 40686-42269 of an African swine fever virus CN/GS/2018 isolate, the knocked-out ASFV MGF-505-7R gene sequence is a nucleotide sequence (shown in SEQ ID NO. 2) of a full gene sequence 40695-42269 of an African swine fever virus CN/GS/2018 isolate, and the construction strategy is shown in figure 1.

The method comprises the following specific steps: designing upstream and downstream sequences of ASFV MGF-505-7R gene each with 1.0kb as a homologous recombination left arm (Lef t arm) and a Right arm (Right arm), and cloning into pUC19 vector respectively to obtain a recombinant transfer vector of ASFV MGF-505-7R; inserting eGFP screening expression box gene fragment p72-eGFP-SV40poly in the middle of gene sequences of the left arm and the right arm of a recombinant transfer vector of ASFV MGF-505-7R; after the sequencing is correct, the homologous recombination transfer vector is named as p7RLR-e GFP; extracting DNA with endotoxin-free plasmid extraction kit, measuring concentration, and storing at-20 deg.C.

4. Cell transfection and recombinant virus screening

Homologous recombinant transfer vectors p7RLR-eGFP (2. mu.g), pX 330. delta. N-7RL (1. mu.g), pX 330. delta. N-7RR (1. mu.g) and 12. mu.L

Macrophage DNA transfection reagents were mixed well and co-transfected into porcine BMDM cells (cell number approximately 10)⁶One/well), after 6h of transfection, the African swine fever virus CN/GS/2018 isolate is directly infected (according to 1MOI infection amount), liquid is not changed until 48h of infection, and the number of fluorescent cells is observed under a fluorescent microscope. The results are shown in FIG. 2, A, under a fluorescence microscopeSporadic fluorescence is visible, i.e., cells considered to be suspected of recombinant virus infection; and (3) selecting all the fluorescent cells in the single hole by contrast of visible light (as shown in figure 2B), blowing the fluorescent cells in a new culture dish with a small center, settling for 1h, selecting the single fluorescent cell, collecting, repeatedly freezing and thawing for 3 times, inoculating the fluorescent cell into a pre-paved 96-well plate PAM cell, observing every 12h, observing the cell hole with fluorescence, marking, and continuously observing for 72 h. The results are shown in FIG. 3, the proportion of the number of fluorescent cells in a part of wells can reach 100%, and the wells are all positive wells, which indicates that the recombinant virus construction is basically successful.

And (3) carrying out limited dilution and expansion culture on the full-positive hole for 6 times, selecting an 8 th generation recombinant virus hole to digest into a single cell, carefully sucking 10 fluorescent cells, respectively inoculating the fluorescent cells into PAM (polyacrylamide) cells of a 96-well plate paved in advance, and continuously growing for 72 hours. Selecting two-hole cells with more G FP fluorescent cells, extracting genome DNA, carrying out PCR identification by using a p72-eGFP fixed-point integration detection primer pair of a 7R gene, and detecting whether a p72-eGFP-SV40pA original is integrated to a 7R gene locus; meanwhile, the purity of the probe is identified by PCR by using a 7R-check-F/R primer pair, wherein the p72-eGFP fixed point integration detection primer pair comprises: detection primer pair ASFV-7R-LA-R inserted into the left homologous arm: TGATTGGATAGGCCAAAATCTGCC (SEQ ID NO. 9) and ASFV-recomb-LA-F: ATGGCGGTTTATGCGAAGGATCTT (shown in SEQ ID NO. 10); and (3) detecting primer pairs ASFV-recomb-RA-R inserted into the right homologous arms: TGCTTTAAAAAACCTCCCACACCT (SE Q ID NO. 11) and ASFV-7R-RA-F: ACAGCATGGAGTATCAGCTTTTCA (shown in SEQ ID number 12). The 7R-check-F/R primer pair for purity detection is as follows: MGF-505-7R-check-F: TTTGGGAAAATC CCGCGGAAAGAA (shown in SEQ ID NO. 13) and MGF-505-7R-check-R: TCCTGTAGGGAGAA CATTTTCTCT (shown in SEQ ID NO. 14).

The experimental results are shown in FIG. 4, wherein A is a result diagram of cross-homology arm PCR detection of whether p72-eGFP in two strains of Δ MGF505-7R recombinant viruses is correctly inserted into a 7R gene target, wt is African swine fever virus CN/GS/2018 isolate, 1, 2 and 3 represent Δ MGF505-7R recombinant viruses, and the results show that the recombinant viruses are obtained after the two single cells are inoculated with cells, and the p72-eGFP-SV40pA original element is correctly inserted into the 7R gene target; b is a result diagram for detecting whether the two recombinant viruses have African swine fever virus CN/GS/2018 isolates through primers arranged in endogenous 7R genes, wherein wt is the African swine fever virus CN/GS/2018 isolate, 1, 2 and 3 represent the recombinant viruses of the delta MGF505-7R, and the results show that the genes of ASFV MGF-505-7R cannot be detected in the genomes of the recombinant viruses of the two holes, which indicates that the genes of the ASFV MGF-505-7R are knocked out successfully; the above results indicate that the two recombinant viruses have been successfully recombined and purified. The recombinant virus was designated MGF-. DELTA.7R.

Example 2 ASFV MGF-505-7R immunosuppression assay

The HEK293 cells in good state are digested with pancreatin and then spread on a 48-well plate, and the plate is placed at 37 ℃ and 5% CO₂Culturing for 12h in a cell incubator, performing Lipofectamine TM 2000 transfection when the cell density is about 70-80%, synchronously transfecting 100ng of IFN-beta reporter plasmid, 10ng of internal reference plasmid TK and 100ng of MGF-505-7R plasmid (inserting ASFV MGF-505-7R gene into PCMV plasmid to obtain PCMV-MGF-505-7R plasmid) and cGAS + MITA plasmid into HEK293 cells, and transfecting for 12 h. Three parallel holes are arranged in the experiment to ensure the reliability of the experimental result. And adding 50 mu L of 1 XPassive lysine buffer into each hole for cracking for 15-20min at room temperature, and detecting the activity of the dual-luciferase reporter gene after full cracking. The results are shown in FIG. 5, wherein the abscissa shows the different plasmids, Ev the empty plasmid PCMV, con the IFN-. beta.reporter plasmid and the internal reference plasmid TK only were transfected, "-" shows that no cGAS + MITA plasmid is contained, and "+" shows that the cGAS + MITA plasmid is contained; the ordinate represents the fluorescence intensity. Experimental results show that the ASFV MGF-505-7R gene can obviously inhibit the activity of IFN-beta induced by cGAS + MI TA and has an immunosuppressive effect.

Example 3 titration of viral Titers

Titration of African swine fever virus employed half the amount of blood cells adsorbed (50% haemadsorption, HAD)₅₀) The method operates. Reference is made to the literature (Borca MV, Ramirez-Medina E, Silva E, Vuono E, Rai A, Pruitt S, Holinka LG, Velazquez-Salinas L, Zhu J, Gladue DP. development of a high yield active area vitamin b deletion of the I177L gene residues in stereo immunity acquisition of the current epidemic European strain JVirol.2020Pii JVI.02017-19) for HAD₅₀Test operation, and appropriate adjustments: primary PBMC (mask, D.W., W.J.Penhale, and J.D.Sedgw ick,1987: Preparation of Lymphocytes sub-requirements. in: Klaus, G.G.B.) (ed.) Lymphocytes: a Practical application, pp.35-54.IRL Press, Oxford.) were inoculated into 96-well cell culture plates, the samples to be tested were subjected to 10-fold gradient dilution, 0.02ml was inoculated per well, viral infection was judged based on rosette formed by aggregation of red blood cells around infected cells, observed for 7 days, and the amount of adsorbed HAD was calculated based on the Reed Muench.Muench method (Reed, L.and H.Muench, A simple method of experiment of blood cells₅₀) And determining the titer to be qualified, and evaluating the pathogenicity.

Example 4 evaluation of virulence of ASFV MGF-505-7R Gene-deleted Strain MGF-Delta 7R

In order to detect the toxicity of ASFV MGF-505-7R gene deletion attenuated African swine fever virus strain MGF-delta 7R, 10HAD is used in the experiment₅₀The dose was evaluated for virulence by intramuscular injection in piglets. In the experiment, 10 healthy long and white piglets which are negative to the African swine fever antigen antibody are divided into 2 groups, and five piglets in each group respectively attack the African swine fever virus CN/GS/2018 isolate and the ASFV M GF-505-7R gene deletion attenuated African swine fever virus strain MGF-delta 7R.

The experimental result shows that the African swine fever virus CN/GS/2018 isolate is injected with 10HAD through muscle₅₀Then typical symptoms of ASFV appear, fever at high temperature, death is totally caused in the later period, while ASFV MGF-505-7R gene deletion attenuated African swine fever virus strain MGF-delta 7R is injected into 10HAD through muscle₅₀Thereafter, there was no death, and the survival rate was 100%, and the results are shown in FIG. 6.

Example 5 immunosuppressive experiment of ASFV MGF-505-7R Gene-deleted Strain MGF-Delta 7R

In order to evaluate the immunosuppressive activity of the ASFV MGF-505-7R gene deletion attenuated African swine fever virus strain MGF-delta 7R, the PAM cells were infected with the African swine fever virus CN/GS/2018 isolate and the ASFV MGF-505-7R gene deletion attenuated African swine fever virus strain MGF-delta 7R, respectively, and the results are shown in FIG. 7, wherein the abscissa represents different strains, MOCK represents a PAM cell without virus strain infection, ASFV represents a PAM cell infected with the African swine fever virus CN/GS/2018 isolate, and MGF-505-7R represents a PA M cell infected with the ASFV MGF-505-7R gene deletion attenuated African swine fever virus strain MGF-delta 7R; the ordinate is the relative expression level of IFN- β mRNA. The experimental result shows that compared with MOCK, the expression level of IFN-beta after the African swine fever virus CN/GS/2018 isolate infects PAM cells is obviously reduced, and the immunosuppression effect is obvious; compared with ASFV, the ASFV MGF-505-7R gene deletion strain MGF-delta 7R has higher expression quantity of IFN-beta after infecting PAM cells, and the immunosuppression effect is reduced.

In conclusion, researchers can simultaneously knock out ASFV MGF-505-7R and one or more virulence genes disclosed (e.g. CD 2)_VMGF360-12L, MGF360-13L, MGF360-14L, MGF360-505R and the like) to finally prepare the safe and effective African swine fever vaccine.

Sequence listing

<110> Lanzhou veterinary research institute of Chinese academy of agricultural sciences

<120> attenuated African swine fever virus strain with gene deletion and application

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1584

<212> DNA

<213> African swine fever virus (African swine fever virus)

<400> 1

atgttctccc ttcaggacct ctgtcggaag aacaccttct tccttccaag tgattttagc 60

aagcataccc tgcatttgct ggggttatac tggaaggggc atggatctat ccaaaggata 120

aagaatgatg gtgtgcttat agagcatgat cttactcttt ccatcaatga agccttaatt 180

cttgcaggag aagagggaaa caatgaagta gtaaagctct tgttactatg ggaaggaaat 240

cttcattatg ccatcatagg agctttgagg actgagaact ataacctagt atgtgagtac 300

catagtcaaa ttcaggactg gcatgttctc ctccctttga ttcaagatcc agaaacattc 360

gaaaaatgtc atgatttaag ccttgaatgt gatctttcat gccttctcca acatgctgta 420

aaatataaca tgctttcgat tcttgttaaa tataaagagg atctactaaa tgtactattt 480

aggcaacaaa ttcaaggact atttatttta gcatgtgaaa atcggaagct tgagattctt 540

acgtggatgg gtcaaaatct gccaattcct gatcctgagc ctatttttag cattgctgtt 600

gtcacaaaag atttagaaat gttttcctta gggtacaaga ttgtttttga atacatggaa 660

aaccaaggac ttcatttaac ccaggtagtt cgtatggtta tgctaaatca tcactttggc 720

atggtaataa ataaaggact tttacccttt gtgctggaaa ttttaaatta tggtgggaat 780

gtaaatagag ccttatctta tgctgtcaca caaaataaaa gaaagatttt agaccatgtt 840

gttcgccaaa agaatatacc ccataaaacc attgaaagaa tgttgcatct ggctgtaaaa 900

aagcatgctc ccaggaaaac tctgaacttg ttactatctt acataaatta caaggtgaaa 960

aatgttaaaa agttgttaga acatgtagtg aaatacaact ctactcttgt gataagactc 1020

ttgttagaaa aaaagaaaaa cctgctggat gctactttga caagatatgt caaagattct 1080

acatactttc aggtgaaaga atttatgcaa gacttctcca tcagcccaga aaaattcatt 1140

aaaatagctg tgcgggaaaa gagaaatgtg ttgatcaagg gtatttctga agatatttgg 1200

gaaaatcccg cggaaagaat caggaatctt aagcagatag tgtgtaccat aaaatatgaa 1260

agtggaagac aattcctgat aaatatcatt cacaccattt accagagtta ttctttgaaa 1320

cctgaagaaa ttcttaaatt ggcaacattt tatgtcaaac acaatgcaac cacccatttt 1380

aaagatctct gcaaatatct ttggctgaac agaagaacag aaagtaagaa actgttttta 1440

gagtgcttgg aaattgctga taagaaggag tttcctgata ttaaaagtat tgtgagtgaa 1500

tacattaact atttgtttac tgcaggagct attaccaagg aagaaatcat gcaagcctat 1560

gctttggagt atgccatgta ttaa 1584

<210> 2

<211> 1575

<212> DNA

<213> African swine fever virus (African swine fever virus)

<400> 2

cttcaggacc tctgtcggaa gaacaccttc ttccttccaa gtgattttag caagcatacc 60

ctgcatttgc tggggttata ctggaagggg catggatcta tccaaaggat aaagaatgat 120

ggtgtgctta tagagcatga tcttactctt tccatcaatg aagccttaat tcttgcagga 180

gaagagggaa acaatgaagt agtaaagctc ttgttactat gggaaggaaa tcttcattat 240

gccatcatag gagctttgag gactgagaac tataacctag tatgtgagta ccatagtcaa 300

attcaggact ggcatgttct cctccctttg attcaagatc cagaaacatt cgaaaaatgt 360

catgatttaa gccttgaatg tgatctttca tgccttctcc aacatgctgt aaaatataac 420

atgctttcga ttcttgttaa atataaagag gatctactaa atgtactatt taggcaacaa 480

attcaaggac tatttatttt agcatgtgaa aatcggaagc ttgagattct tacgtggatg 540

ggtcaaaatc tgccaattcc tgatcctgag cctattttta gcattgctgt tgtcacaaaa 600

gatttagaaa tgttttcctt agggtacaag attgtttttg aatacatgga aaaccaagga 660

cttcatttaa cccaggtagt tcgtatggtt atgctaaatc atcactttgg catggtaata 720

aataaaggac ttttaccctt tgtgctggaa attttaaatt atggtgggaa tgtaaataga 780

gccttatctt atgctgtcac acaaaataaa agaaagattt tagaccatgt tgttcgccaa 840

aagaatatac cccataaaac cattgaaaga atgttgcatc tggctgtaaa aaagcatgct 900

cccaggaaaa ctctgaactt gttactatct tacataaatt acaaggtgaa aaatgttaaa 960

aagttgttag aacatgtagt gaaatacaac tctactcttg tgataagact cttgttagaa 1020

aaaaagaaaa acctgctgga tgctactttg acaagatatg tcaaagattc tacatacttt 1080

caggtgaaag aatttatgca agacttctcc atcagcccag aaaaattcat taaaatagct 1140

gtgcgggaaa agagaaatgt gttgatcaag ggtatttctg aagatatttg ggaaaatccc 1200

gcggaaagaa tcaggaatct taagcagata gtgtgtacca taaaatatga aagtggaaga 1260

caattcctga taaatatcat tcacaccatt taccagagtt attctttgaa acctgaagaa 1320

attcttaaat tggcaacatt ttatgtcaaa cacaatgcaa ccacccattt taaagatctc 1380

tgcaaatatc tttggctgaa cagaagaaca gaaagtaaga aactgttttt agagtgcttg 1440

gaaattgctg ataagaagga gtttcctgat attaaaagta ttgtgagtga atacattaac 1500

tatttgttta ctgcaggagc tattaccaag gaagaaatca tgcaagccta tgctttggag 1560

tatgccatgt attaa 1575

<210> 3

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aaaatcactt ggaaggaaga agg 23

<210> 4

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

catggcatac tccaaagcat agg 23

<210> 5

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ttataaaaca tatgttcata aaaagggtcg ccggaggaaa agtc 44

<210> 6

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ctcctcgccc ttgctcacca tatataatgt tataaaaata att 43

<210> 7

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atggtgagca agggcgagga g 21

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

accacaacta gaatgcagtg 20

<210> 9

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tgattggata ggccaaaatc tgcc 24

<210> 10

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

atggcggttt atgcgaagga tctt 24

<210> 11

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tgctttaaaa aacctcccac acct 24

<210> 12

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

acagcatgga gtatcagctt ttca 24

<210> 13

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

tttgggaaaa tcccgcggaa agaa 24

<210> 14

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

tcctgtaggg agaacatttt ctct 24

Claims

1. An ASFV MGF-505-7R gene, which is characterized in that the nucleotide sequence of the ASFV MGF-505-7R gene is shown in SEQ ID NO. 1.

2. Use of the ASFV MGF-505-7R gene according to claim 1 for reducing the immunosuppressive and pathogenic properties of an african swine fever virus strain by deletion or mutation in an african swine fever virus.

3. Use of an African swine fever virus strain prepared by deletion or mutation of the ASFV MGF-505-7R gene according to claim 1 in an African swine fever virus.

4. Use of an African swine fever virus strain prepared by deleting the ASFV MGF-505-7R gene as described in claim 1 in an African swine fever virus.

5. Use of the ASFV MGF-505-7R gene according to claim 1 for the preparation of an African swine fever vaccine by deletion or mutation in an African swine fever virus.

6. Use of the ASFV MGF-505-7R gene according to claim 1 for the preparation of an African swine fever vaccine by deletion in an African swine fever virus.

7. The use according to any one of claims 2 to 6, wherein the African swine fever virus is genotype II African swine fever virus.

8. The use according to any one of claims 2 to 6, wherein the African swine fever virus is the African swine fever virus CN/GS/2018 isolate.

9. A method for preparing an attenuated African swine fever virus strain is characterized in that the method deletes ASFV MGF-505-7R gene sequence of an original African swine fever virus strain by a genetic engineering means, wherein the nucleotide sequence of the ASFV MGF-505-7R gene is shown in SEQ ID NO. 1.

10. The method according to claim 9, wherein the deletion method of the ASFV MGF-505-7R gene sequence comprises the steps of:

(2) designing targeting oligonucleotides MGF5057R-gRNA-LF and MGF5057R-gRNA-RF aiming at ASFV MGF-505-7R gene, inserting the oligonucleotides into a pX 330-delta N vector in a pairing way, and preparing positive clone plasmids pX330 delta N-7RL and pX330 delta N-7 RR; wherein the nucleotide sequence of the MGF5057R-gRNA-LF is shown in SEQ ID NO.3, and the nucleotide sequence of the MGF5057R-gRNA-RF is shown in SEQ ID NO. 4;

-the Macroph age DNA transfection reagent is fully mixed, cotransfected to BMDM cells taken from healthy SPF Bama miniature pigs of 2-4 months old, and then directly infected with the African swine fever original strain;

11. The method of any one of claims 9 to 10, wherein the original strain of african swine fever is the CN/GS/2018 isolate of african swine fever virus.

12. The method of claim 11, wherein the attenuated african swine fever virus strain MGF- Δ 7R lacks the nucleotide sequence 40695-42269 as compared to the full-length sequence of the african swine fever virus CN/GS/2018 isolate, and the deleted nucleotide sequence is shown in SEQ ID No. 2.

13. An attenuated african swine fever virus strain produced by the method according to any one of claims 9 to 10.

14. An african swine fever vaccine prepared according to the method of any one of claims 9-10.

15. An African swine fever vaccine with ASFV MGF-505-7R gene deletion or mutation.

16. The African swine fever vaccine of claim 15, further comprising CD2_VMGF360-12L, MGF360-13L, MGF360-14L or MGF 360-505R.