CN113476597A

CN113476597A - Construction method and application of vector vaccine for resisting infectious spleen and kidney necrosis virus

Info

Publication number: CN113476597A
Application number: CN202110844250.3A
Authority: CN
Inventors: 贡成良; 蒋军; 孟爱军; 宋学宏
Original assignee: Suzhou Peiente Biotechnology Co ltd
Current assignee: Suzhou Peiente Biotechnology Co ltd
Priority date: 2021-07-26
Filing date: 2021-07-26
Publication date: 2021-10-08

Abstract

The invention discloses a construction method and application of a vector vaccine for resisting infectious spleen and kidney necrosis virus, belonging to the technical field of virus genetic engineering. The vector vaccine comprises a vaccine expressed by silkworm nuclear polyhedrosis virus and expressed as SEQ ID NO: 10, and the antigen protein is an antigen protein MCP shown as SEQ ID NO:1 shown in the CMV-mcp expression cassette encoding. The invention clones an MCP expression cassette cmv-MCP controlled by a cytomegalovirus promoter cmv to a transfer plasmid to construct a recombinant plasmid, then Bacmid-MCP is obtained after a competent cell is transformed, Bacmid-MCP DNA transfects silkworm culture cells to obtain BmNPV-MCP, then the BmNPV-MCP is inoculated to silkworm larvae of 4-5 years or incipient pupae, and homogenate is carried out after disease attack to obtain the vector vaccine. The vaccine can be used for immunizing mandarin fish or perch by injection, oral administration or soaking, and can reduce infectious spleen and kidney necrosis.

Description

Construction method and application of vector vaccine for resisting infectious spleen and kidney necrosis virus

Technical Field

The invention relates to the technical field of virus genetic engineering, in particular to a construction method and application of a vector vaccine for resisting infectious spleen and kidney necrosis virus.

Background

Infectious Spleen and Kidney Necrosis Virus (ISKNV) belongs to a member of the genus of the megacell virus, can infect Siniperca chuatsi and Micropterus salmoides, has high lethality, and seriously harms the development of the mandarin fish and Micropterus salmoides aquaculture industry. The immunity technology is increasingly becoming a safe, effective and environment-friendly novel prevention and control technology in fish disease prevention and control. Over 50 kinds of aquatic vaccines which have been successfully developed in China relate to nearly 30 kinds of pathogens. At present, the common vaccines are mainly: inactivated vaccines (killed vaccines), attenuated vaccines, subunit vaccines, synthetic peptide vaccines, recombinant live vector vaccines, DNA vaccines, mRNA vaccines, and the like. Different types of vaccines each have advantages and disadvantages.

The inactivated vaccine is relatively easy to prepare, but has the problems of unsatisfactory immune effect, poor immunity durability and the like because the inactivated vaccine does not have infection activity, can only stimulate the humoral immunity of an organism and has short immune duration.

The attenuated live vaccine is prepared through physical and chemical process to weaken the virulence of pathogen and maintain its immunogenicity. When the vaccine is inoculated into an immune object, pathogens can grow to induce the immune response of the organism, and the immune object is not damaged, but the production cost is high, the potential risk of restoring pathogenicity is existed, and the safety is poor.

The subunit vaccine is a vaccine which induces organisms to generate antibodies by utilizing a certain surface structure component of microorganisms (antigens), and has the advantages of strong antigenicity, long protection time, good safety, convenient preparation and transportation and the like, but the preparation of the vaccine needs a complex purification technology and process, the preparation cost is high, the epitope of the antigen is easy to lose, and the virus usually escapes immunity through mutation.

The synthetic peptide vaccine is a safe novel vaccine which is prepared by artificially synthesizing protective short peptide according to the amino acid sequence of natural protein, connecting the protective short peptide with a carrier and then adding an adjuvant. The vaccine can enable an organism to generate immunity, cause insufficient immune response performance and have difficult synergistic action between T cell and B cell epitope.

The recombinant vector vaccine is prepared by integrating the antigen gene of pathogen into other non-pathogenic pathogen or bacteria by using gene engineering technology and making the immune object express the antigen gene in vivo. The recombinant vector vaccine has good immune effect and is easy to control, but is greatly influenced by the expression level of the vector and possibly influences the environmental safety.

The DNA vaccine is prepared by inserting antigen gene into expression vector, then introducing into body to express antigen protein, inducing body to produce antibody, so as to achieve the purpose of preventing and treating diseases. The preparation of the DNA vaccine is relatively convenient, different antigen epitope combinations can be combined to prepare the combined vaccine according to requirements, the DNA vaccine is the development direction of a new generation of vaccine, but the DNA vaccine has the risk of integrating into a genome, and the challenge of efficiently delivering the DNA vaccine into cells is still faced.

The mRNA vaccine refers to the expression of antigen protein by transfecting mRNA into cells through liposome nanoparticle encapsulation. The mRNA vaccine is convenient to design, easy to produce, capable of generating humoral immunity and cellular immunity, high in immune protection rate and obvious in response to new paroxysmal infectious diseases. The mRNA vaccine is unstable and is easy to degrade; artificially synthesized raw materials and lipid nanoparticles wrapping mRNA can generate toxicity; the storage and transportation conditions are severe, and cold chain transportation is required.

The fish immunization mode has important influence on the immune effect and popularization and application. Common immunization modes of the aquatic vaccine comprise injection immunization, soaking immunization and oral immunization. Injection immunization is the most common immunization method, can ensure the quantity of antigens, stimulates the fish body to generate long-time immune protection, but easily causes damage to the fish, wastes time and labor, and is not suitable for smaller fish. The oral immunization is to coat the antigen and mix the antigen with feed for feeding, so that the stress reaction of the fish can be avoided, a large amount of fish can be immunized, the damage is small, the method is simple and convenient, the operation is easy, but the immune protection effect is poor due to the easy damage and degradation of the vaccine in the digestive tract; the fish is not easy to be damaged by soaking immunization, the size of the immunized fish is not required, the method is the most convenient immunization mode, but the required vaccine amount is large, and the immunization effect is relatively poor. Therefore, there is a need to find new vaccine vector systems.

Disclosure of Invention

The invention aims to provide a construction method and application of a vector vaccine for resisting infectious spleen and kidney necrosis virus, which aims to solve the problems in the prior art.

In order to achieve the purpose, the invention provides the following scheme:

the invention provides a vector vaccine for resisting infectious spleen and kidney necrosis virus, which comprises a vector expressed by silkworm nuclear polyhedrosis virus and shown as SEQ ID NO: 10, and the antigen protein is an antigen protein MCP shown as SEQ ID NO:1 shown in the CMV-mcp expression cassette encoding.

The invention also provides a construction method of the vector vaccine for resisting the infectious spleen and kidney necrosis virus, which comprises the following steps:

step 1: synthesizing an infectious spleen and kidney necrosis virus (IVNV) major capsid protein gene expression cassette (cmv-mcp) controlled by a cytomegalovirus promoter, wherein the DNA sequence of the cmv-mcp is shown as SEQ ID NO 1;

step 2: cloning the cmv-mcp into plasmid pFasTBac^TMBamHI and XbaI sites of Dual to obtain pFAST^TMDual-cmv-mcp plasmid;

and step 3: applying the pFAST^TMTransforming an escherichia coli competent cell by using the Dual-cmv-mcp plasmid, and culturing and screening by using a resistance culture medium to obtain a recombinant bacterium containing Bacmid-mcp DNA;

and 4, step 4: transfecting Bacmid-MCP DNA in the recombinant bacteria into cultivated silkworm cells, culturing until the cells are attacked, and collecting cell culture supernatant to obtain recombinant virus BmNPV-MCP;

and 5: and (3) inoculating the recombinant virus BmNPV-MCP to silkworm larvae or pupae, collecting the diseased silkworm larvae or pupae, and homogenizing to obtain the vector vaccine for resisting the infectious spleen and kidney necrosis virus.

Further, in the step (1), synthesizing an infectious spleen and kidney necrosis virus main capsid protein gene expression cassette cmv-mcp controlled by a cytomegalovirus promoter, wherein the sequence synthesis can be performed by de novo full chemical synthesis, or cloning the cytomegalovirus promoter and the infectious spleen and kidney necrosis virus main capsid protein gene respectively through PCR, and further connecting the cytomegalovirus promoter and the main capsid protein gene to form a cmv-mcp DNA sequence.

The pFastBacTMDual plasmid is a product of Invitrogen corporation, and belongs to Bac-to-Bac (Bacteria to Baculovir) expression system vectors.

In step 2, the cmv-mcp DNA sequence was cloned into pFasTBac^TMThe BamHI and XbaI sites of Dual can also be cloned into pFasTBac^TMOther multiple cloning sites of Dual can also be seamlessly cloned with pFasTBac^TMAnd (5) connecting by Dual.

In the step 4, the recombinant Bacmid-MCP DNA is transfected into cultivated silkworm cells, the cultivated silkworm cells are cultivated at the temperature of 26-27 ℃ until the cells are attacked, and then cell culture supernatant is collected to obtain recombinant virus BmNPV-MCP; in order to improve the titer of the virus, the recombinant virus can be used for infecting cultivated silkworm cells again, after the cells are diseased, the cell culture supernatant is collected to obtain the P1 generation virus, the P1 generation virus is inoculated to the cells, and after the cells are diseased, the cell culture supernatant is collected to obtain the P2 generation virus.

In step 5, the recombinant virus BmNPV-MCP is inoculated to silkworm larvae or pupae initially, and the pupae initially is preferably inoculated; in the larva selection, 5-instar silkworm larvae are preferred.

Preferably, in step 3, the resistant culture medium is LB agar culture medium containing white tetracycline, kanamycin, gentamicin, IPTG and X-gal;

the culture condition is 35-40 deg.C for 24-48 h.

Preferably, in step 4, the culture temperature is: 26-27 ℃.

Preferably, in step 5, the silkworm larvae are selected from 4-5 instars.

Preferably, the homogenization treatment is specifically:

(a) mixing the diseased silkworm larvae or pupae with a phosphoric acid buffer solution according to the weight ratio of 1 kg: 5-10L of the mixture is homogenized, filtered, the supernatant is collected, and the supernatant is centrifugally purified to obtain recombinant virus liquid, namely the vector vaccine for resisting the infectious spleen and kidney necrosis virus; or

(b) Homogenizing the diseased silkworm larva or pupa, and freeze-drying to obtain recombinant virus, namely the vector vaccine for resisting the infectious spleen and kidney necrosis virus.

Further, after 4-5 days of inoculation, the diseased silkworms or pupae are collected, and 5-10L of phosphate buffer is added per 1kg for homogenization, or normal saline is used to replace the phosphate buffer.

4-5-instar silkworm larvae or pupation are inoculated, and the pupation is optimized, so that the cost can be saved, and the freeze-drying is convenient; when selecting the larva, preferably selecting 5-year-old silkworm larva, and before freeze-drying the diseased silkworm larva, removing midgut and contents, and improving the level of recombinant virus in the freeze-dried powder.

The invention also provides application of the vector vaccine in preparation of a medicament for resisting infectious spleen and kidney necrosis viruses of siniperca chuatsi/weever.

Preferably, the carrier vaccine is in the form of injection or freeze-dried powder.

The invention also provides a method for using the vector vaccine, which is used for injecting or soaking the mandarin fish/weever with the vector vaccine or feeding the mandarin fish/weever by mixing the vector vaccine with feed.

Further, the mandarin fish/weever is injected or soaked, or the mandarin fish/weever is fed with feed to be a preferred carrier vaccine, or the recombinant virus BmNPV-MCP obtained in the step 4.

Preferably, the injection conditions are: injecting 1 × 10 per 100 g of the weight of the mandarin fish/weever¹⁰-1.8×10¹⁰A copied recombinant virus fluid;

the soaking conditions are as follows: planting Siniperca chuatsi/Perch at 1.0 × 10⁸-1.8×10⁸Soaking the copied/ml recombinant virus solution for 2-5 h;

feeding is carried outThe conditions are as follows: adding 5X 10 to 100mg of dry feed⁵-6.3×10⁵Copying the recombinant virus and feeding for 7-8 days.

The invention discloses the following technical effects:

(1) the invention discloses the construction and application of a vector vaccine for resisting infectious spleen and kidney necrosis virus, and no report is found; the vaccine vector baculovirus used in the present invention is non-pathogenic for vertebrate and incapable of being replicated in vertebrate, and its natural host is strictly limited to invertebrate, mainly insect, but can transfer the recombinant baculovirus genome DNA with integrated exogenous DNA to vertebrate tissue cell including fish in transduction mode and independently receptor mode, so that it has high biological safety.

(2) The existing vaccine for resisting the infectious spleen and kidney necrosis virus is an inactivated vaccine, can only stimulate the humoral immunity of an organism, has short duration of immunity, and has the problems of unsatisfactory immune effect, poor immunity durability and the like. The vector vaccine prepared by using the baculovirus as a vaccine vector can realize immunity in the modes of injection, oral administration, soaking and the like, and increases the selection of immune approaches. The vector vaccine can overcome the defects of the existing vaccine, and has good immune effect and convenient use.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.

FIG. 1 shows the result of PCR identification of Bacmid-MCP of example 1; by pFAST^TMAfter DH10/Bac was transformed with Dual-cmv-mcp, transformant DNA was extracted for PCR identification, wherein, lane M: DNA standard molecular weight, lanes 1-4: pFAST^TMDual-cmv-mcp transformed 4 transformants formed by DH10/Bac competent cells, lane 5: wild-type Bacmid transforming bacteria;

FIG. 2 shows the PCR identification of the recombinant virus BmNPV-MCP of example 1; PCR identification was performed by extracting total DNA of virus-infected BmN cells and using primers specific to the major capsid protein gene of infectious spleen and kidney necrosis virus, wherein, Lane M: DNA standard molecular weight, lane 1: blank control, lane 2: uninfected virus BmN cell genome, lane 3: wild-type BmNPV infects the BmN cell genome, lanes 4, 5: BmNP cell genome infected with BmNPV-MCP;

FIG. 3 shows the results of the transcription of the major capsid gene in the kidney in example 1; 8X 10⁹Copied recombinant viruses BmNPV-MCP and 8X 10⁹Copying wild BmNPV to respectively immunize and inject perch (8-12 cm in length and 35-55g in weight) fish, taking 0.1g of kidney tissues at 1, 2, 3 and 4weeks after injection, extracting tissue RNA, detecting the transcription level of capsid protein gene by qRT-PCR by using primers qMCP-1 and qMCP-2, wherein the reference gene is actin gene (0.01)<^*P<0.05，0.001<^**P<0.01，^***P<0.001; the experiments were all repeated 3 times); NC: non-injected group, BmNPV: injecting wild-type BmNPV; BmNPV-MCP-1week, BmNPV-MCP-2week, BmNPV-MCP-3week, BmNPV-MCP-4 week: BmNPV-MCP injection is performed for 1, 2, 3 and 4weeks, respectively;

FIG. 4 is a diagram of Western blot for detecting the expression of major capsid protein genes in the spleen and kidney of an immunized fish in example 1; 8X 10⁹Copied recombinant viruses BmNPV-MCP and 8X 10⁹Copying wild type BmNPV to respectively immunize and inject perch (with the length of 8-12cm and the weight of 35-55g), taking 0.1g of spleen and kidney tissues of 1, 2, 3 and 4weeks after injection, homogenizing, and then carrying out Western blot detection; the primary antibody is a main capsid protein antibody, the secondary antibody is goat anti-mouse IgG marked by HRP, and the internal reference is alpha-Tubulin; lane 1, uninmmunized weever kidney; lane 2: injecting wild type BmNPV weever kidney; lane 3: injecting BmNPV-MCP into the weever kidney for 1 week; lane 4: injecting BmNPV-MCP into the weever kidney for 2 weeks; lane 5: injecting BmNPV-MCP 3-week weever kidney; lane 6: injecting BmNPV-MCP into the weever kidney for 4 weeks;

FIG. 5 shows the antibody titer test of the BmNPV-MCP injection for immunized weever in example 1; 8X 10⁹The recombinant virus BmNPV-MVP is copied and injected into an immune weever (with the length of 8-12cm and the weight of 35-55g), 3 weever are randomly taken at 1week, 2weeks, 3weeks and 4weeks, the tail vein is bled, and the ELISA is used for detecting the antibody titer (0.01)<^*P<0.05，0.001<^**P<0.01，^***P<0.001; the experiments were all repeated 3 times); 1, 2, 3, 4 weeks:

weeks

1, 2, 3 and 4 after BmNPV-MCP injection, respectively;

FIG. 6 is the detection of the major capsid protein gene of BmNPV-MCP in spleen and kidney tissue of Mandarin fish after injection of immunization with BmNPV-MCP of example 2; 8X 10⁹Injecting the copied BmNPV-MCP into a mandarin fish (7-13 cm in body length and 35-60g in weight), extracting a spleen and kidney tissue genome after one week, and carrying out PCR detection by using primers MCP-1 and MCP-2; lane M, Standard molecular weight DNA, Lane 1: BmNPV-MCP DNA; lane 2: spleen and kidney tissues not injected with BmNPV-MCP, lanes 3-4: spleen and kidney tissues of different mandarins after BmNPV-MCP injection.

Detailed Description

Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. Further, for numerical ranges in this disclosure, it is understood that each intervening value, between the upper and lower limit of that range, is also specifically disclosed. Every smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in a stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference herein for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The specification and examples are exemplary only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are open-ended terms that mean including, but not limited to.

The sequence shown in SEQ ID NO 1 used in the following examples is as follows:

the sequence shown in SEQ ID NO. 1 used in the invention is a fusion DNA sequence, wherein 1-6nt is BamHI locus, and 7-623nt is cytomegalovirus promoter; 624 + 629nt is EcoRI site, 630 + 1991nt is main capsid protein gene sequence of the infectious spleen and kidney necrosis virus, 1992 + 1997nt is XbaI site. The restriction sites in the sequence may be according to pFasTBac^TMThe multiple cloning site in the Dual plasmid was adjusted.

The protein sequence expressed by the gene sequence is shown as SEQ ID NO: 10, the sequence is as follows:

MSAISGANVTSGFIDISAFDAMETHLYGGDNAVTYFARETVRSSWYSKLPVTLSKQTGHANFGQEFSVTVARGGDYLINVWLRVKIPSITSSKENSYIRWCDNLMHNLVEEVSVSFNDLVAQTLTSEFLDFWNACMMPGSKQSGYNKMIGMRSDLVAGITNGQTMPAVYLNLPIPLFFTRDTGLALPTVSLPYNEVRIHFKLRRWEDLLISQSNQADMAISTVTLANIGNVAPALTNVSVMGTYAVLTSEEREVVAQSSRSMLIEQCQVAPRVPVTPADNSLVHLDLRFSHPVKALFFAVKNVTHRNVQSNYTAASPVYVNNKVNLPLMATNPLSEVSLIYENTPRLHQMGVDYFTSVDPYYFAPSMPEMDGVMTYCYTLDMGNINPMGSTNYGRLSNVTLSCKVSDNAKTTAAGGGGNGSGYTVAQKFELVVIAVNHNIMKIADGAAGFPIL

example 1 construction of vector vaccine against infectious spleen and kidney necrosis virus and injection of immune-induced weever-produced antibody

(1) Synthesizing an infectious spleen and kidney necrosis virus major capsid protein gene expression cassette CMV-MCP (1997bp) controlled by a cytomegalovirus promoter as shown in SEQ ID NO. 1, cloning into a T-vector, performing sequencing verification, and naming the plasmid which is verified to be correct as pMD-CMV-MCP;

(2) the pMD-CMV-MCP plasmid was digested with BamHI and XbaI, the CMV-MCP fragment was recovered, and cloned into the same digested pFSATBac^TMIn Dual, the recombinant plasmid pFAST was obtained^TMDual-cmv-mcp；

(3)pFAST^TMDH10/Bac competent cells were transformed with Dual-cmv-mcp and plated on LB agar plates containing tetracycline (10. mu.g/ml), kanamycin (50. mu.g/ml), gentamicin (7. mu.g/ml), IPTG (40. mu.g/ml), X-gal (100. mu.g/ml); culturing at 37 ℃ for 48 hours, picking white colonies for culturing, extracting recombinant Bacmid genomic DNA, carrying out PCR on the recombinant Bacmid by using an M13 forward primer (SEQ ID NO:2) and an M13 reverse primer (SEQ ID NO:3), wherein,

m13 forward primer (SEQ ID NO: 2): CCCAGTCACGACGTTGTAAAACG, respectively;

m13 reverse primer (SEQ ID NO: 3): AGCGGATAACAATTTCACACAGG, respectively;

the PCR amplification system (25. mu.L) is shown in Table 1 below:

TABLE 1PCR amplification System

Composition of	Volume of μ L
		H₂O	16.5
10 XPCR buffer	2.5
		50mmol/L MgCl₂	2.0
10mmol/L dNTP mixture	1.0
		Recombinant Bacmid genomic DNA (50ng)	1.0
M13 forward primer 10. mu. mol/L	0.5
		M13 reverse primer 10. mu. mol/L	0.5
Taq DNA polymerase 5U/. mu.L	1

The PCR amplification conditions were: after 5 minutes at 94 ℃ of the pre-denaturation, the mixture was subjected to 35 cycles of denaturation at 94 ℃ for 30 seconds, annealing at 54 ℃ for 30 seconds and extension at 72 ℃ for 4 minutes and 30 seconds, and then incubated at 72 ℃ for 10 minutes.

As shown in FIG. 1, the results show that a band of interest consistent with the theoretical molecular weight (4.5kb) can be amplified from recombinant Bacmid DNA, indicating that recombinant Bacmid has been correctly constructed as required, and is named Bacmid-MCP;

(4) Bacmid-MCP DNA (2 μ g) is added into 48 μ L TC-100 medium (without fetal calf serum, GIBCO BRL company) and mixed evenly, another 5 μ L FuGENE HD transfection reagent (Roche company) is added into 45 μ L TC-100 medium (without fetal calf serum) and mixed evenly, the former is added into the latter dropwise, after being mixed evenly and placed for 30 minutes, the mixture is added into 400 μ L TC-100 medium (without fetal calf serum) and mixed evenly, transfection is carried out for 10 μ L⁵Cultivated silkworm cells BmN. After 4 hours, the cell culture medium was removed, cultured with TC-100 medium containing 10% fetal bovine serum at 27 ℃ for 3 days,and collecting supernatant of the transfection culture cells to obtain P1 generation recombinant virus. 10 mu L of P1 virus was used to infect 10⁵And (3) culturing the single layer of BmN cells for 4-5 days, wherein the cell morphology becomes round, the cell nucleus expands, and the cells lose adherence. And collecting supernatant of the cultured cells to obtain the P2 generation recombinant virus. Simultaneously extracting total DNA of virus infected cells, and carrying out PCR amplification by using specific primers MCP-1(SEQ ID NO:4) and MCP-2(SEQ ID NO:5) of main capsid protein genes of the infectious spleen and kidney necrosis virus, wherein,

MCP-1(SEQ ID NO:4)：GAATTCATGTCTGCAATCTCAGGTG；

MCP-2(SEQ ID NO:5)：CTCGAGTTACAGGATAGGGAAGC；

the PCR amplification system (25. mu.L) is shown in Table 2 below:

TABLE 2PCR amplification System

Composition of	Volume of μ L
		H₂O	16.5
10 XPCR buffer	2.5
		50mmol/L MgCl₂	2.0
10mmol/L dNTP mixture	1.0
		Virus infected cell total DNA (50ng)	1.0
MCP-1 primer 10 mu mol/L	0.5
		MCP-2 primer 10 mu mol/L	0.5
Taq DNA polymerase 5U/. mu.L	1

The PCR amplification conditions were: after 5 minutes at 94 ℃ of the pre-denaturation, the mixture was denatured at 94 ℃ for 30 seconds, annealed at 54 ℃ for 30 seconds, and extended at 72 ℃ for 1min and 20 sec for 35 cycles of amplification, and then incubated at 72 ℃ for 10 minutes.

As can be seen from FIG. 2, a specific band (1.3kb) corresponding to the size of the major capsid gene is observed in

lanes

4 and 5, indicating that the recombinant virus has been constructed as required, and the recombinant virus is named: BmNPV-MCP, and storing at 4 ℃ in the dark for later use;

(5) mix 8X 10⁷The copy/. mu.L of recombinant BmNPV-MCP was injected at 200. mu.L/tail from the basal part of the pectoral fin of bass (8-12 cm in length, 35-55g in body weight) as a control with wild-type virus BmNPV. 0.1g of each kidney tissue at 1, 2, 3 and 4weeks after injection is taken, tissue RNA is extracted, reverse transcription is carried out by a reverse transcription kit (Beijing Quanjin biotechnology Co., Ltd.) according to the product instruction, reverse transcription cDNA is taken as a template, the transcription level of MCP is detected by qPCR by using primers qMCP-1(SEQ ID NO:6) and qMCP-2(SEQ ID NO:7), an internal reference gene is an actin gene, and primers of the actin gene are act-1((SEQ ID NO:8) and act-2(SEQ ID NO: 9).

qMCP-1(SEQ ID NO:6)：CAGGCGTTCCAGAAGTCAAGG；

qMCP-2(SEQ ID NO:7)：CGTGAGACCGTGCGTAGTTC；

act-1((SEQ ID NO:8)：CCCAGAGCAAGAGAGGTATC；

act-2(SEQ ID NO:9)：GCTGTGGTGGTGAAGGAGTAG；

qPCR was performed using the TransStart Tip Green qPCR SuperMix kit (Beijing Quanyujin Biotechnology Co., Ltd.). The reaction system (20. mu.L) is shown in Table 3 below:

TABLE 3 reaction System

Composition of	Volume of μ L
		2×Mix	10
Primer mix 1. mu. mol	1
		cDNA template	1
H₂O	8

The reaction procedure is as follows: amplification was carried out at 95 ℃ for 10 minutes, followed by 39 cycles at 95 ℃ for 15 seconds and 60 ℃ for 1 minute. The fluorescence detection read plate was set at 60 ℃ for a 1min period.

One week after the BmNPV-MCP injection, it was possible to detect transcripts of the major capsid gene in the kidney tissue of weever, and by two weeks the transcript level of the major capsid gene reached the highest and then gradually decreased (FIG. 3). The major capsid proteins were detected by Western blot from spleen and kidney tissues of weever taken further, and were detected from spleen and kidney tissues of weever injected for 1-4 weeks (fig. 4).

(6) Mix 8X 10⁷Copying/microliter of recombinant BmNPV-MCP, injecting 200 microliter/tail from basal part of pectoral fin of bass (8-12 cm long, 35-55g weight), taking 3 pieces of bass from random tail veins at 1week, 2weeks, 3weeks and 4weeks after the injection, and separatingSerum of the non-immunized weever is used as a negative control, and then the antibody titer is measured by ELISA. No obvious antibody titer is detected in the weever serum at the 1 st week of immunization, and the weever serum antibody titer at the 2 nd week of immunization is 1: 3200, the titer of the antibody of the weever serum at the 3 rd week of immunization is 1: 12800, week 4 immune bass serum antibody titers were on par with week 3 (FIG. 5).

Example 2 vector vaccine BmNPV-MCP against infectious spleen and kidney necrosis Virus can be transduced into the tissues of Mandarin fish and express the major capsid proteins of infectious spleen and kidney necrosis Virus

By 8X 10⁹The copied recombinant virus BmNPV-MCP is injected with mandarin fish (7-13 cm in length and 35-60g in weight), after one week, 0.1g of spleen and kidney tissues are taken, the genome is extracted, and primers MCP-1(SEQ ID NO:4) and MCP-2(SEQ ID NO:5) are used for amplification. The PCR amplification system and amplification conditions were the same as in step (4) of example 1.

As shown in FIG. 6, it was revealed that the major capsid protein gene of infectious spleen and kidney necrosis virus was PCR-amplified from BmNPV-MCP-injected Siniperca kneri tissue DNA, indicating that BmNPV-MCP entered the siniperca chuatsi spleen and kidney tissue.

Example 3 immunoprotection of infectious spleen and kidney necrosis Virus infection by immunizing against vector vaccine against infectious spleen and kidney necrosis Virus

(1) Selecting healthy and disease-free largemouth bass (8-12 cm in length and 35-55g in weight) of the same batch, and carrying out oxygen-charging breeding for 2weeks in water temperature of 19-22 ℃.

(2) Take 4X 10⁷Copies/. mu.L of BmNPV-MVP, 200. mu.L/tail injection from the base of the pectoral fin, together with wild-type BmNPV (4X 10)⁷Copy/. mu.L) as negative control, and nonimmunized blank control group (each injected with PBS 200. mu.l, 20 pieces of weever).

(3) Taking 5g of the kidney of the siniperca chuatsi infected by the infectious spleen and kidney necrosis virus, adding 5mL of phosphate buffer solution, fully grinding at 8000r/min, centrifuging for 30min, taking the supernatant, repeating the step for 4 times, filtering with a 0.22 μm filter membrane in a super clean bench, and storing the filtrate at 4 ℃.

(4) 28 days after immunization, infectious spleen and kidney necrosis virus solution (200. mu.L per tail) was injected from the fin. The water temperature was controlled at 27-29 deg.C, and the feed was 3 times per day. Observing the activity of the weever, and checking and recording the disease condition. The diseased fish is identified and confirmed by PCR by using MCP-1 and MCP-2 primers. The PCR amplification system and amplification conditions were the same as in step (4) of example 1.

The results show that: the morbidity of the blank control group, the negative control group and the injection immune group is 70%, 85% and 10% respectively, under the experimental condition, the average value of the blank control group and the negative control group is taken as the morbidity of the control group, and the relative immune protection rate of the injection immune BmNPV-MCP is 87.1%.

Example 4 immunoprotection of infectious spleen and kidney necrosis Virus infection by a vector vaccine soaked with immune against infectious spleen and kidney necrosis Virus

(1) Same as example 3, step (1);

(2) the titer of the bass in the BmNPV-MCP is 1.30 multiplied by 10⁸copies/mL of virus solution were soaked for 3 h.

(3) 28 days after immunization, the infectious spleen and kidney necrosis virus of step (3) of example 3 (200. mu.L per tail) was inoculated by fin injection. The water temperature was controlled at 27-29 deg.C, and the feed was 3 times per day. Observing the activity of the weever, and checking and recording the disease condition. The diseased fish is identified and confirmed by PCR by using MCP-1 and MCP-2 primers. The PCR amplification system and amplification conditions were the same as in step (4) of example 1.

The results show that: the incidence rate of the soaked and immunized weever is 30 percent, while the incidence rate of the blank control group is 70 percent, and the incidence rate after the soaking and immunization is reduced by 40 percent.

Example 5BmNPV-MCP infection of silkworm pupae to silkworm for preparation of vaccine lyophilized powder of vector for resisting infectious spleen and kidney necrosis virus and oral immunization

(1) Dipping the P2 generation recombinant virus obtained in the step (4) in the example 1 by using an insect needle, and puncturing and inoculating the healthy silkworm pupae (silkworm variety: pinus sylvestris x gostemon) of the next day of pupation from the abdominal link;

(2) the inoculated pupa Bombycis is protected at 25 deg.C, and the activity of pupa Bombycis is observed every day to remove septicemia pupa infected by bacteria and Bombyx Batryticatus pupa infected by fungi.

(3) After 4-5 days, collecting the silkworm pupae, pulping with a homogenizer, freeze-drying, and making into lyophilized powder with water content not more than 10%.

(4) Adding 10mL phosphate buffer (0.01mol/L, pH 7.2) into 1g of lyophilized powder, shaking thoroughly, centrifuging at 12000r/min for 10 min; taking supernatant, 12000r/min, centrifuging for 10min, and repeating for 3 times.

(5) Filtering the supernatant with a 0.22 μm filter membrane, collecting filtrate, taking 10 μ l, performing 10-fold serial dilution with TC-100 insect culture medium, inoculating silkworm BmNPV cultured cells, and determining the titer of recombinant virus BmNPV-MCP in the filtrate;

(6) according to the titer of the recombinant virus BmNPV-MCP in the filtrate, 5.5 multiplied by 10 mg of dried fish feed is sprayed according to 100mg of the dried fish feed⁵Copying the recombinant virus BmNPV-MCP, drying in the shade, obtaining a feed containing the BmNPV-MCP, feeding the weever for 7-8 days, and then feeding the weever with a normal feed.

(7) After 28 days of rearing, the infectious spleen and kidney necrosis virus (200. mu.L per tail) obtained in step (3) of example 3 was inoculated by fin injection, and the activity of the weever was observed, examined and the incidence of disease was recorded. The diseased fish is identified and confirmed by PCR by using MCP-1 and MCP-2 primers. The PCR amplification system and amplification conditions were the same as in step (4) of example 1.

The results show that: the incidence rate of the weever fed with the immune is 25 percent, while the incidence rate of the control group is 70 percent, and the incidence rate is reduced by 45 percent after the oral immune.

The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.

Sequence listing

<110> Bei Ente Biotech, Suzhou Ltd

<120> construction method and application of vector vaccine for resisting infectious spleen and kidney necrosis virus

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1997

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ggatccacat tgattattga ctagttatta atagtaatca attacggggt cattagttca 60

tagcccatat atggagttcc gcgttacata acttacggta aatggcccgc ctggctgacc 120

gcccaacgac ccccgcccat tgacgtcaat aatgacgtat gttcccatag taacgccaat 180

agggactttc cattgacgtc aatgggtgga gtatttacgg taaactgccc acttggcagt 240

acatcaagtg tatcatatgc caagtacgcc ccctattgac gtcaatgacg gtaaatggcc 300

cgcctggcat tatgcccagt acatgacctt atgggacttt cctacttggc agtacatcta 360

cgtattagtc atcgctatta ccatggtgat gcggttttgg cagtacatca atgggcgtgg 420

atagcggttt gactcacggg gatttccaag tctccacccc attgacgtca atgggagttt 480

gttttggcac caaaatcaac gggactttcc aaaatgtcgt aacaactccg ccccattgac 540

gcaaatgggc ggtaggcgtg tacggtggga ggtctatata agcagagctc tctggctaac 600

tagagaaccc actgcttact ggcgaattca tgtctgcaat ctcaggtgca aacgtaacca 660

gcgggttcat cgacatctcc gcgtttgatg cgatggagac ccacttgtac ggcggcgaca 720

atgccgtgac ctactttgcc cgtgagaccg tgcgtagttc ctggtacagc aaactgcccg 780

tcaccctgtc aaaacagact ggccatgcca attttgggca ggagtttagt gtgacggtgg 840

cgaggggcgg cgactacctc attaatgtgt ggctgcgtgt taagatcccc tccatcacat 900

ccagcaagga gaacagctac atccgctggt gcgacaatct gatgcacaat ctagtggagg 960

aggtgtcggt gtcatttaac gacctggtgg cacagaccct caccagcgag ttccttgact 1020

tctggaacgc ctgcatgatg cccggcagca aacagtctgg ctacaacaag atgattggca 1080

tgcgcagcga cctggtggcc ggcatcacca acggccagac tatgcccgcc gtctacctta 1140

atttgcccat tcccctcttc tttacccgtg acacgggcct ggcgttgcct accgtgtctc 1200

tgccgtacaa cgaggtgcgc atccacttca agctgcggcg ctgggaggac ctgctcatca 1260

gccagagcaa ccaggccgac atggccatat cgaccgtcac cctggctaac attggcaatg 1320

tagcacccgc actgaccaat gtgtctgtga tgggcactta cgctgtactg acaagcgagg 1380

agcgtgaggt ggtggcccag tctagtcgta gcatgctcat tgaacagtgc caggtggcgc 1440

cccgtgtgcc cgtcacgccc gcagacaatt ctttggtgca tctggacctc aggttcagtc 1500

accccgtgaa ggccttgttc tttgcagtaa agaacgtcac ccaccgcaac gtgcaaagca 1560

actacaccgc ggccagtccc gtgtatgtca acaacaaggt gaatctgcca ttgatggcca 1620

ccaatcccct gtccgaggtg tcactcattt acgagaacac ccctcggctc caccagatgg 1680

gagtagacta cttcacatct gtcgacccct actactttgc gcccagcatg cctgagatgg 1740

atggtgttat gacctactgc tatacgttgg acatgggcaa tatcaacccc atgggttcaa 1800

ccaactacgg ccgcctgtcc aacgtcaccc tgtcatgtaa ggtgtcggac aatgcaaaga 1860

ccaccgcggc gggcggtggc ggcaacggct ccggctacac ggtggcccaa aagtttgaac 1920

tggtcgttat tgctgtcaac cacaacatca tgaagattgc tgacggcgcc gcaggcttcc 1980

ctatcctgta atctaga 1997

<210> 2

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cccagtcacg acgttgtaaa acg 23

<210> 3

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

agcggataac aatttcacac agg 23

<210> 4

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gaattcatgt ctgcaatctc aggtg 25

<210> 5

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ctcgagttac aggataggga agc 23

<210> 6

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

caggcgttcc agaagtcaag g 21

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cgtgagaccg tgcgtagttc 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cccagagcaa gagaggtatc 20

<210> 9

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gctgtggtgg tgaaggagta g 21

<210> 10

<211> 453

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 10

Met Ser Ala Ile Ser Gly Ala Asn Val Thr Ser Gly Phe Ile Asp Ile

1 5 10 15

Ser Ala Phe Asp Ala Met Glu Thr His Leu Tyr Gly Gly Asp Asn Ala

20 25 30

Val Thr Tyr Phe Ala Arg Glu Thr Val Arg Ser Ser Trp Tyr Ser Lys

35 40 45

Leu Pro Val Thr Leu Ser Lys Gln Thr Gly His Ala Asn Phe Gly Gln

50 55 60

Glu Phe Ser Val Thr Val Ala Arg Gly Gly Asp Tyr Leu Ile Asn Val

65 70 75 80

Trp Leu Arg Val Lys Ile Pro Ser Ile Thr Ser Ser Lys Glu Asn Ser

85 90 95

Tyr Ile Arg Trp Cys Asp Asn Leu Met His Asn Leu Val Glu Glu Val

100 105 110

Ser Val Ser Phe Asn Asp Leu Val Ala Gln Thr Leu Thr Ser Glu Phe

115 120 125

Leu Asp Phe Trp Asn Ala Cys Met Met Pro Gly Ser Lys Gln Ser Gly

130 135 140

Tyr Asn Lys Met Ile Gly Met Arg Ser Asp Leu Val Ala Gly Ile Thr

145 150 155 160

Asn Gly Gln Thr Met Pro Ala Val Tyr Leu Asn Leu Pro Ile Pro Leu

165 170 175

Phe Phe Thr Arg Asp Thr Gly Leu Ala Leu Pro Thr Val Ser Leu Pro

180 185 190

Tyr Asn Glu Val Arg Ile His Phe Lys Leu Arg Arg Trp Glu Asp Leu

195 200 205

Leu Ile Ser Gln Ser Asn Gln Ala Asp Met Ala Ile Ser Thr Val Thr

210 215 220

Leu Ala Asn Ile Gly Asn Val Ala Pro Ala Leu Thr Asn Val Ser Val

225 230 235 240

Met Gly Thr Tyr Ala Val Leu Thr Ser Glu Glu Arg Glu Val Val Ala

245 250 255

Gln Ser Ser Arg Ser Met Leu Ile Glu Gln Cys Gln Val Ala Pro Arg

260 265 270

Val Pro Val Thr Pro Ala Asp Asn Ser Leu Val His Leu Asp Leu Arg

275 280 285

Phe Ser His Pro Val Lys Ala Leu Phe Phe Ala Val Lys Asn Val Thr

290 295 300

His Arg Asn Val Gln Ser Asn Tyr Thr Ala Ala Ser Pro Val Tyr Val

305 310 315 320

Asn Asn Lys Val Asn Leu Pro Leu Met Ala Thr Asn Pro Leu Ser Glu

325 330 335

Val Ser Leu Ile Tyr Glu Asn Thr Pro Arg Leu His Gln Met Gly Val

340 345 350

Asp Tyr Phe Thr Ser Val Asp Pro Tyr Tyr Phe Ala Pro Ser Met Pro

355 360 365

Glu Met Asp Gly Val Met Thr Tyr Cys Tyr Thr Leu Asp Met Gly Asn

370 375 380

Ile Asn Pro Met Gly Ser Thr Asn Tyr Gly Arg Leu Ser Asn Val Thr

385 390 395 400

Leu Ser Cys Lys Val Ser Asp Asn Ala Lys Thr Thr Ala Ala Gly Gly

405 410 415

Gly Gly Asn Gly Ser Gly Tyr Thr Val Ala Gln Lys Phe Glu Leu Val

420 425 430

Val Ile Ala Val Asn His Asn Ile Met Lys Ile Ala Asp Gly Ala Ala

435 440 445

Gly Phe Pro Ile Leu

450

Claims

1. A vector vaccine for resisting infectious spleen and kidney necrosis virus is characterized by comprising a vector expressed by bombyx mori nuclear polyhedrosis virus and shown as SEQ ID NO: 10, and the antigen protein is an antigen protein MCP shown as SEQ ID NO:1 shown in the CMV-mcp expression cassette encoding.

2. A method for constructing the vector vaccine against infectious spleen and kidney necrosis virus according to claim 1, comprising the steps of:

step 2: cloning the cmv-mcp into plasmid pFasTBac^TMBamHI and XbaI sites of DualObtaining pFAST^TMDual-cmv-mcp plasmid;

3. The method for constructing a recombinant vector as claimed in claim 2, wherein in step 3, the resistant medium is LB agar medium containing white tetracycline, kanamycin, gentamicin, IPTG and X-gal;

the culture condition is 35-40 deg.C for 24-48 h.

4. The method according to claim 2, wherein in step 4, the culture temperature is: 26-27 ℃.

5. The method according to claim 2, wherein in step 5, the silkworm larvae are selected from 4 to 5 instars.

6. Construction process according to claim 2, characterized in that said homogenization treatment is in particular:

7. Use of the vector vaccine of claim 1 in the preparation of a medicament against infectious spleen and kidney necrosis virus of siniperca chuatsi/bass.

8. The use of claim 7, wherein the carrier vaccine is in the form of an injection or a lyophilized powder.

9. A method of using the vector vaccine of claim 1, wherein siniperca chuatsi/perch is injected or infused with the vector vaccine or fed mixed with feed to siniperca chuatsi/perch.

10. Use according to claim 9, wherein the injection conditions are: injecting 1 × 10 per 100 g of the weight of the mandarin fish/weever¹⁰-1.8×10¹⁰A copied recombinant virus fluid;

the feeding conditions are as follows: adding 5X 10 to 100mg of dry feed⁵-6.3×10⁵Copying the recombinant virus and feeding for 7-8 days.