WO2007025420A1

WO2007025420A1 - Low virulent strain of recombinant newcastle disease lasota vaccine expressing ha protein of avian influenza-h5 virus

Info

Publication number: WO2007025420A1
Application number: PCT/CN2006/000056
Authority: WO
Inventors: Zhigao Bu; Hualan Chen
Original assignee: Zhigao Bu; Hualan Chen
Priority date: 2005-09-02
Filing date: 2006-01-13
Publication date: 2007-03-08
Also published as: CN1298845C; CN1772887A

Abstract

Low virulent strain of recombinant newcastle disease LaSota vaccine expressing wild or mutant hemagglutinin(HA)protein of avian influenza-H5 virus is provided.Particularly, Low virulent strains of recombinant newcastle disease LaSota vaccine are rLasota-H5wtHA and rLasota-H5mutHA.The present invention also provides method for preparing said low virulent strain,and the use of such strain in preparing vaccine for preventing avian influenza.

Description

Recombinant Newcastle disease LaSota attenuated vaccine strain expressing avian influenza virus H5 subtype HA protein

The present invention relates to the field of recombinant viral vaccines, and more particularly to a recombinant Newcastle disease LaSota attenuated vaccine strain expressing a gene encoding a wild type or mutant avian influenza virus H5 subtype hemagglutinin (HA) protein, more specifically The recombinant Newcastle disease LaSota attenuated vaccine strains were rLasota-H5wtHA and rLasota-H5mutHA. The invention also discloses a method for preparing the recombinant Newcastle disease LaSota attenuated vaccine strain and the application of the recombinant Newcastle disease LaSota attenuated vaccine strain in preparing a vaccine for preventing avian influenza. Background technique

Newcastle disease virus (DV) is a non-segmented single-stranded negative-strand RNA virus, which is an important member of the Paramyxoviridae family and a model virus. Recombinant NDV has extraordinary advantages as a live virus vaccine vector: NDV attenuated vaccine including LaSota strain has been used for poultry epidemic prevention for a long time, and its safety and efficacy have been fully proved; NDV inheritance is relatively stable, only one serotype, poison The possibility of recombination and virulence reversion between plants is extremely small; the replication process is completed in the cell paddle, from RNA to RNA, there is no possibility of DNA phase and cell genome integration; NDV attenuated vaccine can induce systemic humoral immunity at the same time, local The formation of mucosal immunity and cellular immunity forms a more comprehensive and accurate immune protection; it can be used in a variety of ways by drinking water, spraying, nasal drops, eye drops or injection; NDV has high titer of chicken embryo growth characteristics, Production costs are extremely low ⁽¹ ' ^Wu2 ' ¹³⁾ . NDV is a highly contagious and highly lethal poultry epidemic. The attenuated vaccine used in Newcastle disease prevention in China is at least 10 billion feathers per year. The economic significance of DV as a carrier for live virus vaccines is enormous.

The reverse genetic operation of negative-strand RNA viruses is a process of producing new viruses by manipulating viral genomic cDNA. The basic process is: 1 assembling a complete viral genome (or recombinant genome) cDNA clone, precisely at the 5' end. After being affixed to the T7 promoter, 3, the terminal is precisely fused to the self-cleaving nuclease sequence and the T7 transcription termination signal, constitutes a genomic cDNA transcription template; 2 is a genomic cDNA transcription template and a transcription-related functional structural protein necessary for initiating viral replication. Such as nuclear protein (NP), phosphoprotein (P) and polymerase proteins

(L) expression plasmid (T7 promoter) together, co-transfected with virus replication-expressing cells expressing T7 polymerase; 3 24-72 hours after harvesting the culture supernatant, filtering to continue sensitive cell passage or inoculation of chicken embryo allantoic sac Cavity rescue

(rescue) virus. After mutation, deletion or exogenous gene insertion modification of the genomic cDNA, the corresponding mutation or recombinant negative strand can be obtained by reverse genetic system (RGS system). RNA virus (I'2, 3'4'5'6).

The NDV genome is 15186 nucleotides in length and, like other paramyxoviruses, includes nuclear protein (NP), phosphoprotein (P), matrix protein (M), fusion protein (F), and lectin neuraminidase protein (HN). ), and the six large transcriptional coding units of the large polymerase protein (L) (Fig. 1A). Like other negative-strand RNA viruses, NDV has a minimal infectious unit of ribonucleoprotein complexes, and protein-free RNA itself is not infectious. The genomic RNA of NDV forms a nuclear protein complex together with P, P, and L proteins, and initiates the first round of RNA transcription and translational synthesis of viral proteins to produce infectious progeny virus ⁽⁷ ' ^1Q) . According to this principle, in 1999 European scholars took the lead in establishing the first reverse genetic system (RGS system) for highly pathogenic DV ( ²⁾ .

Avian influenza is an important disease that jeopardizes the development of the world poultry industry. Highly pathogenic avian influenza can cause 100% of deaths in infected poultry and is classified as a Class A severe infectious disease by the OIE. The H5 subtype has historically caused an outbreak of avian flu. Since the end of 2003 to the beginning of 2004, Asian countries such as South Korea, Japan, Vietnam, Thailand, Indonesia, Cambodia, Laos, and mainland China have successively outbreaked H5 subtype highly pathogenic avian influenza, and existing avian influenza inactivated vaccines and poultry pox live carriers. The vaccine has the advantages of safe and immune protection, but it still has the disadvantages of high manufacturing cost and relatively inconvenient use. It is of great practical significance to develop a new generation of vaccines that are efficient, safe, low-cost and easy to use.

Avian Influenza (AI) is an avian infection and/or disease syndrome caused by Avian Influenza Virus (AIV). AIV is taxonomically classified as: Viral (Vira) - Orthomyxoviridae ( Orthomyxoviridae) - Influenza Virus A and B - Avian Influenza Virus o The avian influenza virus belongs to the influenza A virus of the genus Orthomyxoviridae, and the genome consists of 8 single-strand negative chains. Composition of RNA fragments. The surface structural proteins hemagglutinin (HA) and neuraminidase (NA) are different in antigenicity and are classified into different subtypes. Hemagglutinin (HA) is the main immunogenic protein of avian influenza virus, which induces the production of antibody-specific specific humoral and cellular immune responses. Anti-HA antibodies can interfere with the binding of viruses to sialic acid receptors. The process of fusion of the viral envelope with the endocytic membrane neutralizes the infection of the virus.

The virulence of AIV is closely related to the amino acid sequence of its surface structural protein HA cleavage site. The low virulence AIV HA cleavage site has only one basic amino acid arginine (R). This structure determines that these viruses can only reproduce in the respiratory system after infecting animals, because only the airway epithelial cells contain a fine A specific trypsin-like protease that cleaves HA0, which contains a single basic amino acid arginine at the cleavage site, into active HA1 and HA2, and initiates the adsorption and replication cycle of the virus. High pathogenicity H5 and H7 subtypes The AIV HA cleavage site contains a contiguous number of basic amino acid residues, RKKR, which can be recognized and cleaved by proteases widely present in various cells in the body, thus having a wide range of tissue tropism. Once infected, it can cause systemic spread and lead to rapid death. versus The highly pathogenic H5 and H7 subtypes AIV are potentially more harmful to humans than the subtypes of influenza viruses such as H1, H2, H3 and H9, which can spread systemically and may spread throughout the body. Quickly die.

In 2001-2002, Palese. P. et al. successively constructed a recombinant NDV B1 strain expressing the HI subtype influenza virus HA immunogen gene and a recombinant NDVB1 strain expressing the H7 subtype influenza virus HA immunogen gene, and immunological tests showed these two NDVs. Live vector vaccines induce protective immune responses in mice and birds, respectively. However, because B1 itself is highly weak, the ability to replicate in immunized chickens is poor, so the ability to induce effective immune protection in immunized chickens is relatively weak. Experiments have shown that NDV B1 strain expressing H7 subtype HA gene is NDV and The survival protection of H7 subtype highly pathogenic avian influenza lethal challenge is only 60% and 40%, respectively, and does not prevent the replication and release of the virus in vivo ⁽¹²⁾ . Studies have shown that the NDV genome inserts exogenous reporter genes or immunogenic genes at different sites, and maintains high genetic and expression stability through continuous high-generation passages of cells or chicken embryos ⁽¹¹ ' ¹² ' ¹³⁾ . However, due to the above-mentioned expression system, the deficiency and defects of the live virus vector itself, and the cost of use, etc., it has not been widely applied in production practice. Summary of the invention

In view of the above research background, the present inventors further improved the immunogenicity of the avian influenza virus-expressing antigen, and constructed a recombinant NDV live vector two-week attenuated vaccine rLasota-H5wtHA and rLasota-H5mutHA expressing wild-type and mutant avian influenza virus HA immunogen proteins. Animals are immunized by various methods such as nose drops, eye drops, intramuscular injection and even drinking water, spray inhalation, etc. to induce a protective immune response against avian influenza, and are used for the prevention of immunity against avian Newcastle disease and avian influenza.

Accordingly, it is an object of the present invention to provide a recombinant Newcastle disease LaSota attenuated vaccine strain which expresses a gene encoding a wild type or mutant avian influenza virus H5 subtype hemagglutinin (HA) protein.

In one embodiment, the gene encoding the wild type HA protein has the nucleotide sequence set forth in SEQ ID No. 1.

In another embodiment, the gene encoding the mutant HA protein has the nucleotide sequence shown in SEQ ID No. 2.

Preferably, the Newcastle disease LaSota attenuated vaccine strain is AV1615, and more preferably the recombinant Newcastle disease LaSota attenuated vaccine strain is rLasota-H5wtHA and rLasota-H5mutHA.

Still another object of the present invention is to provide a method for producing the above-described recombinant Newcastle disease LaSota attenuated vaccine strain, the method comprising:

(1) constructing a transcription plasmid comprising a wild type or mutant avian influenza virus inserted therein Genomic cDNA sequence of the Newcastle disease LaSota attenuated vaccine strain of the H5 subtype HA protein gene (wild type or mutant HA gene);

(2) constructing one or more transcriptional helper plasmids comprising a cDNA sequence encoding the nuclear protein (NP) of the Newcastle disease LaSota attenuated vaccine strain, and a phosphoprotein (P) encoding the Newcastle disease LaSota attenuated vaccine strain a cDNA sequence, and a cDNA sequence encoding the large polymerase protein (L) of the Newcastle disease LaSota attenuated vaccine strain;

(3) co-transfecting the transcription plasmid and the transcriptional helper plasmid into the host cell to which the virus is replicated, and culturing the transfected host cell;

(4) Harvest the supernatant, filter and continue to pass sensitive cells or inoculate the chicken embryo allantoic cavity to rescue the recombinant virus strain. In one embodiment of the above production method, a wild type or mutant avian influenza virus H5 subtype will be encoded

The gene of the HA protein was inserted into the artificially introduced Pmel site between the genomes P and M of the Newcastle disease LaSota attenuated vaccine strain. Preferably, the LaSota attenuated vaccine strain is AV1615.

In another embodiment of the above production method, the genomic cDNA sequence included in the transcription plasmid is located after the T7 promoter, and the genomic cDNA transcription is constituted before the sequence encoding the self-cleaving nuclease and the T7 transcription terminator. template. Preferably, the self-shearing nuclease is a hepatitis D virus ribozyme (Rib).

In another embodiment of the above production method, the cDNA sequence encoding the nuclear protein (NP) of the Newcastle disease LaSota attenuated vaccine strain in the transcriptional helper plasmid, and the phosphoric acid encoding the Newcastle disease LaSota attenuated vaccine strain are included. The cDNA sequence of the protein (P) and the cDNA sequence of the large polymerase protein (L) encoding the Newcastle disease LaSota attenuated vaccine strain are located after the T7 promoter. Preferably, the transcription plasmid is pBRN-FL-H5wtHA (also known as pBR-FL-H5HA t ) or pBR -FL-H5 mutHA (also known as _P BRN-FL-H5HAmut), and the transcriptional helper plasmid is plasmid pBSNP, pBSP And pBSL. In a preferred embodiment, the host cell is BHK-21.

The present invention also provides the use of the above-mentioned recombinant Newcastle disease LaSota attenuated vaccine strain (especially rLasota-H5wtHA and rLasota-H5mutHA) for preparing a vaccine for preventing avian influenza.

The present invention amplifies 10 cDNA fragments of the DV vaccine strain LaSota by RT-PCR, and splices the overlapping portions of the fragments to assemble a full-length cDNA clone. The sequence determination results have been registered in GenBank with accession number AY845400. Then Avian influenza virus H5 subtype A/Goose/Guangdong/96/l/H5N1 isolate wild type (retaining HA protease cleavage site, H5wtHA) and mutant (protease cleavage site deletion, H5mutHA) The HA gene was recombined into P and M of the NDV vaccine strain LaSota, respectively. And its nuclear protein (NP), phosphoprotein (P) and large polymerase protein (L) helper plasmid Anti-genomic RNA is synthesized by co-transfection into cells infected with poxvirus expressing T7 polymerase. This RNA is transcribed and replicated under the action of P, P and L proteins. The transfected supernatant was inoculated with SPF embryos to obtain an infectious rescue virus from cDNA. It was confirmed by RT-PCR and genomic cDNA sequence analysis that Lasota derived strains _r Lasota-H5wtHA and rLasota-H5mutHA with artificial genetic markers and wild-type or mutant HA genes were rescued. The proliferative characteristics of the rescued virus on chicken embryos were similar to those of the wild-type LaSota vaccine strain, and the blood coagulation price was as high as 2 ¹² . The above results confirmed once again that DV has the ability to serve as a live carrier for vaccines. The above recombinant NDV, rLasota-H5wtHA and rLasota-H5mutHA can be used as a bivalent attenuated vaccine against the attenuated vaccine against avian influenza A and Newcastle disease and avian influenza, which does not interfere with the current general application. Avian influenza epidemiology serological surveillance.

Multiple basic amino acids in the HA protein cleavage site are essential molecular basis for determining H5 subtype highly pathogenic avian influenza. HA, as an RNA viral envelope protein disease, may be involved in the surface of the viral envelope of recombinant NDV, and may play a role in cell invasion and cell invasion. By artificially deleting the amino acid amino acid at the HA cleavage site and converting it into a genetic form of the low pathogenic avian influenza virus HA protein, potential biosafety risks will be completely avoided. To this end, the present invention manually deletes four basic amino acids (-RKKR-) at the cleavage site by PCR, and mutates another amino acid to form a mutant low-pathogenic form H5 subtype HA gene (mutHA gene). , SEQ ID No 2), used to construct a recombinant Newcastle disease LaSota bivalent vaccine strain expressing the H5 subtype avian influenza virus HA antigen. DRAWINGS

Figure 1. Assembly of full-length NDV cDNA from subgenomic overlapping cDNA fragments generated from high fidelity RT-PCR. The cDNA fragments were ligated at a consensus restriction site and assembled in the transcription plasmid pBR322, and the RBZ and T7 terminator sequences were pre-cloned in the transcription plasmid PBR322 at Eco?/ and

See the instructions for details). (A) shows the first and last nucleotides of the entire full-length genome of the parental NDV. (B) A cDNA clone of NDV containing the GFP gene is displayed at the top, and the horizontal line below the genetic map shows the position of a single cDNA.

Figure 2. Nucleotide changes introduced into the modified enzyme site by RT-PCR and sequenced by using the PRISM kit (Perkin-Elmer) and Applied Biosystems ABB 10 automated sequencer. Boxed is a nucleotide substitution introduced in pBR l-10 by PCR mutagenesis (mutation from A to G;).

Figure 3. Immunofluorescence analysis of recombinant Newcastle disease virus rLasota-H5 tHA and rLasota-H5imitHA expressing H5 subtype HA antigen. (Fig. 3A and D) NDV-H5wtHA infects BHK-21 cells with an MOI of 1 ( 3B and E) and NDV-H5mutHA infected BHK-21 cells with MOI of 1, (Fig. 3C and F) NDV LaSota strain control infected BHK-21 cells with MOI of 1, and infected BHK cells were fixed in methanol 20 hours after infection. Chicken anti-H5 subtype avian influenza virus high serum (Fig. 3A, B and C) and chicken anti-Newcastle disease virus high serum (Fig. 3D, E and F) were primary antibodies, FITC-conjugated rabbit anti- X-bird IgG was subjected to indirect immunofluorescence assay for secondary antibodies, and cells were observed under a Leica DMIRES2 fluorescence microscope. The results showed that both wild-type and mutant H5 subtype HA antigens were correctly expressed in the recombinant Newcastle disease LaSota attenuated vaccine strain.

Figure 4. Recombinant Newcastle disease virus rLasota-H5wtHA and rLasota-H5mutHA expression H5HA protein blot analysis. Lane 1 : Protein labeling; Lane 2: Chicken embryo primary cells (CEF) infected with rLasota-H5wtHA

(obtained from Harbin Veterinary Research Institute); Lane 3: CEF cells infected with rLasota-H5mutHA; Lane 4: CEF cells infected with rLaSota; Lane 5: normal CEF cells; Lane 6: H5 subtype highly pathogenic avian influenza virus inoculation Chicken embryo allantoic fluid; Lane 7: Newcastle disease virus LaSota attenuated vaccine strain inoculated 9 to 10 days old SPF chicken embryo allantoic fluid; Lane 8: SPF chicken embryo allantoic fluid.

Figure 5. Comparison of kinetics of chicken embryo growth in recombinant Newcastle disease virus live vector vaccine.

Figure 6. Plasmid map of pBTRT.

Figure 7. DNA sequence of the pBTRT plasmid. The first italic part: T7 promoter; underlined part: ribozyme sequence; second underlined italic part: T7 terminator.

FIG 8. _P BRN-FL-H5wtHA Plasmid map.

Figure 9. DNA sequence of the pBRN-FL-H5wtHA plasmid. Underlined italic part: wtHA gene sequence. Figure 10. Plasmid map of pBRN-FL-H5mutHA.

Figure 11. DNA sequence of the pB N-FL-H5mutHA plasmid. Underlined italic part: mutHA gene sequence. detailed description

The invention is described in detail below with reference to the embodiments, which are intended to illustrate the invention, but not to limit the scope of the invention. The scope of the invention is defined by the appended claims. Example 1 Recombinant Newcastle disease expressing wild-type or mutant avian influenza virus H5 subtype hemagglutinin (HA) protein

Construction of cells, viruses and test materials for LaSota attenuated vaccine strains BHK-21 cells (milk hamster kidney cell ATCC CCL-10), medium is DMEM containing 10% fetal bovine serum (Hyclone) and lg/ml G418 (Dulbecco's modified Eagle's medium); DV Lasota vaccine strain AV1615 (purchased From the China Veterinary Microorganisms Collection and Management Center (CVCC). Inoculated 9-10 years old SPF chicken embryos were harvested at -70 °C after storage. The chicken anti-NDV high serum was prepared by our laboratory (Chu, HP, G. Snell, DJ Alexander, and GC Schild. 1982. Avian Pathol 11 :227-234); SPF chicken embryos and SPF chickens were provided by the SPF Laboratory Animal Center of Harbin Veterinary Research Institute. H5 subtype highly pathogenic avian influenza virus (HPAIV) A/Goose/Guangdong/96/l/H5Nl isolate [GD/1/96(H5N1)〗 (The earliest isolated H5 subtype highly pathogenic bird in China Influenza virus, Tang Xiuying et al. Identification of Chinese avian influenza epidemic strains. Chinese livestock and poultry infectious diseases, 1998, 20 (1): 1-5.) and its SPF chicken high serum-free, H5 subtype HPAIV) A/Duck/Nanliui The wild-type Newcastle disease virus LaSota vaccine AV1615 strain (rLaSota) rescued by the 04/l/H5N1 isolate [NH/04(H5N1)] and reverse genetic manipulation was purchased from Harbin Veterinary Research Institute, and the transcription vector was constructed.

The genomic RNA transcription vector pBTRT was constructed with the low copy cloning vector pBR322 (Invitrogen) and inserted into the T7 promoter (T7 promotor), the hepatitis D virus ribozyme (Rib) and the T7 transcription termination signal (T7 terminal) at the EcoR a I site. Built by the lab itself. The DNA fragment cloned between the T7 promoter and the ribozyme can be transcribed under the action of T7 RNA polymerase, and due to the autocatalytic function of Rib, the 3' end of the transcript can be ensured to be exactly identical to the cloned DNA fragment. Construction of full-length cDNA of recombinant DV LaSota strain inserted into wild-type and mutant HA genes

In order to establish the reverse genetic operating system of NDV Newcastle disease Lasota vaccine strain, we must first construct a full-length cDNA clone of the corresponding genome as a genomic negative-strand RNA transcription template, and construct ten cDNA clone fragments covering the entire genome. The 15 nt nt complete cDNA clone was obtained by ligation of the low-copy plasmid transcription vector plasmid pBTRT. The sequence analysis results were registered in GenBank, accession number AY845400, and the H5 subtype avian influenza virus was wild. And mutant HA gene H5wtHA (GenBank accession number AF148678, underlined italicized part in Figure 9, sequence listing SEQ ID No. 1) and H5mutHA gene (gene full-length DNA sequence shown in Figure 11 underlined italic part, sequence listing SEQ ID No 2 ) cloned between P and M. The T7 RNA polymerase promoter was prefixed to the 5' end of the full-length cDNA fragment, and a self-catalyzing hepatitis delta ribozyme (GenBank X04451) and a T7 transcription termination signal were ligated to the cDNA fragment. The constructed plasmids were named pBRN-FL-H5wtHA and pBRN-FL-H5mutHA, respectively. _(P BR -FL-H5AvtHA and pBRN-FL-H5nmtHA Plasmid map and the full DNA sequence are shown in Figure 8, 9 and 10, 11). In order to avoid methylation of the Xba site, the 6178th base of the F protein coding region in the genomic cDNA was synonymously changed from T to C by the PCR genome and used as a molecular marker for rescue of the virus. As with other investigators, we also introduced two extra G at the 5' end of the genomic cDNA at the T7 polymerase promoter, which may contribute to viral rescue of paramyxovirus reverse genetic manipulation. details as follows-

NDV Lasota vaccine strain virus chicken embryo inoculated allantoic fluid. Genomic RNA was extracted by conventional method (animal virology, second edition); the whole gene component was 10 fragments (F1-F10) with overlapping ends and RT-PCR amplification. The cDNA fragment was cloned into the pBluescript (Clontech) Smal site and confirmed by sequence analysis to be identical to the viral genomic RNA sequence; the sequence assay results were registered in GenBank under accession number AY845400. In order to introduce a specific molecular genetic marker, a methylated J3⁄4d site was selected at 6172 bp of the Lasota vaccine strain genomic cDNA, and the sequence was TCTAGATCA, which was mutated to TCTAGACCA by PCR, so that it was no longer recognized by methylase. Thus, it can be recognized by the restriction endonuclease; the restriction enzyme cleavage site existing in the overlapping portion of the adjacent fragment is ligated to assemble the complete NDV genomic cDNA (Fig. 1A), and the wild type H5 subtype avian influenza virus is separately And mutant HA genes H5wtHA and H5mutHA genes (wtHA: with Trizol

(Invitrogen) proposed the IBDV genome, and after reverse transcription, the gene was amplified by PCR. The following primers were added to the system. Upstream primer 5 '

AGTGCTTCTT 3 ' , downstream bow I 5, GTTTAAACTTAAA TGCAAATTCTGCATTGT3 ' _a mutHA ■: upstream bow I 5 ' GTTTAAACC downstream primer GTTTAAACTTAAATGCAAATTCTGCATTGT5 ' ) cloned into P, M artificially introduced P i site, and terminated in the prefix gene The gene initiation sequence (GE/GS) C TTAAGAAAAAA/T/ACGGGTAGAA ) was cloned into the transcription vector pBTRT and constructed into the viral genomes of the wild type and mutant HA genes H5wtHA and H5mutHA genes containing the H5 subtype avian influenza virus, respectively. The transcription plasmids pBRN-FL-H5wtHA and pBRN-FL-H5nmtHA (Fig. IB); the open reading frame (ORF) cDNAs expressing the nuclear protein (NP), phosphoprotein (P) and large polymerase protein (L) genes are followed by The clones were cloned downstream of the pBluescript II (+/-) plasmid T7 promoter and constituted the transcriptional helper plasmids pBSNP, pBSP and pBSL, respectively. Rescuing infectious DV from recombinant full-length cDNA clones (virus rescue) In order to rescue infectious NDV from cloned cDNA, BHK-21 cells were first co-transfected with pBRN-FL-H5wtHA and _P BRN-FL-H5mutHA and a helper plasmid expressing NDV NP, P, L protein, respectively. The fusion protein F0 of NDV must be lysed into F1 and F2 to be infectious. For the weak attenuated strain of Lasota, BHK-21 cells can not secrete the protease required for cleavage of F0 protein. Therefore, the corresponding protease is added to the medium, so this should be Replace with serum-free medium and add TPCK (toluenesulfonylalanyl chloride. Sigma) ( lg / ml), continue to culture 2-3 夭, harvest the transfected cell supernatant and inoculate SPF at 9-11 days old. Chicken embryo. After 4 days, the chicken embryo allantoic fluid was harvested, and the blood coagulation (HA) test results were positive. The HA value of different chicken embryos was between 2 ⁸ · ¹¹ ; the NDV immune serum hemagglutination inhibition (HI) test also showed positive results. Viral positive allantoic fluid was harvested as the F1 generation of the rescued viruses rLasota-H5wtHA and rLasota-H5mutHA. Further RT-PCR and sequence analysis showed that the 6178-point base of the F1 generation rescued the viral genomic cDNA was C, but not the C of the original LaSota parental strain, which was completely consistent with the expectation (Fig. 2). The results showed that the infectious progeny viruses rLasota-H5wtHA and rLasota-H5mutHA were successfully rescued by NDV LaSota vaccine strain genomic cDNA clone by reverse genetic manipulation technique. More specifically, the experimental steps are as follows:

When BHK-21 cells were inoculated into a 50-80% monolayer grown in a 35-nm six-well plate, the transcription plasmid and helper plasmids pBRN-FL-H5wtHA or pBRN-FL-H5mutHA, pBSNP, pBSP and pBSL were 5 g, 2.5, respectively. g, 1.25μ _§ 1.25μ _β , co-transfected BHK-21 cells, using the CaP04 transfection kit (Invitrogene), the operation was carried out according to the kit instructions. 8-12 hours after transfection, the transfection mixture was discarded, cells were shocked with PBS containing 10% DMSO for 2.5 minutes, added to complete DMEM overnight, replaced with serum-free medium the next day, and added with TPC (1 μ _§ /ml) After 2-3 days of incubation, the culture supernatant was harvested, filtered through a 0.22 um pore filter, and inoculated with SP-11 embryoid sac cavity for 9-11 days; the SPF embryo after inoculation was further cultured, 3-5 days, and the chicken embryo was taken. 50 μl of allantoic fluid was routinely subjected to hemagglutination (ΗΑ) and hemagglutination inhibition (HI) tests of Newcastle disease virus (Thayer SG, Nersessian BN, Rivetz B, Fletcher OJ. Comparison of serological tests for antibodies against Newcastle disease virus and infectious Bronchitis virus using ImmunoComb solid-phase immunoassay, a commercial enzyme-linked immunosorbent assay, and the hemagglutination-inhibition assay. Avian Dis. 1987 Jul-Sep; 31(3): 459-63. Harvested HA and HI test results positive allantoic fluid, frozen at -70 °C, and titrated the EID ₅ o and PFU virus content per ml of chicken embryo and chicken embryo fibroblasts according to conventional methods ⁽¹⁴⁾ . Named rLasota-H5wtHA and rLasota-H5mutHA, respectively. Example 2 Recombinant NDV expression AVI HA protein indirect immunofluorescence assay (IFA) test

The NDV LaSota vaccine strain transiently infects mammalian cells cultured in vitro. For proof Replication of rLasota-H5wtHA and rLasota-H5mutHA viruses in BHK-21 cells and expression of viral antigens, both of which have an infection with MOI of 1 to infect approximately 70-80% of monolayer BHK-21 cells (Fig. 3A) And B), at the same time, the NDV wild-type LaSota vaccine strain infected cells as control (Fig. 3C), the cells showed early CPE (cytopathic) phenomenon 20 hours after infection, and immediately indirectly immunized with NDV high-free SPF chicken positive serum as detection antibody. Fluorescence staining, as a result, strong positive reactions were observed under fluorescence microscopy of the three virus-infected cells (Fig. 3A, B and C). More specifically, the experimental steps were as follows:

The chicken embryos were inoculated with the second generation of allantoin virus rLasota-H5wtHA, rLasota-H5mutHA and wild-type LaSota vaccine strains (Fig. 3D, E and F) DMEM diluted appropriately, and grown in 24 volumes according to the volume of ΜΟΙ=5, 50μ1. Oral plate BHK-21, 37 ° C, after incubation for 1 h, washed three times with DMEM, then added to complete DMEM to continue the culture, 24 h after the cells were fixed with 95% ethanol for 5 min, PBST (0.05% Tween 20 phosphate buffer) After washing the cells, the cells were blocked with SPF chicken serum for 1 hour, and the chicken anti-H5 subtype highly pathogenic avian influenza virus was used as the primary antibody against SPF chicken positive serum. After 30 minutes, the PBST was washed and added to a 1:160 dilution. Fluorescein (FITC)-labeled rabbit anti-chicken IgG secondary antibody (Sigma) for 30 min, after PBST washing and fluorescence microscopy (Leica DMIRES2), rLasota-H5wtHA and rLasota-H5mutHA infected cells all showed strong positive reaction, while rLasota infected cells It is completely negative.

The results showed that the recombinant Newcastle disease virus rLasota-H5wtHA and rLasota-H5mutHA successfully expressed the H5 subtype avian influenza virus HA antigen protein. Example 3 Recombinant NDV expression H5 subtype avian influenza virus HA protein

Western-Blot identification

Take virus-infected chicken embryo fibroblast (CEF) lysate (After discarding the culture solution, add 1/10 volume of PBS, suspend the cells, add an equal volume of 2xSDS lysis buffer, boil water for 10 min, centrifuge at 12000 g for 10 min, harvest The supernatant or virus was inoculated with SPF chicken embryo allantoic fluid and subjected to SDS-PAGE (Bio-Rad). The protein was electrotransferred (Bio-Rad) onto a nylon membrane (Ameresco), 10% skim milk was blocked overnight, washed with PBST (0.05% Tween20) and then immunized with 1:50 dilution to prepare chicken anti-H5 subtype avian influenza virus HA. Antigen high serum was primary antibody, horseradish peroxidase (HRP) labeled rabbit anti-mouse goat anti-mouse IgG (Sigma) secondary antibody, 1:2500 times diluted with PBST, DAB (diaminobiphenyl gum, Sigma) After 3 to 5 minutes of color, the reaction was quenched with deionized water. The results are shown in Figure 4, demonstrating that recombinant NDV expresses wild-type and mutant AVI HA proteins, respectively. The results showed that rLasota-H5wtHA and rLasota-H5mutHA were positive for HA antigen infection in CEF, and Newcastle disease Lasota vaccine strain virus infection and HA antigen detection without CEF were negative; H5N1 subtype highly pathogenic avian influenza The virus GD/1/96 strain was positive for HA antigen inoculated with SPF chicken embryo allantoic fluid, while the Newcastle disease Lasota vaccine strain virus inoculation and non-inoculated SPF chicken embryo allantoic fluid HA antigen were negative.

The results showed that the H5 subtype avian influenza virus HA antigen was correctly expressed in the recombinant Newcastle disease virus rLasota-H5mutHA and rLasota-H5wtHA. Example 4 Growth characteristics and pathogenic characteristics of rNDV in chicken embryos To determine the growth characteristics of chick embryos of rLasota-H5wtHA and rLasota-H5mutHA rescued by reverse genetic manipulation and their pathogenicity to chicken embryos, virus embryos will be rescued. The F1 generation was inoculated with lxl0 ⁴ EID _{5Q for} 9 to 10 days of 齢SPF chicken embryo allantoic cavity. Results The wild-type Newcastle disease virus LaSota vaccine strain (rLaSota) rescued by reverse genetic manipulation did not kill SPF chicken embryos within 120 hours. Allantoic fluid was harvested at 24 hours, 48 hours, 72 hours and 96 hours after inoculation. EID _5Q the cyst fluid were ^{^{^{10- 8 '5, 10' 8}}} · 6, 10 '1Μ and 10' ^{^9.4.} rLasota-H5wtHA and rLasota-H5mutHA were inoculated for 9 to 10 days in the same dose route as SPF chicken embryo chorioallantoic cavity, and SPF chicken embryos were also not killed within 120 hours; rLasota-H5wtHA harvested at 24 hours, 48 hours, 72 hours and 96 hours after inoculation allantoic fluid per milliliter of allantoic fluid were then EID _5G ^{^{^{10- 8 · 2, 10 · 8}}} · 6, 1 (T 9 'Q and 1 (Γ ⁸ · ^5. 24 hours after inoculation rLas ₀ ta-H5mutHA, The allantoic fluid was harvested at 48 hours, 72 hours, and 96 hours, and the EID _5D per milliliter of allantoic fluid was 10. ⁷ · ⁹ , 10' ⁸ · ⁵ , 1 (Γ ⁹ · ² and 1 (Γ ⁸ · ^{6 )} . (Fig. 5) The results showed that the chick embryo growth kinetics of the reverse genetic manipulation rescue virus rLa _SO ta-H5wtHA and rLasota-H5mutHA was similar to that of the wild strain NDV Lasota vaccine strain (rLaSota), and the NDV LaSota vaccine parent strain was still maintained in the chicken embryo. High titer growth and low lethal biological characteristics.

Next, the recombinant viruses rLasota-H5wtHA and rLasota-H5mutHA were compared with the reverse genetic manipulation to rescue the wild-type Lasota vaccine strain (rLaSota), rLaSota, for pathogenicity analysis. Intracerebral pathogenicity index (ICPI), intravenous pathogenicity index (IVPI) and average embryonic lethal time (MDT) were determined according to the recommendations of the International Organization for Animal Health (O.I.E.). The LaSota live vaccine strain for newborn pheasant should have an ICPI of around 0.4 or below 0.4. As a result, the rLasota-H5mutHA virus not only maintained the low pathogenicity of the NDV Lasota strain, AV1615, but was also weakened. The above results indicate that the recombinant NDV maintains the high titer growth characteristics and low pathogenicity of the parental LaSota vaccine strain in the SPF dock.

Table 1. Pathogenicity analysis of recombinant Newcastle disease virus

Virus strains Chicken embryos mean brain pathogenicity index Intravenous pathogenicity index F protein cleavage site Dead time (hours) (ICPI) ** (IVPI) ** Sequence analysis *** ( MDT ) **

rLasota >120 0.35 0 GGRQGR L rLasota-H5mutHA >120 0 0 GGRQGR L rLasota-H5wtHA >120 0 0 GGRQGR L

** Follow the O.I.E recommended standard.

*** Routine RT-PCR and sequence analysis. Example 5 Inducing the immune effect of protective antibodies

To determine the immunogenicity of the virus rLasota-H5wtHA and rLasota-H5mutHA to SPF chicks by reverse genetic manipulation, rLasota-H5wtHA was used as an example. Chicken embryos were amplified by F1 generation of allantoic acid 2xlO ID _5Q . Artificial immunization of 12 7-day-old white henhen SPF chicks (provided by SPF Experimental Animal Center of Harbin Veterinary Research Institute), and another set of non-immune control group 8; immunization group and non-immune control group were respectively isolated in air negative pressure filtration In the device. After 3 weeks, the blood samples from the wing veins were routinely tested for specific hemagglutination inhibitory antibodies against Newcastle disease and H5 subtype avian influenza.

Experimental results: rLasota-H5wtHA and rLasota-H5nmtHA allantoic fluid F1 were artificially immunized with 7x day old white henhen SPF chicks at a dose of 2xl0 ⁶ EID _5Q , and observed for 3 weeks after immunization. There was no abnormality in the chicks, and there was no significant difference between the consumption of the words and the growth and development of the non-immunized control group. As a result, the two recombinant viruses were attenuated for 3 weeks after immunization of the chicks, and the levels of NDV and H5 subtype AIV-specific HI antibodies were induced at the sputum level. reaction. The results indicate that the recombinant has good immunogenicity and retains the good safety of the low pathogenic LaSota vaccine strain. Specifically, for the rLasota-H5wtHA and rLasota-H5mutHA viruses, they were each compared with the NDV Lasota vaccine strain AV1615 for induction of protective antibody immunoreactivity. The results are shown in Tables 2 and 3, indicating that both the recombinant viruses rLasota-H5wtHA and rLasota-H5mutHA are capable of simultaneously inducing a protective antibody immunoreactivity against NDV and AIV. Table 2. H5 subtype avian influenza Newcastle disease virus live vector bivalent vaccine (rLasota-H5wtHA) immunized 1 week old SPF chicks induced protective antibody immune response

SPF chick dose HI antibody titer (log ₂ ) ** Group vaccine*

(Feather) EID ₅₀ NDV AIV

1 30 rLaSota 2x106 7.4±0.6 <1

2 36 rLasota-H5wtHA 2x106 7.2±0.8 6.1±1.1

3 8 PBS <1 <1 * The vaccine is immunized on the 7th day by intranasal and intraocular injection, with a total volume of 100 μΐ per feather;

**After immunization, the serum of DV and Η5 subtype AIV specific HI antibody was detected at 19 days (26 days old). Table 3 H5 subtype avian influenza Newcastle disease virus live vector bivalent vaccine (rLasota-H5mutHA) immunization 1 week old

SPF-dimensional chicken induces protective antibody immune response

* Recombinant Newcastle disease virus is immunized with 7-day-old chicks by intranasal and eye-dropping methods, each volume of ΙΟΟμΙ;

**After immunization, the serum of DV and Η5 subtype AIV-specific HI antibody was detected on the 19th day (26th day). In addition, for the rLasota-H5wtHA and rLasota-H5mutHA viruses, they were compared with the immunoprotection of the NDV Lasota vaccine strain AV1615 against the Newcastle disease virulent F48E9 (purchased from CVCC) lethal challenge. The results are shown in Tables 4 and 5, indicating that both rLasota-H5wtHA and rLasota-H5mutHA viruses have the same immunoprotective effects as AV1615 with a virulent attack on Newcastle disease. Table 4. H5 subtype avian influenza Newcastle disease virus live vector bivalent vaccine (rLasota-H5wtHA) immunization 1 week old SPF chicks immune protection against Newcastle disease virulent lethal challenge

* Recombinant Newcastle disease virus is immunized with 7-day-old chicks by intranasal and eye-dropping methods, and each dose of 2x10 ⁶ EID ₅ G is ΙΟΟμΙ volume;

** 21 days after immunization (28 days old), DV virulent F48E9 strain 10 ⁴ ELD _{5 ()} dose was challenged by intramuscular injection for 21 days. Table 5. H5 subtype avian influenza Newcastle disease virus live vector bivalent vaccine (rLasota-H5imitHA) immunized 1 week old

Immune Protection of SPF Wei Chicken against Newcastle Disease

* Recombinant Newcastle disease virus was immunized with 7-day-old chicks by intranasal and eye-dropping methods, and each dose of 2x10 ⁶ EID _5Q was ΙΟΟμΙ volume;

** 21 days after immunization (28 days old), DV virulent F48E9 strain (CVCC> 10 ⁴ ELD _5Q dose was challenged by intramuscular injection, and continued for 21 days. The above results indicated that rLasota-H5wtHA and rLasota-H5mutHA virus recombination The vaccine was used to immunize chicks by conventional intranasal or eye-dropping methods. After immunization, there was no abnormality compared with the Newcastle disease LaSota vaccine strain parental wild-type immunization group and non-immune control. The specific protection of NDV and H5 subtype avian influenza virus after immunization Sex-related hemagglutination inhibition (HI) antibody capacity is comparable to existing vaccines and is safe and effective.

Finally, rLasota-H5wtHA and rLasota-H5mutHA viruses were used to immunize 1 week old SPF chicks with two H5 subtype avian influenza Newcastle disease virus live vector bivalent vaccines, and to evaluate the lethality of H5 subtype 髙 pathogenic avian influenza. Immune protection. The results are shown in Tables 6 and 7. The results showed that the rLasota-H5wtHA and rLasota-H5mutHA virus recombinant vaccines immunized chickens with 100% complete immune protection against Newcastle disease virulent strains and H5 subtype highly pathogenic avian influenza virus. No disease, no death; H5 subtype high pathogenic avian influenza virus completely prevented respiratory and digestive tract virus emissions after attack.

Table 6. H5 subtype avian influenza Newcastle disease virus live vector bivalent vaccine (rLa _S ota-H5wtHA) immunization for 1 week

Immune protection of the age-related SPF cone chicken against the lethal attack of H5 subtype highly pathogenic avian influenza

SPF detoxification (positive / negative) *氺 * protection points chicks attack

Immunization * throat (D.P.I.) cloaca (D.P.I.) hair group **

(feather) dead Ί'

3 5 7 3 5 7 'ill

1 12 rLasota-H5wtHA GD/96 0/12 0/12 0/12 0/12 0/12 0/12 0/12 0/1:

2 12 rLasota-H5wtHA NH/04 0/12 0/12 0/12 0/12 0/12 0/12 0/12 0/1:

3 8 rLaSota GD/96 8/8 6/6 1/1 10/10 6/6 1/1 8/8 8/8 4 8 rLaSota NH/04 8/8 8/8 8/8 8/8***

5 8 PBS GD/96 8/8 4/4 7/8 4/4 8/8 8/8

6 8 PBS NH/04 8/8 7/8 8/8 8/8***

ΙΟΟμΙ volume

** 21 days after immunization (28th 齢) Η5 subtype 髙 pathogenic avian influenza virus GD/96 strain (provided by Harbin Veterinary Research Institute) and NanHui/04 (NH/04) strain (by Harbin Veterinary Research) Provided by the nasal infection route, the dose is 100 LD _5D , and the observation is continued for 21 days after the attack;

***The control group died from the attack of Nanhui 04 years (NH/04) within 3 days, and the throat and cloaca swabs of the isolated virus were collected from the dead chickens on the 2nd and 3rd day after the challenge; DPI, The number of days after a virulent infection. Table 7. H5 subtype avian influenza Newcastle disease virus live vector bivalent vaccine (rLasot _a -H5inutHA) immunization for 1 week

Immune protection of SPF chicks against lethal challenge of H5 subtype highly pathogenic avian influenza

* Recombinant Newcastle disease virus was immunized with 7-day-old chicks by intranasal and eye-dropping methods, each dose of 2x10 ⁶ EID _5Q , a total volume of ΙμΙ;

** 21 days after immunization (28 days old) Η5 subtype highly pathogenic avian influenza virus GD/96 strain (provided by Harbin Veterinary Research Institute) and NanHui/04 (NH/04) strain (by Harbin Veterinary The Institute provided) the attack by nasal infection, the dose was 100 LD _5Q , and the observation was continued for 21 days after the attack;

*** In the control group, all the deaths were caused within 3 days after the attack on Nanhui 04 years (H/04). The throat and cloaca swabs of the isolated virus were collected from the dead chickens on the 2nd and 3rd days after the challenge; DPI, The number of days after a virulent infection. This study selected a Newcastle disease virus LaSota attenuated vaccine, which has been widely used in China for many years and has been widely used in practice, as a parent strain, through the anti-gene operation technology of negative-strand RNA virus. The non-coding region between the P gene and the M gene in the genome was a foreign gene insertion site, and a HA immunogen gene expressing the H5 subtype 髙 pathogenic avian influenza virus wild type and an artificial deletion cleavage site with a plurality of bases were constructed. Recombinant NDV strain of mutant HA immunogenic gene, rLasota-H5wtHA and rLasota-H5mutHA, as a bivalent attenuated vaccine candidate against Newcastle disease and H5 subtype highly pathogenic avian influenza, and biosafety Evaluation. Studies have shown that the NDV genome inserts exogenous reporter genes or immunogenic genes at different sites, and the biological characteristics, low pathogenicity and genetic stability of the genome are maintained by successive high passages of cells or chicken embryos.

The immunoassay results of the recombinant viruses rLasota-H5wtHA and rLasota-H5mutHA showed that the rLasota-H5mutHA and rLasota-H5mutHA recombinant vaccines can produce 100% of the lethal attack of H5 subtype highly pathogenic avian influenza and Newcastle disease virulent immunity. Fully immunoprotective, the ability to induce protective antibodies is comparable to existing inactivated vaccines, and has an advantage in inducing important mucosal and cellular immunity; maintaining a safe, effective, high titer of the parental LaSota vaccine strain on newborn chicks The advantages of chicken embryo growth characteristics, ease of use, etc.; environmental and social benefits are significant, compared with the traditional avian influenza vaccine, the same dose of vaccine production is only one percent of the chicken embryo, the product volume is only one thousandth, and the production The use of mineral oil is not required, and the effect of traditional oil emulsion inactivated vaccine injection on immunization against commercial chickens is completely avoided.

Newcastle disease virus as a live virus vector has great advantages in constructing a double-valent vaccine against avian influenza and Newcastle disease. Avian influenza and Newcastle disease have been classified as Class A severe infectious diseases by the OIE. They are an important disease that jeopardizes the development of the world poultry industry. Avian influenza also has extremely important public health significance. The attenuated vaccine used in Newcastle disease prevention in China is at least 10 billion feathers per year. The application of NDV attenuated vaccine, especially LaSota vaccine strain, is an indispensable immunization program for all newborn chicks in China. Newcastle disease virus (NDV) is a non-segmented single-stranded negative-strand RNA virus with clear genomic structure and functional background. Only one serotype is genetically stable. The foreign gene inserted in recombinant NDV is high in cells or chicken embryos. Stable expression can still be maintained after sub-passage, and is very suitable as an expression or vaccine vector. For a long time, the safety and efficacy of the NDV attenuated LaSota vaccine strain has been fully proved; the live vaccination vaccine can simultaneously induce systemic humoral immunity, local mucosal immunity and cellular immunity to form a more comprehensive and accurate immune protection; , spray, nose, eye or injection a variety of ways to the seedlings, the use of extremely convenient; DV has a sputum titer of chicken embryo growth characteristics, production costs are extremely low.

The application of rLasota-H5mutHA recombinant vaccine will make the H5 subtype highly pathogenic avian influenza vaccine control almost no additional manufacturing and use costs, and the country can save at least tens of millions of dollars of epidemic prevention funds and a large number of society every year. Labor costs, and reduce the adverse stress response of immunized subjects. The available data show that this vaccine has great social, economic and environmental benefits compared with the existing Newcastle disease and avian influenza vaccines, and the domestic and international markets have broad prospects. Newcastle disease virus as a vaccine carrier is an internationally advanced new technology. If the progress is further accelerated, H5 Asia The avian influenza Newcastle disease virus live vector vaccine is expected to become the first live vaccine for the negative-strand RNA virus in the world.

references

1. Takaald Nakaya, Jerome Cros, Man-Seong Park, Yurie Nakaya, Hongyong Zheng, Ana Sagrera, Enrique Villar, Adolfo Garci'A-Sastre, and Peter Palese. 2001. Recombinant Newcastle Disease Virus as a Vaccine Vector Journal of Virology, 75 : 11868- 11873

2. Ben PH Peeters, Olav S. Deleeuw, Guus Koch and Amol. J. Gielkens 1999. Rescue of Newcastle Disease Virus from Cloned cDNA: Evidence that Cleavability of the Fusion Protein Is a Major Determinant for Virulence. Journal of Virology. 5001-5009

3. Zhuhui Huang, Aruna Panda, Subbiah Elankumaran, Dhanasekaran Govindarajan, Daniel D. Rockemann, and Siba K. Samal.2003. The Hemagglutinin-Neuraminidase Protein of Newcastle Disease Virus Determines Tropism and Virulence. Journal of Virology.78: 4176-4184

4. Zhuhui Huang, Sateesh Krishnamurthy, Aruna Panda, and Siba K. Samal.2003. Newcastle Disease Virus V Protein Is Associated with Viral Pathogenesis and Functions as an Alphalnterferon Antagonist. Journal of Virology.77:8676-8685

5. Teshome Mebatsion, Leonie TC de Vaan, Niels de Haas, Angela Ro"mer-Oberdo"rfer, and Marian Braber.2003. Identification of a Mutation in Editing of Defective Newcastle Disease Virus Recombinants That Modulates P-Gene mRNA Editing and Restores Virus Replication and Pathogenicity in Chicken Embryos. Journal of Virology.77:9259-9265

6. Man-Seong Park, Adolfo Garcia-Sastre, Jerome F. Cros, Christopher F. Basler, and Peter Palese. 2003. Newcastle Disease Virus V Protein Is a Determinant of Host Range Restriction. Journal of Virology.77:9522-9532

7. Z.Huang, S.Elankumaran, A.Panda, and S.K. Samal.2003.Recombinant Newcastle Disease Virus as a Vaccine Vector.Poultry Science .82:899-906

8. Gabriele Neumann, Michael A.Whitt and Yoshihiro Kawaoka. 2002.A decade after the generation of a negative-sense RNA virus from clond cDNA-what have we Learned? Journal of General Virology.83:2635-2662

9. Angela Romer-Oberdorfer, Egbert Mundt, Teshome Mebatsion, Ursula J. Buchholz. 1999. Generation of recombinant lentogenic Newcastle disease virus from cDNA. Journal of General Virology. 80:2987-2995

10. B. P. H. Peeters, Y.K. Gruijthuijsen, O.S. de Leeuw, Wo!] A. L. J. Gielkens. 2000. Genome replication of Newcastle disease virus: involvement of the rule-of-six. Archives of Virology.145:1829-1845

Claims

Rights request

A recombinant Newcastle disease LaSota attenuated vaccine strain expressing a gene encoding a wild type or mutant avian influenza virus H5 subtype hemagglutinin (HA) protein.

,

The recombinant Newcastle disease LaSota attenuated vaccine strain according to claim 1, wherein the gene encoding the wild type HA protein has the nucleotide sequence shown by SEQ ID No. 1.

The recombinant Newcastle disease LaSota attenuated vaccine strain according to claim 1, wherein the gene encoding the mutant HA protein has the nucleotide sequence shown in SEQ ID No. 2.

The recombinant Newcastle disease LaSota attenuated vaccine strain according to any one of claims 1 to 3, wherein the Newcastle disease LaSota attenuated vaccine strain is AV1615. '

The recombinant Newcastle disease LaSota attenuated vaccine strain according to claim 4, wherein the recombinant Newcastle disease LaSota attenuated vaccine strain is rLasota-H5wtHA and rLasota-H5mutHA.

A method of producing a recombinant Newcastle disease LaSota attenuated vaccine strain according to claim 1, the method comprising:

(1) Constructing a transcription plasmid comprising a genomic cDNA of the Newcastle disease LaSota attenuated vaccine strain in which a gene encoding a wild type or mutant avian influenza virus H5 subtype HA protein (wild type or mutant HA gene) is inserted Sequence

(4) Harvest the supernatant, filter and continue to pass sensitive cells or inoculate the chicken embryo allantoic cavity to rescue the recombinant virus strain.

The method according to claim 6, wherein the gene encoding the wild type or mutant avian influenza virus H5 subtype HA protein is inserted into the artificially introduced Pmel site between the genomes P, M of the Newcastle disease LaSota attenuated vaccine strain.

The method according to claim 6 or 7, wherein the LaSota attenuated vaccine strain is AV1615 (Chinese Veterinary Microorganisms Collection and Management Center, cvcc).

9. A method according to claim 6 or 7, comprising a genomic cDNA sequence in said transcription plasmid Located after the T7 promoter, a genomic cDNA transcription template is constructed prior to encoding the sequence of the self-cleaving nuclease and the Τ7 transcription terminator.

10. The method according to claim 9, wherein the self-shearing nuclease is a hepatitis D virus ribozyme (Rib) o

The method according to claim 6 or 7, which comprises a cDNA sequence encoding the nuclear protein (P) of the Newcastle disease LaSota attenuated vaccine strain in the transcriptional helper plasmid, encoding the Newcastle disease LaSota attenuated vaccine strain. The cDNA sequence of phosphoprotein (P) and the cQNA sequence of the large polymerase protein (L) encoding the Newcastle disease LaSota attenuated vaccine strain are both located after the T7 promoter.

12. The method according to claim 6, wherein the transcription plasmid is pBRN-FL-H5wtHA or pBRN-FL-H5mutHA ₀

13. The method according to claim 6, wherein the transcriptional helper plasmids are plasmids pBSNP, pBSP and pBSL.

14. A method according to claim 6 wherein the host cell is BHK-21 or chicken embryo fibroblasts.

15. Use of a recombinant Newcastle disease LaSota attenuated vaccine strain according to any one of claims 1-5 for the preparation of a vaccine for the prevention of avian influenza.

16. The use according to claim 15, wherein said recombinant Newcastle disease LaSota attenuated vaccine strain is rLasota-H5wtHA and rLasota-H5mutHA.