CN108728490B

CN108728490B - Baculovirus vector-based carp herpesvirus II type DNA vaccine and construction method and application thereof

Info

Publication number: CN108728490B
Application number: CN201810534457.9A
Authority: CN
Inventors: 贡成良; 曹广力; 李坤; 刘波; 胡小龙; 薛仁宇
Original assignee: Suzhou University
Current assignee: Nantong Jiuying Biotechnology Co.,Ltd.
Priority date: 2018-05-29
Filing date: 2018-05-29
Publication date: 2021-03-26
Anticipated expiration: 2038-05-29
Also published as: CN108728490A

Abstract

The invention relates to a baculovirus vector-based cyprinid herpesvirus II type DNA vaccine and a construction method and application thereof. Optimizing codons of 1-186, 993-1197, 603-783 and 85-186 nt region sequences of cyprinid herpesvirus II type ORF72, ORF66, ORF81 and ORF82, chemically synthesizing ORF72-ORF66-ORF81-ORF82 fusion sequence, and cloning into baculovirus transfer vector pFSATBac under the control of promoter^TMDual construction recombinant plasmid pFSATBac^TMThe plasmid is converted into DH10/Bac competent cells to obtain Bacmid-FA-D4ORF, and Bacmid-FA-D4ORF DNA is transfected into cultivated silkworm cells to obtain BmNPV-FA-D4ORF, namely the rhabdovirus II type DNA vaccine based on the baculovirus vector. The DNA vaccine can be used for immunizing carassius auratus gibelio by injection or oral administration or soaking, and reducing gill hemorrhage of carassius auratus gibelio.

Description

Baculovirus vector-based carp herpesvirus II type DNA vaccine and construction method and application thereof

Technical Field

The invention relates to the technical field of virus genetic engineering, in particular to a method for preparing a carp herpesvirus II type DNA vaccine based on a baculovirus vector and application thereof.

Background

Herpesvirus II (Cyprinid herpesvirus II, CyHV-2) infection of carp can cause outbreak of gill hemorrhage of carassius auratus gibelio, thereby causing serious economic loss. At present, the prevention and control of the disease are mainly controlled from the aspects of detecting seedlings, enhancing immunity, reducing stress, reducing culture density, removing diseased fish and the like, but the prevention and control effect is limited. Immunoprophylaxis is the most direct and effective method for preventing and treating viral diseases. At present, the common vaccines are mainly: inactivated vaccines (killed vaccines), attenuated vaccines, subunit vaccines, DNA vaccines, and protein subunit/DNA combination vaccines. Different types of vaccines each have advantages and disadvantages, examples: the inactivated vaccine is relatively easy to prepare, but has poor immunogenicity, relatively unsatisfactory immune effect and poor immunity durability; the attenuated vaccine can overcome the defects of the inactivated vaccine, but has high production cost, potential risk of recovering pathogenicity and poor safety; the subunit vaccine has the advantages of strong antigenicity, long protection time, good safety, convenient preparation and transportation and the like, but the epitope is easy to lose, and the virus usually evades the immunity through mutation; the preparation of the DNA vaccine is relatively convenient, different antigen epitope combinations can be combined to prepare the combined vaccine according to requirements, the DNA vaccine is the development direction of a new generation of vaccine, but the challenge on how to deliver the DNA vaccine into cells efficiently is still faced.

Various methods of immunizing fish are available. The injection immunization is the most common immunization method, the method has good immunization effect, but the immunization workload is large, the fish body is easy to be injured and have stress reaction, and the requirement on the purity of the vaccine is also high; the oral immunization has small damage to the fish, simple and convenient method and easy operation, but the vaccine is easy to degrade in the digestive tract, so the immune protection effect is poor; the soaking immunization is mainly suitable for immunizing young seedlings, the required vaccine amount is large, and the immunization effect is relatively poor. Therefore, there is a need to find new vaccine vector systems.

Baculovirus has a narrow host range, is mainly infected by insects, and is safe to vertebrates. The baculovirus can efficiently transfer exogenous DNA to target cells, so that the cyprinid herpesvirus II combined DNA vaccine prepared by the baculovirus system can possibly overcome the defects of the existing vaccine, and the vaccine has good immune effect and convenient use.

Disclosure of Invention

The invention aims to provide a construction method of a cyprinid herpesvirus II type DNA vaccine based on a baculovirus vector; the DNA vector vaccine prepared by the baculovirus vector can deliver the DNA vaccine vector into cells with the help of baculovirus, and has convenient use and good immune effect; different antigen genomes can be conveniently combined together through splicing of DNA, and the prepared multi-subunit combined DNA vaccine can effectively prevent viruses from escaping immunity through mutation.

In order to achieve the purpose, the invention adopts the technical scheme that:

a construction method of cyprinid herpesvirus II type DNA vaccine based on baculovirus vector comprises the following steps:

(1) cloning the promoter into SmaI/Xho I site of pFASATBacDual to obtain pFASATBacDual-FA vector; the sequence of the promoter is shown as SEQ ID NO. 1;

(2) cloning the fusion DNA sequence into XhoI/KpnI site of pFASATBacDual-FA to obtain pFASATBacDual-FA-D4 ORF plasmid; the sequence of the fusion DNA is shown as SEQ ID NO. 2;

(3) transforming DH10/Bac competent cells by pFSATBacDual-FA-D4ORF plasmid, then coating the cells on an LB agar medium plate, culturing at 37 ℃, selecting white colonies, and extracting recombinant Bacmid-FA-D4ORF DNA;

(4) transfecting recombinant Bacmid-FA-D4ORF DNA into cultivated silkworm cells, culturing at 26-27 ℃ until the cells are attacked, and collecting cell culture supernatant to obtain recombinant virus BmNPV-FA-D4 ORF;

(5) inoculating recombinant virus BmNPV-FA-D4ORF to cultivated silkworm or cultivated silkworm cells, after the disease occurs, collecting cultivated silkworm hemolymph or cultivated silkworm cell supernatant, and centrifugally purifying to obtain virus particles which are the cyprinid herpesvirus II type DNA vaccine based on baculovirus vectors;

or

(6) Inoculating recombinant virus BmNPV-FA-D4ORF to silkworms, homogenizing the ill silkworms, freezing and drying to prepare freeze-dried powder which is the cyprinid herpesvirus II type DNA vaccine based on baculovirus vectors.

The invention also discloses a preparation method of the recombinant virus for the cyprinid herpesvirus II type DNA vaccine based on the baculovirus vector, which comprises the following steps:

(4) transfecting recombinant Bacmid-FA-D4ORF DNA into cultivated silkworm cells, culturing at 26-27 ℃ until the cells are attacked, and then collecting cell culture supernatant to obtain the baculovirus vector-based recombinant virus for the cyprinid herpesvirus II type DNA vaccine.

In the technical scheme, in the step (3), the LB agar culture medium comprises tetracycline, kanamycin, gentamicin, IPTG and X-gal with the contents of 10 mug/ml, 50 mug/ml, 7 mug/ml, 40 mug/ml and 100 mug/ml respectively.

In the technical scheme, in the step (4), the recombinant virus BmNPV-FA-D4ORF is transfected into cultivated silkworm cells again, the cultivated silkworm cells are cultivated at 26-27 ℃ until the cells are attacked, and then cell culture supernatant is collected to obtain secondary recombinant virus BmNPV-FA-D4 ORF; and (3) the secondary recombinant virus BmNPV-FA-D4ORF is used for inoculating the silkworm or the cultivated silkworm cells in the step (5) or inoculating the silkworm in the step (6).

In the technical scheme, the silkworms are larvae of 4-5 years old or pupae initially.

The invention also discloses a baculovirus vector-based carp herpesvirus II type DNA vaccine constructed according to the baculovirus vector-based carp herpesvirus II type DNA vaccine construction method; the recombinant virus for the cyprinid herpesvirus II type DNA vaccine based on the baculovirus vector is prepared according to the preparation method of the recombinant virus for the cyprinid herpesvirus II type DNA vaccine based on the baculovirus vector.

The invention also discloses an application of the baculovirus vector-based carp herpesvirus II type DNA vaccine in preparation of an allogynogenetic crucian carp gill hemorrhage immunoprophylaxis medicine.

The invention also discloses a fusion DNA, and the sequence of the fusion DNA is shown as SEQ ID NO. 2.

The invention also discloses an application of the recombinant virus for the cyprinid herpesvirus II type DNA vaccine based on the baculovirus vector or the fusion DNA in preparing the cyprinid herpesvirus II type DNA vaccine based on the baculovirus vector.

In the above technical scheme, the pFSATBACDual plasmid is a product of Invitrogen corporation in America, and belongs to Bac-to-Bac (bacterio to Baculovir) expression system vectors.

In the invention, the sequence SEQ ID NO 1 is:

CCCGGGCTCTTACAGGAAACGGGTCATTTAACTTCAGTTATCATGACTTCAATGAAAAATTACCCCTATTTTGCATAGAGAAGTACTTGGTAGATTCCTACACAGAAATATTATGGTATTATTGTGAATACAATAAAAGGTAAATGACCTACAGAGCTGCTGCTGTGTTAAATTGTAAACACAACACAGGACCAAGGAGGTGTCCACCACTACGACCAATACTGGCACTTGTAACCTTTCACAGACTTTTTAAAAGGTTGAAGAGTCTTATTGGTGCTATCGCAACTAAATACGTAATTACGAAACACAATGTATTAAAATTCGCAAATAACAGGGTAAAATTTGATCAAAATCACCGAGGCCTTGTTCTTCAACTAGTCTAGCTTCCCCTTCTTTCACTCTCAAGTTGCAAGAAAGCAAGTGTAGCAATGTGCACGCGACAGCTGGGTGTGTGACGCTGGACCAATCAGAGCGCAGAGCTCCGAAAGTTTACCTTTTATGGCTAGAGCCGGGCATATGCCGTCATATAAAAGAGCTCGCCCAGCCTTTCAACCTCACTTTGAGCTCCAATCTCGAG

the sequence SEQ ID NO 2 is: .

CTCGAGATGTACGGTCTGAACAACGCTCAGGGTTTCATCGATACCGAGTGGATCGACAGACAGTCAATCGCTATGACCGCTCAGGAAACAAGCAGACTGTTGAACCCGTACCTGGCTACAAAAGGTCAGAGAGTGGACCCTTCAAACCTGTACATCCCAGACGGTATCTTCGTGACATACACACCTACCGGTTCAAGACACCCTATGGTGGAATACGAACGCATCGAATCACAACTGGAACCAGACACAGGAGCTTCAAGCTTCGTGGACAAACTGGTGGAAAAGTCAGACCTGTCAGCTTGCTTGTCACACACAGACGGTACAATCGAACTGCCTTCATCTTGGGTGGACCCTAGAGCTAAACAGTTCCACGATCTGGACGACCTGATGATCTACGGTTCAGCAGATTACATGGACTCAGACGACGAAGATTACGATTCATACGCCGGAGCAGCAGAAACACTGCAAAGAAGCATGCGCGACTACGCTGACGAAGAAGATAGCGACATGGACGATAGCACATCACTGCTGAACAGCGTGAGAAAGATGAGCAGCAAGTTCAAGAGCACCGTGTACGAAGACGACCAAACACAGAGCAGCAACACAACAGCTACAAGCGACCGCTACAAGTACTACACAAGCAGAGGTACAATCCAACGCGCTAACAGACCGGGTTTG TAAGGTACC

In the technical scheme, the culture medium is obtained by adding tetracycline, kanamycin, gentamicin, X-gal and IPTG into an LB culture medium; the content of tetracycline, kanamycin, gentamicin, IPTG and X-gal on an LB agar plate is 10 mug/ml, 50 mug/ml, 7 mug/ml, 40 mug/ml and 100 mug/ml respectively, and the method is favorable for screening of recombinant Bacmid-FA-D4 ORF.

In the technical scheme, in the step (4), firstly, the recombinant virus BmNPV-FA-D4ORF infects cultivated silkworm cells again, the cultivated silkworm cells are cultivated at 26-27 ℃, and after the cells are diseased, cell culture supernatant is collected, so that high-titer second-generation recombinant virus BmNPV-FA-D4ORF is obtained, and the success rate and the morbidity of the recombinant virus for inoculating the silkworm larvae or silkworm pupae are improved; the second-generation recombinant virus BmNPV-FA-D4ORF is inoculated to cultivated silkworm or cultivated silkworm cells, the preferable scheme is that the inoculated silkworm is a larva of 4-5 years old or a primarily pupated silkworm, the cost can be saved, and the titer of the vector virus can be improved.

In the above technical scheme, in the step (5), the centrifugally purified virus particles may specifically be obtained by taking a supernatant of cultured silkworm cells infected with the disease, and performing repeated differential centrifugation at 1000 rpm and 20000 rpm; or taking hemolymph of infected and diseased silkworms, freezing and thawing for more than 3 times, and obtaining the hemolymph by repeated differential centrifugation at 1000 rpm and 20000 rpm.

In the technical scheme, in the step (6), the recombinant virus BmNPV-FA-D4ORF is inoculated on the silkworm, the silkworm can be a larva of 4-5 years old or a pupa initially, and the preferred scheme is pupa initially, so that the cost can be saved, and the freeze-drying is convenient. Before silkworm larvae after disease are freeze-dried, the midgut and contents can be removed, and the level of recombinant viruses in the freeze-dried powder is improved.

The fusion DNA sequence disclosed by the invention is shown as SEQ ID NO. 2. In order to prevent the escape of the carp herpes virus II from immunity through mutation, partial coding DNA sequences of ORF72, ORF66, ORF81 and ORF82 of the carp herpes virus II are spliced and fused by adopting the following strategy: DNA sequences of 1-186, 993-1197, 603-783 and 85-186 nt regions of cyprinid herpesvirus II type ORF72, ORF66, ORF81 and ORF82 are connected in series according to the order of ORF72, ORF66, ORF81 and ORF82, and the expressed protein has the characteristic of multi-subunit antigenic protein; in order to improve the expression level of the vaccine gene, the fusion vaccine gene is optimized by codon and then chemically synthesized. In the sequence SEQ ID NO. 2, the translated amino acid sequence of the 7-192nt region is identical with the translated amino acid sequence of the 1-186 region of the cyprinid herpesvirus II ORF 72; the amino acid sequence translated from the 193-396nt region is identical to the amino acid sequence translated from the 993-1197 region of the cyprinid herpesvirus II ORF 66; the translated amino acid sequence of the 397-576nt region is consistent with the translated amino acid sequence of the 603-783 region of the cyprinid herpesvirus II ORF 81; the amino acid sequence translated in the 577-region 678nt is identical to the amino acid sequence translated in the 85-186 region of cyprinid herpesvirus II ORF 82.

Further, the invention discloses an immunoprophylaxis medicine for crucian gibelio hemorrhagic disease, which comprises the recombinant virus BmNPV-FA-D4ORF, silkworm lyophilized powder infected by the recombinant virus BmNPV-FA-D4ORF and virus particles, namely a baculovirus vector-based cyprinid herpesvirus II type DNA vaccine.

Due to the application of the technical scheme, compared with the prior art, the invention has the following advantages:

1. the construction method of the cyprinid herpesvirus II type DNA vaccine based on the baculovirus vector disclosed by the invention is not reported; the DNA vaccine vector used by the invention, namely the baculovirus, is strictly limited to insects due to the natural host, is not pathogenic to vertebrates, can efficiently transfer exogenous DNA to vertebrate cells including fish, and has high biological safety.

2. According to the DNA vaccine based on the baculovirus vector, due to the fusion of the antigen genes of ORF72, ORF66, ORF81 and ORF82 of the cyprinid herpesvirus II, the protein expressed in cells has the characteristic of multi-subunit antigen protein, so that the cyprinid herpesvirus II can be effectively prevented from escaping immunity through mutation; and the level of the DNA vaccine vector expressing the antigen protein is further improved through codon optimization.

3. The invention uses baculovirus as vaccine carrier, can realize immunity through injection, oral administration, soaking and other modes, and increases the selection of immunity approaches.

Drawings

FIG. 1 is a diagram of cultured silkworm cells infected with BmNPV-FA-D4ORF, a recombinant virus according to the example;

FIG. 2 is the PCR detection of kidney tissue of the recombinant virus BmNPV-FA-D4ORF after intraperitoneal immunization injection of Carassius auratus gibelio for 1, 2 and 3 weeks in the example; wherein lane Marker, DNA standard molecular weight; lane N, healthy fish kidney tissue;

lanes

1W, 2W, and 3W, kidney tissue at 1, 2, and 3 weeks post intraperitoneal immunization of BmNPV-FA-D4ORF, respectively;

FIG. 3 is the PCR assay of spleen tissue after intraperitoneal immunization of crucian carp with

allogynogenetic

1, 2 and 3 weeks for the recombinant virus BmNPV-FA-D4ORF of the example; wherein lane Marker, DNA standard molecular weight; lane N, healthy fish spleen tissue;

lanes

1W, 2W, and 3W,

spleen

1, 2, and 3 weeks after intraperitoneal immunization with BmNPV-FA-D4ORF, respectively;

FIG. 4 is the reverse transcription RT-PCR detection of spleen tissue after intraperitoneal immunization of crucian carp with

allogynogenetic

1, 2 and 3 weeks on the basis of the recombinant virus BmNPV-FA-D4ORF of the example; lane 1, DNA standard molecular weight;

lanes

2, 3 and 4, reverse transcription RT-PCR of spleen tissue after intraperitoneal immunization of crucian carp with BmNPV-FA-D4ORF for 1, 2, 3 weeks;

FIG. 5 shows the qPCR detection result of tissue of carassius auratus gibelio soaked in recombinant virus BmNPV-FA-D4ORF in the fourth embodiment.

Detailed Description

The invention is further described with reference to the following figures and examples, in which some conventional methods are schematically shown:

example a construction method of a baculovirus vector-based cyprinid herpesvirus II DNA vaccine and an injection immunization effect thereof

(1) Synthesizing a promoter sequence (0.56 kb) as shown in SEQ ID NO. 1, cloning into a T-vector, performing sequencing verification, and naming a plasmid which is verified to be correct as pMD-beta-actin;

(2) by usingSmaI andXhoi enzyme digestion pMD-beta-actin plasmid, recovery of promoter fragment, cloning into pFSATBac of same enzyme digestion^TMIn Dual, obtain pFSATBac^TMDual-FA vector;

(3) synthesizing fusion DNA sequences of ORF72-ORF66-ORF81-ORF82 as shown in SEQ ID NO. 2, cloning the synthesized sequences into a T vector, performing sequencing verification, and naming the plasmid which is verified to be correct as pMD-D4 ORF;

(4) by usingXhoI andKpni enzyme digestion pMD-D4ORF plasmid, recovery ORF72-ORF66-ORF81-ORF82 fusion DNA fragment, clone into the same enzyme digestion pFSATBac^TMIn the Dual-FA vector, obtain pFSATBac^TMThe Dual-FA-D4ORF vector;

（5）pFSATBac^TMtransformation of DH10/Bac competent cells by Dual-FA-D4ORF, and coating on LB agar culture plates containing tetracycline (10 mu g/ml), kanamycin (50 mu g/ml), gentamicin (7 mu g/ml), IPTG (40 mu g/ml) and X-gal (100 mu g/ml); culturing at 37 ℃ for 48 hours, selecting a white colony for culturing, extracting recombinant Bacmid genomic DNA, carrying out PCR on the recombinant Bacmid by using an M13 forward primer (SEQ ID NO:3) and an M13 reverse primer (SEQ ID NO:4), and amplifying a target band consistent with a theoretical molecular weight (3.33kb) from the recombinant Bacmid DNA, thereby indicating that the recombinant Bacmid is correctly constructed as required and named Bacmid-FA-D4 ORF;

(6) Bacmid-FA-D4ORF DNA (2 μ g) is added into 48 μ L TC-100 medium (without fetal calf serum, GIBCO BRL company) and mixed evenly, another 5 μ L FuGENE HD transfection reagent (Roche company) is added into 45 μ L TC-100 medium (without fetal calf serum) and mixed evenly, the former is added into the latter dropwise, after mixing and standing for 30 minutes, added into 400 μ L TC-100 medium (without fetal calf serum) and mixed evenly, transfection is carried out for 10 μ L⁵Cultivated silkworm cells BmN. After 4 hours, the cell culture medium was removed, the cells were cultured at 27 ℃ for 3 days in TC-100 medium containing 10% fetal bovine serum, and the supernatant of the transfected cells was collected to obtain P1 generation recombinant virus BmNPV-FA-D4 ORF. 10 mu L of P1 virus was used to infect 10⁵And (3) culturing the BmN cells in a monolayer for 4-5 days, wherein the cell morphology is rounded, the cell nucleus is expanded, and the cells lose adherence, as shown in figure 1. Collecting the supernatant of the virus-infected cultured cells to obtain P2 generation recombinant virus BmNPV-FA-D4ORF, and storing at 4 ℃ in a dark place for later use;

(7) taking the P2 generation recombinant virus, and carrying out the following steps: inoculating cultivated silkworm cell at 100V/V,culturing at 27 deg.C for 4 days, after disease occurrence, collecting cell culture supernatant, centrifuging at 1000 rpm for 10 min, removing cell debris, centrifuging the supernatant at 20000 rpm for 60 min at 4 deg.C, discarding the supernatant, dissolving the precipitate with 0.01mol/L phosphate buffer solution, centrifuging at 1000 rpm for 10 min, centrifuging the supernatant at 20000 rpm for 60 min, dissolving the precipitate with 0.01mol/L phosphate buffer solution, and making into 10-phase suspension⁷Storing the virus mother liquor at-80 deg.C;

(8) using 100 mu L of virus mother liquor to inject allogynogenetic crucian carp (30-65 g/tail) into abdominal cavity, taking kidney tissue after injecting for 1-3 weeks, extracting genome DNA, using SEQ ID NO:5 sequence as forward primer and SEQ ID NO:6 sequence as reverse primer, PCR amplifying, specifically amplifying recombinant virus fragment (0.675 kb), as shown in figure 2, Lane Marker, DNA standard molecular weight; lane N, naive kidney tissue;

lanes

1W, 2W, 3W are

kidney tissues

1, 2, 3 weeks after injection immunization, respectively. Indicating that the BmNPV-FA-D4ORF has entered the kidney cells. Further taking blood of fish immunized for 1-4 weeks, detecting antibody level in the blood by ELISA method, and the result shows that the antibody level gradually rises, the antibody titer in the blood reaches 6400 at 3 weeks after injection, and starts to decline at 4 weeks;

(9) intraperitoneal injecting 30-65 g/tail of carassius auratus gibelio into 100 mu L of virus mother liquor, and culturing at 24 ℃ for 3 weeks; 1 g of crucian carp gill hemorrhage disease fish kidney tissue is added with 10mL of 0.01mol/L phosphate buffer solution for homogenate, centrifugation is carried out for 20 minutes at 3000 r/min, supernate (containing carp herpes virus II type) is taken out, allogynogenetic crucian carp which is inoculated and immunized for 3 weeks is injected, breeding is carried out at 24-DEG water temperature, the number of diseased fish 11 days before virus inoculation is counted, and the immune protection rate is calculated. The results show that the incidence rate of nonimmunized fish reaches 38.46%, the incidence rate of fish injected with wild silkworm baculovirus is 29.17%, the incidence rate of fish injected with immunity is 7.69%, and the relative immune protection rate is 80.01%, which indicates that the carassius auratus gibelio immunity injection recombinant virus can reduce the occurrence of carassius auratus gibelio hemorrhagic disease.

Example II construction method and vaccine Properties of Cyprinus Carpio herpesvirus II DNA vaccine based on baculovirus vector

(1) The same as the step (1) of the embodiment;

(2) the same step (2) as the example;

(3) the same step (3) as the example;

(4) the same step (4) as the example;

(5) the same step (5) as in the example;

(6) the same step (6) as in the example;

(7) dipping the P2 generation recombinant virus with insect needle, inoculating 5-year-old silkworm from internode membrane, normally raising at 25 deg.C, collecting silkworm hemolymph after 5 days of silkworm outbreak, and freeze thawing for more than 3 times alternately. Centrifugation was carried out at 1000 rpm for 10 minutes, and after removal of cell debris, centrifugation was carried out at 20000 rpm at 4 ℃ for 60 minutes. Discarding supernatant, dissolving precipitate with 0.01mol/L phosphate buffer solution, centrifuging at 1000 rpm/min for 10 min, centrifuging supernatant at 20000 rpm/min for 4 min, dissolving precipitate with 0.01mol/L phosphate buffer solution, and making into 10¹⁰Storing the virus mother liquor at-80 deg.C;

(8) intraperitoneal injection of carassius auratus gibelio (30-65 g/tail) is carried out by 100 mu L of virus mother solution in the step (7), after injection for 1-3 weeks, spleen tissues are taken, genome DNA is extracted, and PCR amplification is carried out by taking the sequence SEQ ID NO. 5 as a forward primer and the sequence SEQ ID NO. 6 as a reverse primer, so that ORF72-ORF66-ORF81-ORF82 fragments (0.675 kb) can be specifically amplified, as shown in figure 3, a lane Marker and DNA standard molecular weight; lane N, naive spleen tissue;

lanes

1W, 2W, 3W are

spleen tissues

1, 2, 3 weeks after injection immunization, respectively. Indicating that the BmNPV-FA-D4ORF has entered spleen cells. Further, after total RNA is extracted from spleen tissue and is reversely transcribed into cDNA, the sequence of SEQ ID NO. 5 is taken as a forward primer, the sequence of SEQ ID NO. 6 is taken as a reverse primer, and PCR amplification is carried out, so that ORF72-ORF66-ORF81-ORF82 fragments can be specifically amplified, as shown in figure 4, lane 1 and DNA standard molecular weight;

lanes

2, 3, and 4 are the amplification products from spleen tissue samples after 1, 2, and 3 weeks of injection immunization, respectively, indicating that the vaccine genes are expressed in the cells.

EXAMPLE III construction method of Cyprinus Carpio herpesvirus II type DNA vaccine based on baculovirus vector and oral immunization

(1) The same as the step (1) of the embodiment;

(2) the same step (2) as the example;

(3) the same step (3) as the example;

(4) the same step (4) as the example;

(5) the same step (5) as in the example;

(6) the same step (6) as in the example;

(7) dipping the P2 generation recombinant virus with insect needle, puncturing and inoculating the primary pupa from the internode membrane, protecting for 5 days at 25 ℃, collecting the pupa infected with the recombinant virus, adding 0.01mol/L phosphate buffer solution according to the proportion of 1:10(W/V), and homogenizing. Filtering the homogenate with 8 layers of gauze, freeze-drying the filtrate to obtain pupa Bombycis lyophilized powder with water content less than 7%. Storing the freeze-dried powder at a low temperature of 4 ℃;

(8) and (3) uniformly mixing the freeze-dried powder obtained in the step (7) with the carassius auratus gibelio feed according to a ratio of 1:100 (W/W), feeding the carassius auratus gibelio (30-65 g/tail) for 4 weeks, adding 10mL of 0.01mol/L phosphate buffer solution into 1 g of kidney tissue of carassius auratus gibelio hemorrhagic disease fish, homogenizing the mixture, centrifuging the mixture for 20 minutes at a speed of 3000 r/min, taking supernatant (containing carp herpesvirus II type II), injecting and inoculating the carassius auratus gibelio immunized for 3 weeks, breeding the carassius auratus gibelio at a temperature of 24 ℃, counting the number of diseased fish before 11 days of virus inoculation, and calculating. The results show that the protection rate of oral immunization reaches 60%.

Example four construction method and immersion immunization of cyprinid herpesvirus II type DNA vaccine based on baculovirus vector

(1) The same as the step (1) of the embodiment;

(2) the same step (2) as the example;

(3) the same step (3) as the example;

(4) the same step (4) as the example;

(5) the same step (5) as in the example;

(6) the same step (6) as in the example;

(7) dipping the P2 generation recombinant virus with insect needle, puncturing and inoculating the primary pupa from the internode membrane, protecting for 5 days at 25 ℃, collecting the pupa infected with the recombinant virus, and adding 5L water into 10 pupa to homogenize. Filtering the homogenate by 8 layers of gauze to obtain filtrate;

(8) soaking carassius auratus gibelio (30 g/tail) in the filtrate obtained in the step (7) for 5 hours, taking gills, spleens and blood, extracting genome RNA, carrying out reverse transcription to obtain cDNA, then calculating the relative expression abundance of the vaccine genes of each tissue by using a sequence SEQ ID NO. 7 as a forward primer and a sequence SEQ ID NO. 8 as a reverse primer and carrying out qPCR (quantitative polymerase chain reaction) (figure 5). The signals of the vaccine gene transcription can be detected from gill, spleen and blood, which indicates that the cyprinid herpesvirus II type DNA vaccine based on the baculovirus vector can enter fish tissues through soaking and express the vaccine gene.

In the present invention, the DNA sequence is:

SEQ ID NO:1

SEQ ID NO:2

SEQ ID NO:3：

CCCAGTCACGACGTTGTAAAACG

SEQ ID NO:4：

AGCGGATAACAATTTCACACAGG

SEQ ID NO:5

ACACTCGAGATGTACGGTCTGAACAACGCTC

SEQ ID NO:6

GCAGGTACCTTACAAACCCGGTCTGTTAGC

SEQ ID NO:7

ACTGCCTTCATCTTGGGTGG

SEQ ID NO:8

CGGCGTATGAATCGTAATCT

sequence listing

<110> Suzhou university

<120> baculovirus vector-based cyprinid herpesvirus II type DNA vaccine, and construction method and application thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 577

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cccgggctct tacaggaaac gggtcattta acttcagtta tcatgacttc aatgaaaaat 60

tacccctatt ttgcatagag aagtacttgg tagattccta cacagaaata ttatggtatt 120

attgtgaata caataaaagg taaatgacct acagagctgc tgctgtgtta aattgtaaac 180

acaacacagg accaaggagg tgtccaccac tacgaccaat actggcactt gtaacctttc 240

acagactttt taaaaggttg aagagtctta ttggtgctat cgcaactaaa tacgtaatta 300

cgaaacacaa tgtattaaaa ttcgcaaata acagggtaaa atttgatcaa aatcaccgag 360

gccttgttct tcaactagtc tagcttcccc ttctttcact ctcaagttgc aagaaagcaa 420

gtgtagcaat gtgcacgcga cagctgggtg tgtgacgctg gaccaatcag agcgcagagc 480

tccgaaagtt taccttttat ggctagagcc gggcatatgc cgtcatataa aagagctcgc 540

ccagcctttc aacctcactt tgagctccaa tctcgag 577

<210> 2

<211> 687

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ctcgagatgt acggtctgaa caacgctcag ggtttcatcg ataccgagtg gatcgacaga 60

cagtcaatcg ctatgaccgc tcaggaaaca agcagactgt tgaacccgta cctggctaca 120

aaaggtcaga gagtggaccc ttcaaacctg tacatcccag acggtatctt cgtgacatac 180

acacctaccg gttcaagaca ccctatggtg gaatacgaac gcatcgaatc acaactggaa 240

ccagacacag gagcttcaag cttcgtggac aaactggtgg aaaagtcaga cctgtcagct 300

tgcttgtcac acacagacgg tacaatcgaa ctgccttcat cttgggtgga ccctagagct 360

aaacagttcc acgatctgga cgacctgatg atctacggtt cagcagatta catggactca 420

gacgacgaag attacgattc atacgccgga gcagcagaaa cactgcaaag aagcatgcgc 480

gactacgctg acgaagaaga tagcgacatg gacgatagca catcactgct gaacagcgtg 540

agaaagatga gcagcaagtt caagagcacc gtgtacgaag acgaccaaac acagagcagc 600

aacacaacag ctacaagcga ccgctacaag tactacacaa gcagaggtac aatccaacgc 660

gctaacagac cgggtttgta aggtacc 687

<210> 3

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cccagtcacg acgttgtaaa acg 23

<210> 4

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

agcggataac aatttcacac agg 23

<210> 5

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

acactcgaga tgtacggtct gaacaacgct c 31

<210> 6

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gcaggtacct tacaaacccg gtctgttagc 30

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

actgccttca tcttgggtgg 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cggcgtatga atcgtaatct 20

Claims

1. A construction method of cyprinid herpesvirus II type DNA vaccine based on baculovirus vector is characterized by comprising the following steps:

or

(6) Inoculating recombinant virus BmNPV-FA-D4ORF to silkworms, homogenizing the ill silkworms, freezing and drying to prepare freeze-dried powder which is a cyprinid herpesvirus II type DNA vaccine based on a baculovirus vector;

in the step (3), the LB agar culture medium comprises tetracycline, kanamycin, gentamicin, IPTG and X-gal with the contents of 10 mug/ml, 50 mug/ml, 7 mug/ml, 40 mug/ml and 100 mug/ml respectively; in the step (4), the recombinant virus BmNPV-FA-D4ORF is transfected into cultivated silkworm cells again, the cultivated silkworm cells are cultivated at 26-27 ℃ until the cells are attacked, and then cell culture supernatant is collected to obtain a secondary recombinant virus BmNPV-FA-D4 ORF; the BmNPV-FA-D4ORF of the secondary recombinant virus is used for inoculating the silkworm or the cultivated silkworm cells in the step (5) or inoculating the silkworm in the step (6); the silkworms are larvae of 4-5 years old or pupae initially.

2. The baculovirus vector-based cyprinid herpesvirus type II DNA vaccine constructed by the baculovirus vector-based cyprinid herpesvirus type II DNA vaccine construction method according to claim 1.

3. An immunoprophylaxis drug for gill hemorrhage of carassius auratus gibelio, comprising the baculovirus vector-based cyprinid herpesvirus type II DNA vaccine of claim 2.

4. Use of baculovirus vector-based cyprinid herpesvirus II DNA vaccine of claim 2 in the preparation of an immunoprophylaxis drug for gill hemorrhage of Carassius auratus gibelio.