WO2007025431A1

WO2007025431A1 - Recombinant newcastle disease lasota attenuated vaccine strain expressing vp2 gene of infectious bursal disease virus

Info

Publication number: WO2007025431A1
Application number: PCT/CN2006/001541
Authority: WO
Inventors: Zhigao Bu; Xiaomei Wang; Hualan Chen
Original assignee: Zhigao Bu; Xiaomei Wang; Hualan Chen
Priority date: 2005-09-02
Filing date: 2006-07-03
Publication date: 2007-03-08
Also published as: CN1772886A

Abstract

The present invention discloses recombinant Newcastle Disease LaSota attenuated vaccine strain expressing VP2 gene of infectious bursal disease virus (IBDV). More specifically, recombinant Newcastle Disease LaSota attenuated vaccine strain is rLasota-VP2. The present invention also discloses a method for producing the recombinant Newcastle Disease LaSota attenuated vaccine strain and its use in the preparation of vaccine for the prevention of the diseases caused by Newcastle Disease virus(NDV) and IBDV.

Description

Recombinant Newcastle Disease Lacto Attenuated Vaccine Strain Expressing Infectious Bursal Disease Virus VP2 Gene

Technical field

The present invention relates to the field of recombinant viral vaccines, and more particularly to a recombinant Newcastle disease LaSota attenuated vaccine strain expressing the infectious bursal disease VP2 gene. The present invention also relates to a method for preparing the recombinant Newcastle disease LaSota attenuated vaccine strain and its use as a vaccine. Background technique

Newcastle disease virus (NDV) is a non-segmented single-stranded negative-strand RNA virus that has been studied intensively as an important member of the Paramyxoviridae family and model virus. Recombinant NDV has extraordinary advantages as a live virus vaccine vector: NDV attenuated vaccine including LaSota strain has been used for poultry epidemic prevention for a long time, and its safety and efficacy have been fully proved; NDV inheritance is relatively stable, only one serotype, poison The possibility of recombination and virulence reintegration between plants is minimal; the replication process is completed in the cytoplasm, from RA to RNA, there is no possibility of DNA phase and cell genome integration; NDV attenuated vaccine can induce systemic humoral immunity, local The formation of mucosal immunity and cellular immunity forms a more comprehensive and accurate immune protection; it can be easily applied by drinking water, spraying, nasal drops, eye drops or injections; NDV has the characteristics of chicken embryo growth with sputum titer The production cost is extremely low ⁽¹ ' ^Wu2 ' ¹³⁾ . NDV is a highly contagious and highly lethal poultry epidemic. The attenuated vaccine used in Newcastle disease prevention in China is at least 10 billion feathers per year. The economic significance of NDV as a live virus vaccine vector is enormous.

The reverse genetic operation of the negative-strand RA virus is a process of producing a new virus by manipulating the viral genomic cDNA. The basic process is: 1 assembling a complete viral genome (or recombinant genome) cDNA clone, precisely at the 5' end. After being affixed to the T7 promoter, the 3' end is precisely fused to the self-cleaving nuclease sequence and the T7 transcription termination signal to form a genomic cDNA transcription template; 2 is a genomic cDNA transcription template and a transcription-related functional structural protein necessary for initiating viral replication. Such as nuclear protein (NP), phosphoprotein (P) and polymerase proteins

(L) expression plasmid (T7 promoter) together, co-transfected with virus replication-expressing cells expressing T7 polymerase; 3 24-72 hours after harvesting the culture supernatant, filtering to continue sensitive cell passage or inoculation of chicken embryo allantoic sac Cavity rescue

(rescue) virus. After mutation, deletion or exogenous gene insertion modification of the genomic cDNA, the corresponding mutant or recombinant negative-strand RA virus can be obtained by the reverse genetic system (RGS system) ⁽¹ , ² , ³ , ⁴ > ⁵ , ⁶⁾ . The NDV genome is 15186 nucleotides in length and, like other paramyxoviruses, includes nuclear protein (NP), phosphoprotein (P), matrix protein (M), fusion protein (F), and lectin neuraminidase protein (HN). ), and the six large transcriptional coding units of the large polymerase protein (L) (Fig. 1A). In this study, GFP protein was cloned between P and M to study the proper expression of foreign protein in NDV. Like other negative-strand RNA viruses, NDV has a minimal infectious unit of ribonucleoprotein complexes, and protein-free RNA itself is not infectious. Is NDV's genomic RNA passed with N? The P and L proteins together form a nuclear protein complex, which initiates the first round of RNA transcription and translational synthesis of viral proteins, producing an infectious progeny virus ⁽ 7'1 ⁽⁾⁾ . According to this principle, in 1999 European scholars took the lead in establishing the first reverse genetic system (RGS system) for highly pathogenic NDV ( ²⁾ . At present, at least four laboratories in Europe and the United States use NDV's RGS technology to conduct intense competitive research in basic and applied research. In 2001-2002, Palese. P. et al. successively constructed a recombinant NDV B1 strain expressing the HI subtype influenza virus HA immunogen gene and a recombinant DVB1 strain expressing the H7 subtype susceptibility virus HA immunogen gene. The NDV live vector vaccine induces a protective immune response in mice and birds, respectively. However, because B1 itself is highly weak, the ability to replicate in immunized chickens is poor, so the ability to induce effective immune protection in immunized chickens is relatively weak. The experiment shows that NDV B1 strain expressing H7 subtype HA gene is NDV and The survival protection of the H7 subtype highly pathogenic avian influenza lethal challenge is only 60% and 40%, respectively, and does not prevent the replication and release of the virus in vivo ⁽¹²⁾ . Studies have shown that the NDV genome inserts exogenous reporter genes or immunogenic genes at different sites, and maintains high genetic and expression stability through continuous high-generation passages of cells or chicken embryos (11, 12, 13).

IBDV (Infectious Bursal Disease Virus) is an important pathogen that harms the healthy development of poultry industry in China and the world. IBDV is a double-stranded double-segment RNA virus (Bimaviridae), the smaller segment of the genome encodes a 90KD RA-dependent polymerase VP1, and the longer segment A encodes a small non-structural protein VP5, a large pre-cleavage Somatic proteins and their cleavage products VP2, VP4 and VP3. Eukaryotic cells heterologously express VP2-VP4-VP3 precursor protein and appropriately modify the C-segment amino acid of VP3 protein to promote the assembly of mature virions. VP2 and VP3 constitute the major structural proteins of virions, of which VP2 is the primary immunogen that induces protective neutralizing antibodies. The target cells after infection of the chicks are mainly B cells in the differentiation stage, causing pathological damage and immunosuppression of lymphoid tissues related to B lymphocyte development, especially bursa of Fabricius, resulting in more susceptible to other pathogens and failure of vaccine immunization. In the past 20 years, the virulence of IBDV epidemic strains has gradually increased. Super-virulent strains (vvIBDV) have been reported in the world for killing chickens with a mortality rate of 60~80%. In addition, since 1985, the United States has begun to isolate antigenicity. A variant of the IBDV classic strain. Vaccine immunization is the primary means of preventing IBD. Low-virulence or moderately virulence vaccines are widely used in China, but the direct and indirect economy caused by IBD every year The losses are still in the hundreds of millions. The emergence of super-toxicity poses a huge challenge to the prevention of IBD in China's poultry industry. An important cause of the failure of IBD live vaccine immunization is the widespread interference of maternal antibodies in the production of fresh-bred chicks. Due to the presence of maternal antibodies, it is forced to use a more virulent medium-virulent vaccine strain, which will inevitably cause pathological damage and immunosuppression of lymphocytes in some immunized chicks. Long-term use of live vaccines is considered to be super virulent and mutated. The important reason for the emergence of strains. For a long time, the attempts and efforts of scholars from various countries to develop new IBD vaccines to replace the traditional IBDV vaccines have been uninterrupted, and a series of important progress has been made. The VP2 subunit vaccines of different expression systems have been developed and the VP2 antigen has been expressed. Live carrier vaccines such as recombinant fowlpox virus, recombinant turkey herpesvirus/Marek's virus, and recombinant avian adenovirus have also been successful. However, due to the above-mentioned expression system, the deficiency and defects of the live virus vector itself, and the cost of use, etc., it has not been widely applied in production practice. SUMMARY OF THE INVENTION

In view of the above research background, the present inventors further improved the immunogenicity of the IBDV-expressing antigen, and avoided the interference of the NDV-specific maternal antibody on the immune effect, and constructed a recombinant NDV live vector attenuated vaccine expressing the IB2 antigen of the IBDV super virulent isolate of China. rLasot _a -VP2, for primary immunization or booster immunization against Newcastle disease and bursal disease prevention. .

Accordingly, an object of the present invention is a recombinant Newcastle disease LaSota attenuated vaccine strain expressing the VP2 gene of infectious bursal disease virus (IBDV). Preferably, the Newcastle disease LaSota attenuated vaccine strain is AV1615, and more preferably the recombinant Newcastle disease LaSota attenuated vaccine strain is rLasota-VP2.

Still another object of the present invention is to provide a method for producing the above-described recombinant Newcastle disease LaSota attenuated vaccine strain, the method comprising:

(1) constructing a transcription plasmid comprising a genomic cDNA sequence of the Newcastle disease LaSota attenuated vaccine strain into which the VP2 gene of infectious bursal disease virus (IBDV) is inserted;

(2) constructing one or more transcriptional helper plasmids comprising a cDNA sequence encoding the nuclear protein (NP) of the Newcastle disease LaSota attenuated vaccine strain, and a phosphoprotein (P) encoding the Newcastle disease LaSota attenuated vaccine strain a cDNA sequence, and a cDNA sequence encoding the large polymerase protein (L) of the Newcastle disease LaSota attenuated vaccine strain;

(3) co-transfecting the transcription plasmid and the transcriptional helper plasmid into a host cell to which the virus is replicated, and culturing the transfected host cell;

(4) Harvest the supernatant, filter and continue to pass sensitive cells or inoculate the chicken embryo allantoic cavity to rescue the recombinant virus strain. In one embodiment of the above production method, the VP2 gene of IBDV is inserted into Newcastle disease LaSota Artificially introduced sites between the genomes P, M of the attenuated vaccine strain. Preferably, the LaSota attenuated vaccine strain is AV1615.

In another embodiment of the above production method, the genomic cDNA sequence included in the transcription plasmid is located after the T7 promoter, and the genomic cDNA transcription is constituted before the sequence encoding the self-cleaving nuclease and the T7 transcription terminator. template. Preferably, the self-shearing nuclease is a hepatitis D virus ribozyme (Rib).

In another embodiment of the above production method, the cDNA sequence encoding the nuclear protein (NP) of the Newcastle disease LaSota attenuated vaccine strain in the transcriptional helper plasmid, and the phosphoric acid encoding the Newcastle disease LaSota attenuated vaccine strain are included. The cDNA sequence of the protein (P), and the cDNA sequence of the large polymerase protein (L) encoding the Newcastle disease LaSota attenuated vaccine strain are all located after the T7 promoter. Preferably, the transcription plasmid is pBR-FL-VP2, and the transcriptional helper plasmids are plasmids pBSNP, pBSP and pBSL. In a preferred embodiment, the host cell is BHK-21.

The invention also provides the use of the above recombinant Newcastle disease LaSota attenuated vaccine strain (especially rL _aS ota-VP2) for preparing a vaccine for preventing diseases caused by Newcastle disease and infectious bursal disease virus.

In this study, 10 cDNA fragments of NDV vaccine strain LaSota were amplified by RT-PCR, and the overlapping portions of the fragments were spliced and assembled into full-length cDNA clones. The sequence determination results have been registered in GenBank with accession number AY845400. Insert the VP2 gene of IBDV into the non-coding region of genomic P and M genes into the full-length genome, and then co-transfect its nuclear protein (NP), phosphoprotein (P) and large polymerase protein (L) helper plasmid to express T7. The poxvirus of the polymerase infects the cells, thereby synthesizing the anti-genomic RNA. This RNA is transcribed and replicated under the action of P, P and L proteins. The transfected supernatant was inoculated with SPF embryos to obtain an infectious virus from cDNA. Through the mutation of the base, the derivative strain of Lasota with the genetic label rLasota-VP2 was produced. The proliferated characteristics of the rescued virus on the chicken embryo were similar to those of the wild poison, and the blood coagulation price was as high as 2 ¹² . The above results showed that the genetically modified DV showed The virus can be rescued from the cDNA clone, and it is confirmed once again that NDV has the potential as a live carrier of the vaccine. The recombinant virus live vector capable of simultaneously preventing NDV and IBDV has been developed using the anti-gene operating system of the established NDV attenuated strain Lasota AV1615 strain. Bivalent (two-link) high-efficiency vaccine strain. DRAWINGS

Figure 1. Assembly of full-length NDV cDNA from subgenomic overlapping cDNA fragments generated from high fidelity RT-PCR. The cDNA fragments were ligated at a consensus restriction site and assembled in the transcription plasmid pBR322, and the RBZ and T7 terminator sequences were pre-cloned between the Eco?/ and ^// sites in the transcription plasmid pBR322 (see the specification for details). . (A) shows the first and last nucleotides of the entire full-length genome of the parental NDV. (B) display contains The NDV cDNA clone of the VP2 gene of BDV shows the position of a single cDNA in the horizontal line below the genetic map.

Figure 2. Nucleotide changes introduced into the modified enzyme site by RT-PCR and sequenced by using the PRISM kit (Perkin-Elmer) and Applied Biosystems ABI310 automated sequencer. Boxed is a nucleotide substitution introduced in pBR l-10 by PCR mutagenesis (mutation from A to G:).

Figure 3. Immunofluorescence analysis of rLasota-VP2 expressing antigen protein of recombinant Newcastle disease virus. rLasota-VP2 chicken embryo passage F2 generation infected BHK-21 cells (A & C) and uninfected BHK-21 cells (B & D), respectively, with chicken anti-Newcastle disease high serum (A & B) and chicken anti-IBDV high immunity Serum (C & D) was an indirect immunofluorescence assay for primary antibodies. The results showed that the infectious bursal disease virus VP2 antigen was effectively expressed in the recombinant Newcastle disease virus rLasota-VP2. ..

Figure 4. Comparison of chick embryo growth kinetics of recombinant Newcastle disease virus live vector vaccine expressing VP2 antigen of IBDV super virulent Gx strain. SPF chicken embryo passage F2 generation seed toxic allantoic fluid was inoculated with 10 days old SPF chicken embryos at a dose of lxl0 ³ EID _5Q . Ten chick embryos were taken at different time points, and the urine stocks were harvested separately. EID _5Q titration was performed as usual by 10 times continuous gradient dilution.

Figure 5. Western-blot detection of recombinant Newcastle disease virus rLasota-VP2 expressing infectious bursal disease virus VP2 antigen. rLasota-VP2 strain and NDV LaSota strain were infected with BHK-21 cells according to MOI 1. The infected cells were collected 24 hours after infection, SDS-PAGE electrophoresis, chicken anti-IBDV high serum-free primary antibody, HRP-conjugated rabbit Anti-chicken IgG is the secondary antibody and immunoblot assay is performed. The results showed that the infectious bursal disease virus VP2 antigen was correctly expressed in the recombinant Newcastle disease virus rLasota-VP2. (lane 1, protein molecular weight marker; lane 2, rLasota-VP2 infected BHK-21 cells; lane 3, NDV LaSota strain).

Figure 6. Expression of IBDV super virulent Gx strain VP2 antigen Recombinant Newcastle disease virus live vector bivalent vaccine immunization 1 week old SPF chicks induced Newcastle disease virus specific HI antibody immune response. The vaccine was immunized with 7-day-old chicks by intranasal and intraocular injections at a dose of 2× ^{10 6} EID ₅₍₎ for a total volume of 100 μΐ. After the immunization, the venous venous blood was collected for the first, second, third and fourth weeks, and NDV-specific HI was performed. Antibody detection.

Figure 7. Plasmid map of pBTRT.

Figure 8. DNA sequence of the pBTRT plasmid. The first italic part: T7 promoter; underlined part - ribozyme sequence; second underlined italic part: T7 terminator.

Figure 9. Plasmid map of pBRN-FL-VP2.

Figure 10. DNA sequence of the pBR-FL-VP2 plasmid. The underlined italic part is the VP2 gene.

Figure 11. The AV1615 genomic cDNA sequence, wherein 122 to 1591 bp is the coding sequence for gene P, The 1887 to 3074 bp is the coding sequence of the gene P, and the 8381 to 14995 bp is the coding sequence of the gene L. Figure 12. Sequence of plasmid pBSNP, the underlined italic portion is the coding sequence for the NP gene.

Figure 13. The sequence of the plasmid pBSP, the underlined italic part is the coding sequence for the P gene.

Figure 14. Sequence of plasmid pBSL, the underlined italic portion is the coding sequence for the L gene. detailed description

The invention is described in detail below with reference to the embodiments, which are intended to illustrate the invention, but not to limit the scope of the invention. The scope of the invention is defined by the appended claims. Example 1 Expression of the VP2 gene of infectious bursal disease virus (IBDV)

Recombinant Newcastle disease LaSota attenuated vaccine strain construction Cell and virus

BHK-21 cells (milk hamster kidney cell ATCC CCL-10), medium is DMEM containing 10% fetal bovine serum (Hyclone) (Dulbecco's modified Eagle's medium); NDV Lasota vaccine strain AV1615 (purchased from Chinese veterinary microbes) Collection Management Center (CVCC). The 9-day-old SPF chicken embryo chorioallantoic cavity was inoculated and half-infected with chicken embryos (EID _5G ) was titrated and stored at -70 °C for free; chicken anti-DV high-preserved serum was prepared by the laboratory (refer to Chu, HP). , G. Snell, DJ Alexander, and GC Schild. 1982. Avian Pathol 11 :227-234 ); SPF chicken embryos and SPF chickens were provided by the SPF Laboratory Animal Center of Harbin Veterinary Research Institute. IBDV super virulent strain IBDV GX strain was purchased from the Harbin Veterinary Research Institute of Chinese Academy of Agricultural Sciences. Construction of transcription vectors

The genomic RNA transcription vector pBTRT is based on the low-copy cloning vector pBR322 (Invitrogen) and in EcoRI/ra! The site was inserted into the T7 promoter (T7 promotor), the hepatitis D virus ribozyme (Rib) and the T7 transcription termination signal (T7 terminal), which were constructed by the laboratory. The DNA fragment cloned between the T7 promoter and the ribozyme can be transcribed under the action of T7 RNA polymerase, and due to the autocatalytic function of Rib, the 3' end of the transcript can be ensured to be exactly identical to the cloned DNA fragment. Construction of full-length cDNA of recombinant NDV LaSota strain inserted into VP2 gene of IBDV

In order to establish a reverse genetic operating system for the NDV Newcastle disease Lasota vaccine strain, the corresponding gene must be constructed first. The full-length cDNA clone of the group was used as a transcript template for the genomic negative-strand RNA. To this end, ten cDNA clones covering the entire genome were constructed, and the pBTRT was ligated in the low-copy plasmid transcription vector plasmid using the cleavage site of the overlapping portion of each fragment. A complete cDNA clone of 15186 nt was obtained by assembly. The sequence analysis results were registered in GenBank under accession number AY845400, and the VP2 gene of IBDV (GenBank AY444873) was cloned into P, M. The T7 RNA polymerase promoter was prefixed to the 5' end of the full-length cDNA fragment, and a self-catalyzing hepatitis delta ribozyme (GenBank X04451) and a T7 transcription termination signal were ligated to the cDNA fragment. The constructed plasmid was named pBRN-FL-VP2. In order to avoid methylation of the Xba site, the 6178th base of the F protein coding region in the genomic cDNA was synonymously changed from T to C by the PCR genome and used as a molecular marker for rescue of the virus. As with other investigators, we also introduced two extra G at the 5' end of the genomic cDNA at the T7 polymerase promoter, which may contribute to viral rescue of paramyxovirus reverse genetic manipulation. The details are as follows: DV Lasota vaccine strain virus chicken embryo inoculation of allantoic fluid The genomic RA was extracted by conventional methods (animal virology, second edition); the whole gene component was 10 fragments (F1-F10) with overlapping terminal portions for RT-PCR. The amplified cDNA fragment was cloned into the pBluescript (Clontech) Smal site and confirmed by sequence analysis to be identical to the viral genomic RNA sequence; the sequence assay results were registered in GenBank under accession number AY845400. In order to introduce a specific molecular genetic marker, the methylation of the genomic cDNA of Lasota vaccine strain was selected at 6172 bp; the ααΐ site, the sequence was TCTAGATCA, which was mutated to TCTAGACCA by PCR, so that it was no longer subject to methylase. Identification, and thus can be recognized by the restriction enzyme 3⁄4«Ι; the restriction enzyme cleavage sites present in overlapping portions of adjacent fragments are ligated into assembled NDV genomic cDNA (Fig. 1A); in addition, reference [15], The SDS-Protease-K method proposed the IBDV genome and stored at -70 °C for use as an RT-PCR template. The RT-PCR reverse transcription system was 20 μl. The following components, viral RNA, IBDV VP2 gene upstream and downstream primers, dNTP, and water were sequentially added to a 500 μl fistula. 65 ° C water bath 5 min; then add 5 χ 1st buffer 4μ1, O.lmol / L DTT 2μ1, RNase inhibitor (20 υ / μ1) 1μ1, mixed and 37 ° C water bath 2min; added M-MLV (rat source) Reverse transcriptase) (lOU/μΙ) 1 μl, 37 Ό water bath reaction for 50 min, the reaction was stopped in a 70 ° C water bath for 15 min. The cDNA of the VP2 gene ORF amplified by RT-PCR was used as a template for PCR amplification, and the following primers were added to the system. Upstream primer 5, gtttaaacttagaaaaaatacgggtagaacgccaccatgacgaacctgcaagat 3', downstream bow I 5, gtttaaacgtcaccttagggcccgg 3Ό PCR reaction step: pre-denaturation at 95 ° C for 10 min, in the order of 94 ° C lmin, 53.8 ° C lmin, 72 ° C 2 min, after 30 cycles, The final extension was 72 min at 72 °C. The PCR product was digested by cadaveric/^1 and cloned into the Pmel site artificially introduced between the genomes of LaSota Newcastle disease virus strains P and M, and pre-loaded with gene termination and gene initiation sequence (GE/GS) (TAAAGAAAAAA/ T/ACGGGTAGAA ) , and cloned into the transcription vector pBTRT to construct a Newcastle disease LaSota attenuated genome containing the IBDV VP2 gene. The plasmid pBRN-FL-VP2 (Fig. IB) was recorded; the open reading frame (OF) cDNAs expressing the nuclear protein (NP), phosphoprotein (P) and large polymerase protein (L) genes were cloned immediately in pBluescript ll SK ( +/-) The Sma I site downstream of the plasmid T7 promoter constitutes the transcriptional helper plasmids pBSNP, pBSP and pBSL, respectively. Rescuing infectious DV from recombinant full-length cDNA clones (virus rescue)

In order to rescue infectious recombinant NDV from the cloned recombinant cDNA, BHK-21 cells were first co-transfected with pBRN-FL-VP2 and a helper plasmid expressing NDV NP, P, L proteins. The fusion protein F0 of NDV must be lysed into F1 and F2 to be infectious. For the weak attenuated strain of Lasota, BHK-21 cells can not secrete the trypsin required for cleavage of F0 protein, so the medium should be replaced with serum-free culture at this time. The TPCK (toluenesulfonylalanyl chloromethanone)-treated trypsin (Sigma, Cat# T8802) ( lg/ml) was added to the medium for 2-3 days, and the transfected cells were harvested and seeded at 9-11. Day old SPF chicken embryo. After 4 days, the chicken embryo allantoic fluid was harvested, and the blood coagulation (HA) test results were positive. The HA value of different chicken embryos was between 2 ⁸ _ ⁿ ; the NDV immune serum hemagglutination inhibition (HI) test also showed positive results. The virus-positive allantoic fluid was harvested as the F1 generation of the rescue virus rLa _SO ta-VP2. Further RT-PCR and sequence analysis showed that the 6178-site base of the F1 generation rescued the viral genomic cDNA was C, but not the C of the original LaSota parental strain, which was completely consistent with the expectation (Fig. 2). The results showed that the NDV LaSota vaccine strain genomic cDNA clone was successfully used to rescue the infectious progeny virus rLasota-VP2o by reverse genetic manipulation technique. More specifically, the experimental steps are as follows:

BHK-21 cells were inoculated with 50% to 80% monolayers in a 35mm six-well plate and artificially infected with recombinant poxvirus expressing T7 polymerase. The transcription plasmid and helper plasmids pBR-FL-VP2, pBS P, pBSP and pBSL were respectively _{_{5μ β, 2.5μ β 1.25 g 1.25μ}} β, co-transfected BHK-21 cells using CaP04 transfection kit (Invitrogene), the operation proceeds according to kit instructions. 8-12 hours after transfection, the transfection mixture was discarded, and the cells were shocked with PBS containing 10% DMSO for 2.5 minutes, added to complete DMEM overnight, replaced with serum-free medium for the first day, and added with TPCK (lg / Ml) After 2-3 days of incubation, the culture supernatant was harvested, filtered through a 0.22 um pore filter and inoculated with SP-1 embryoid sac cavity for 9-1 1 day; SPF embryos after inoculation were further cultured, 3-5 days, chicken embryos were taken. 50 μl of allantoic fluid was routinely subjected to hemagglutination (HA) and hemagglutination inhibition (HI) tests of Newcastle disease virus (Thayer SG, Nersessian BN, Rivetz B, Fletcher OJ. Comparison of serological tests for antibodies against Newcastle disease virus and infectious Bronchitis virus using ImmunoComb solid-phase immunoassay, a commercial enzyme-linked immunosorbent assay, and the hemagglutination-inhibition assay. Avian Dis. 1987 Jul-Sep; 31(3): 459-63. The HA and HI test results were positive for allantoic fluid, frozen at -70 °C, and the chicken embryo and chicken embryo were fibrillated on the 9-10 day according to the conventional method. Dimensional cell titration of EIDso and PFU virus content per ml ⁽¹⁴⁾ . The Newcastle disease virus was named as rLasota-VP2. Example 2 Immunofluorescence analysis of recombinant Newcastle disease virus rLa _SO ta-VP2 expressing antigen protein

The NDV LaSota vaccine strain transiently infects mammalian cells cultured in vitro. In order to demonstrate the replication of rLasota-VP2 virus in BHK-21 cells and viral antigen expression, rLasot _a- VP2 chicken embryos were passaged into F2 generation to infect BHK-21 cells (3A & 3C) and uninfected BHK-21 cells (3B & 3D). Indirect immunofluorescence spectrometry was performed with chicken anti-Newcastle disease high serum (3A & 3B) and chicken anti-IBDV deprived serum (3C & 3D) as primary antibodies. The results showed that a strong positive reaction was observed under fluorescent microscopy of the virus-infected cells (Fig. 3A & 3C), while the SPF chicken control serum fluorescent staining was negative (Fig. 3B & 3D). Example 3 Western-Blot identification of recombinant NDV expressing IBDV VP2 protein BHK-21 cells of expanded rLaSota-VP2 were discarded, 1/10 volume of PBS was added, cells were suspended, and an equal volume of 2XSDS lysis buffer was added. After liquid boiling water was lysed for 10 min, centrifuged at 12000 g for 10 min, and the supernatant was taken for SDS-PAGE (Bio-Rad); the protein was electrotransferred (Bio-Rad) onto a nylon membrane (Ameresco), and 10% skim milk was blocked overnight, PBST (0.05 %Tween20) After washing, add 1: 50 PBST diluted primary antibody (chicken anti-IBDV high serum). The secondary antibody was horseradish peroxidase (HRP)-labeled rabbit anti-chicken goat anti-mouse IgG (Sigma), diluted 1:2500 times PBST. DAB (diaminobiphenyl gum, Sigma) was developed for 3 to 5 minutes and then quenched with deionized water. The results are shown in Figure 5, demonstrating that the infectious bursal disease virus VP2 antigen is efficiently expressed in the recombinant Newcastle disease virus rLasota-VP2. Example 4 Growth characteristics and pathogenic characteristics of rNDV in chicken embryos To determine the growth characteristics of chicken embryos of rLaSota-VP2 rescued by reverse genetic manipulation and its pathogenicity to chicken embryos, expression of IBDV super virulent Gx strain VP2 antigen was performed. Comparison of chicken embryo growth kinetics of recombinant Newcastle disease virus live vector vaccine. The SPF chicken embryos were passaged into the F2 generation seed toxic allantoic fluid to inoculate 50 day old SPF chicken embryos at a dose of lxlO ³ EID ₅ o. 10 chicken embryos at different time points, 100 μΐ of urine stocks were harvested from each chicken embryo, and 10 times continuous gradient dilution was performed as usual. ₅ ο titration, the results showed that rLaSota-VP2 chicken embryo growth kinetics and wild-type Newcastle disease LaSota attenuated The vaccine strain is similar. According to the OIE standard, the intracerebral pathogenicity index (ICPI) of rLaSot _a -VP2 was determined to be 0.35, the venous disease index (IVPI) was 0, and the average lethal time (MDT) of chicken embryos was greater than 96 hours. The results indicated that the reverse genetic manipulation of the rescue virus rLasota-VP2 still maintained the high titer growth and low lethal biological characteristics of the DV LaSota vaccine parent strain in chicken embryos. Example 5 Induction of the immune effect of protective antibodies

To determine the immunogenicity of the virus rLa _SO ta-VP2 as attenuated vaccine against SPF chicks by reverse genetic manipulation, rLasota-VP2 was immunized with 7-day-old SPF chicks by intranasal dosing (Harbin Veterinary Research Institute SPF Experimental Animal Center) Provided), each dose of 2xl0 ⁶ EID _5Q , a total of lOOul volume; after the first, second, third, and fourth weeks of immunization, the wing vein blood was collected for MDV-specific HI antibody detection. As a result, as shown in Fig. 6, the rLasota-VP2 recombinant virus induced NDV-specific HI antibody level response at the sputum level 3 weeks after immunization of the chicks.

The IBDV super virulent Gx strain VP2 antigen was recombined with Newcastle disease virus rLasota-VP2 to immunize 1 week old SPF chicks. A significant IBDV virus VP2 antigen-specific antibody immune response was detected 3 weeks after immunization. (Results are shown in Table 1) Table 1. Expression of IBDV super virulent Gx strain VP2 antigen Recombinant Newcastle disease virus _r Lasota-VP2 Immunization 1 week old SPF chicks before and after E3DV specific antibody immune response

Antibody titer **

SPF Chicken

Group vaccine VP2 specific ELISA (OD _490nm ) AGP

(feather)

Before attacking, before attacking, after attacking

0.04 ±0.01 0.25 ±0.09

1 10 rLaSota 2x10' +

(a) (a)

0.12+0.04 0.19 +0.04

2 33 rLasota-VP2 2x10 , '6

(b) (b)

0.03 ±0.01 0.27 ±0.07

3 8 PBS +

(a) (a)

* Recombinant Newcastle disease virus rLa _SO ta-VP2 was immunized with 7-day-old chicks by intranasal and eye-dropping methods, each with a total volume of lOOul; 21 days after immunization, infectious bursal disease virus GX strain 4X10 ³ ELD _{5G was used} . Nasal, eye-point infections to attack;

** 19 days after immunization (26 days old) Serum was collected for NDV-specific HI antibody, including ELISA antibody detection based on prokaryotic expression of VP2 antigen and IBDV routine serum agar diffusion (AGP) antibody detection; surviving chicken on day 7 after challenge Detection of ELISA antibody based on prokaryotic expression of VP2 antigen and detection of routine serum AGP antibody; a/b, significant difference Finally, the rLasota-VP2 recombinant virus was immunized against 1-week-old SPF chicks to assess its immunoprotective effect against the Newcastle disease virulent lethal challenge and the IBDV supertoxic lethal challenge. The results are shown in Table 2 and Table 3, respectively. The results showed that the rLasota-VP2 recombinant virus vaccine immunized chicks to 100% complete immune protection against Newcastle disease virulent strain and IBDV super virulent lethal challenge, no disease, no death, the effect is very significant . Table 2. IBDV super virulent Gx strain VP2 antigen recombinant Newcastle disease virus rLasota-VP2 immunization 1 week old SPF chicks immune protection against Newcastle disease virulent lethal challenge

SPF chick NDV F48E9 ^b group vaccine ^a

^(study ) morbidity death

1 10 rLaSota 0/1 1 0/1 1

2 11 rLasota-VP2 0/10 0/10

3 1 1 PBS 10/10 10/10 a. Recombinant Newcastle disease virus rLasota- VP2 is immunized by intranasal and eye-dropping methods. 7-day-old chicks, each dose of 2x10' EIDso is a volume of lOOul;

b. 21 days after immunization (28 days old) using NDV virulent F48E9 strain (provided by Chinese Veterinary Drug Surveillance Institute) 1X10' ELD _5Q dose was attacked by intramuscular injection and continued for 14 days.

IP060052 Table 3. Expression IBDV super virulent Gx strain VP2 antigen recombinant Newcastle disease virus rLasota- VP2 immunization 1 week old SPF chick immune protection against IBDV super virulent attack bursal changes immune protection

SPF

Histopathological damage ¹

Group chick (feather) vaccine weight ( g)

7d onset 7d death

3d 7d 3d . 7d

3d ^a 7d'

1 6 10 rLasota-VP2 269 soil 36(A) 1.17 soil 0.37 1.18 soil 0.43(A) 0/10 0/10 rLaSota 201 soil 10(B) 1.11 +0.21 0.66 soil 0.14(B) 6/6 2/6

3 7 8 PBS 191 soil 36 (B) 1.01 soil 0.23 0.56 soil 0.13 (B) 8/8 4/8

Recombinant Newcastle disease virus rLasota-VP2 was immunized with 7-day-old chicks by intranasal and eye-dropping, 2χ10 ^δ EE) _5Q per dose, a total volume of lOOul;

21 days after immunization (28 days old), IBDV super virulent Gx strain was challenged by nasal infection. The dose was 4000 ELD per _gallon , and it was observed for 7 days after challenge.

A.3d is observed after 3 days of culling;

B.7d was observed after 7 days of culling;

c. Weight according to the statistical results of the 7d group;

d. Ratio of weight ratio of chicken capsule to weight ratio of chicken in the same age

e. The 3d group contained sick and culled chickens. The number of "+" was proportional to the degree of inflammatory damage of the cystic lymphoid follicles; the 7d group included natural death and artificial culling, "+" number and cystic follicle atrophy

10 degrees proportional;

f. The morbidity and mortality are based on the statistical results of the 7d group;

Αί , the difference is extremely significant

Newcastle disease virus (NDV) is a non-segmented single-stranded RA virus with clear genomic structure and functional background, and relatively stable genetics. The foreign gene inserted in recombinant NDV can remain in the cell or chicken embryo after high passage. Stable expression, very suitable as an expression or vaccine vector. NDV attenuated vaccine can be used by drinking water, spraying, nasal drops or eye drops. It is easy to use and extremely low cost. NDV is a two-week attenuated vaccine constructed as a live avian influenza vaccine. It is of great economic significance.

The invention adopts the RGS of Newcastle disease virus (NDV) as the platform, and the protective immunogen VP2 protein of IBDV is the target gene, and the corresponding transcription termination (GE) sequence of the DV genome P gene and the transcription initiation of the M gene are added at the 5th end. The (GS) sequence was inserted into the non-coding region between the P gene and the M gene in the genome, and a recombinant Newcastle disease virus LaSota attenuated vaccine strain rLaSota-VP2 expressing the infectious bursal disease VP2 protective immunogen gene was constructed as a preventive infectious agent. A bivalent attenuated vaccine for bursal disease. Immunofluorescence and estern-blot assays showed that VP2 antigen was correctly and stably expressed in recombinant virus. Chicken embryo growth motility test and brain pathogenicity index test showed that rLaSota-VP2 maintained the high titer growth and low pathogenicity of chicken embryos of Newcastle disease virus LaSota attenuated vaccine strain. Newcastle disease virulent lethal challenge and IBDV super-toxic lethal challenge experiments prove that rL _aS ota-VP2 recombinant virus forms an effective immune protection against the Newcastle disease virulent strain and IBDV super virulent lethal attack. references

1. Takaaki Nakaya, Jerome Cros, Man-Seong Park, Yurie Nakaya, Hongyong Zheng, Ana Sagrera, Enrique Villar, Adolfo Garci'A-Sastre, and Peter Palese. 2001. Recombinant Newcastle Disease Virus as a Vaccine Vector Journal of Virology, 75: 11868-11873

2. Ben PH Peeters, Olav S. Deleeuw, Guus Koch and Arnol. J. Gielkens 1999. Rescue of Newcastle Disease Virus from Cloned cDNA: Evidence that Cleavability of the Fusion Protein Is a Major Determinant for Virulence. Journal of Virology. 5001-5009 3. Zhuhui Huang, Aruna Panda, Subbiah Elankumaran, Dhanasekaran

Govindarajan, Daniel D. Rockemann, Wokou Sib a K. Samal. 2003. The

Virulence. Journal of Virology.78: 4176-4184

4. Zhuhui Huang, Sateesh Krishnamurthy, Aruna Panda, and Siba K. Samal. 2003. Newcastle Disease Virus V Protein Is Associated with Viral Pathogenesis and Functions as An Alphalnterferon Antagonist. Journal of Virology.77:8676-8685

5. Teshome Mebatsion, Leonie TC de Vaan, Niels de Haas, Angela Ro'*mer-Oberdo"rfer, and Marian Braber. 2003. Identification of a Mutation in Editing of Defective Newcastle Disease Virus Recombinants That Modulates P-Gene mR A Editing And Restores Virus Replication and Pathogenicity in Chicken Embryos. Journal of Virology.77:9259-9265

6. Man-Seong Park, Adolfo Garcia-Sastre, Jerome F. Cros, Christopher F. Basler, Hess Peter Palese. 2003. Newcastle Disease Virus V Protein Is a Determinant of Host Range Restriction. Journal of Virology.77:9522- 9532

7. Z. Huang, S.Elankumaran, A P and S.K, Samal.2003,. Recombinant Newcastle

Disease Virus as a Vaccine Vector. Poultry Science .82:899-906

8. Gabriele Neumann, Michael A. Whitt and Yoshihiro Ka aoka. 2002. A decade after the generation of a negative-sense RNA virus from clond cDNA-what have we learned?

Journal of General Virology. 83:2635-2662

9. Angela Romer-Oberdorfer, Egbert Mundt, Teshome Mebatsion, Ursula J.

Buchholz. 1999. Generation of recombinant lentogenic Newcastle disease virus from cDNA.

Journal of General Virology.80:2987-2995

10. B. P. H. Peeters, Y.K. Gruijthuijsen, O.S. de Leeuw, Wokou A. L. J. Gielkens. 2000. Genome replication of Newcastle disease virus: involvement of the rule-of-six. Archives of Virology.145:1829-1845

11. Z. Huang, S. Elankumaran, AS Yunus, and SK Samal. 2004. A Recombinant Newcastle Disease Virus (NDV) Expressing VP2 Protein of Infectious Bursal Disease Virus (BDV) Protects against NDV and IBDV. Journal of General Virology. :10054-10063

12. D. E. S ayne, D.L.Suarez, S.Schultz-Cherry, T.M.Tumpey, P.Palese, and A.Garcia-Sastre.2002.Recombinant Paramyxovirus Type 1 -Avian Influenza-H7 Virus as a

Vaccine for Protection of Chickens Against Influenza and Newcastle Disease. AVIAN DISEASES.47:1047-1050

13. Ines Engel-Herbert a, Ortrud Werner b, Jens P. Teifke c, Teshome Mebatsion d, Thomas C. Mettenleiter a, Angela Ro"mer-Oberdo" rfer a.2002. Characterization of a recombinant Newcastle disease virus expressing the green Fluorescent protein. Journal of Virological Methods. 108: 19-28

14. Yin Zhen, Liu Jinghua. 1997. Animal Virology (Second Edition) Science Press.

15. Wang X, Fu C and Gao H Molecular and antigenic characterization of very virulent infectious bursal disease virus strain Gx isolated in China. 2003, Agricultural Sciences in China Vol.2 (5) : 566~572

Claims

Rights request

A method for producing a recombinant Newcastle disease LaSota attenuated vaccine strain expressing the infectious bursal disease virus (IBDV) VP2 gene, the method comprising:

(1) constructing a transcription plasmid, wherein the transcription plasmid is pBR-FL-VP2, and the nucleotide sequence thereof is shown in SEQ ID No. 2;

(2) constructing a transcriptional helper plasmid, wherein the transcriptional helper plasmid comprises the following three plasmids: a plasmid comprising a cDNA sequence encoding the nuclear protein (NP) of the Newcastle disease LaSota attenuated vaccine strain, including the Newcastle disease LaSota attenuated a plasmid for the cDNA sequence of the phosphoprotein (P) of the vaccine strain, and a plasmid comprising the cDNA sequence encoding the large polymerase protein (L) of the Newcastle disease LaSota attenuated vaccine strain;

(4) Harvesting the supernatant, filtering to continue the passage of sensitive cells or inoculation into the chicken embryo allantoic cavity to rescue the recombinant virus strain, wherein the host cell is a cell line stably expressing T7 polymerase.

2. The method according to claim 1, wherein said transcriptional helper plasmids are plasmids pBSNP, pBSP and pBSL, respectively, which are nuclear proteins (NP) and phosphoproteins encoding the Newcastle disease LaSota attenuated vaccine strain.

The cDNA sequences of (P) and large polymerase protein (L) were cloned separately from the pBluescript II (+/-) plasmid T7 promoter.

3. The method according to claim 1 or 2, wherein the host cell is BHK-21.

4. The NDV LaSota vaccine strain progeny virus rLasota-VP2 prepared according to the method of claim 1 or 2.

The use of the NDV LaSota vaccine strain progeny virus rLasota-VP2 according to claim 4 for the preparation of a vaccine for preventing diseases caused by Newcastle disease virus and IBDV.