CN100487119C - Recombination newcastle disease LaSota weak virus vaccine for expressing poultry influenza virus H5 sub type HA protein - Google Patents

Recombination newcastle disease LaSota weak virus vaccine for expressing poultry influenza virus H5 sub type HA protein Download PDF

Info

Publication number
CN100487119C
CN100487119C CNB2006100757816A CN200610075781A CN100487119C CN 100487119 C CN100487119 C CN 100487119C CN B2006100757816 A CNB2006100757816 A CN B2006100757816A CN 200610075781 A CN200610075781 A CN 200610075781A CN 100487119 C CN100487119 C CN 100487119C
Authority
CN
China
Prior art keywords
virus
vaccine strain
attenuated vaccine
new castle
plasmid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CNB2006100757816A
Other languages
Chinese (zh)
Other versions
CN1869234A (en
Inventor
步志高
陈化兰
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Harbin Veterinary Research Institute of CAAS
Original Assignee
Harbin Veterinary Research Institute of CAAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Harbin Veterinary Research Institute of CAAS filed Critical Harbin Veterinary Research Institute of CAAS
Priority to CNB2006100757816A priority Critical patent/CN100487119C/en
Priority to PCT/CN2006/001626 priority patent/WO2007128169A1/en
Publication of CN1869234A publication Critical patent/CN1869234A/en
Application granted granted Critical
Publication of CN100487119C publication Critical patent/CN100487119C/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/145—Orthomyxoviridae, e.g. influenza virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5256—Virus expressing foreign proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16111—Influenzavirus A, i.e. influenza A virus
    • C12N2760/16134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/18011—Paramyxoviridae
    • C12N2760/18111—Avulavirus, e.g. Newcastle disease virus
    • C12N2760/18141—Use of virus, viral particle or viral elements as a vector
    • C12N2760/18143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Virology (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Organic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biophysics (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pulmonology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biochemistry (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention relates to reconstructing LaSota weak poison vaccine strain to express wild type or mutant type fowl influenza virus H5 HA albumen. Concretely, it is rL-QHwH5 and rL-QHmH5. The invention also discloses the method to make the LaSota weak poison vaccine and the application in defending fowl influenza virus.

Description

Express the recombinant new castle disease LaSota attenuated vaccine strain of avian influenza virus H5 subtype HA protein
Technical field
The present invention relates to recombinant viral vaccine field, more specifically, the present invention relates to the recombinant new castle disease LaSota attenuated vaccine strain of a kind of expression encoding wild type or the proteic gene of mutant avian influenza virus H5 hypotype hemagglutinin (HA), more specifically, recombinant new castle disease LaSota attenuated vaccine strain is rL-QHwH5 and rL-QHmH5.The invention also discloses the method and the application of this recombinant new castle disease LaSota attenuated vaccine strain in the vaccine of preparation birds flu-preventing of the described recombinant new castle disease LaSota attenuated vaccine strain of preparation.
Background technology
(Newcastle disease virus NDV) is non-segmented negative sub-thread minus-stranded rna virus to Avian pneumo-encephalitis virus, as the important member and the model virus of Paramyxoviridae, obtains further investigation.Reorganization NDV has outstanding advantage as the live-virus vaccine carrier: the NDV attenuated vaccine that comprises the LaSota strain is used for the poultry epidemic prevention for a long time always, and its safety and effectiveness is fully proved; NDV heredity is relatively stable, and a serotype is only arranged, and reorganization and virulence take place between strain, and to return strong possibility minimum; Reproduction process is finished in cytoplasm, from RNA to RNA, and the possibility that does not exist DNA stage and cellular genome to integrate; The NDV attenuated vaccine can be induced the formation of general humoral immunization, local mucous membrane immunity and cellular immunization simultaneously, forms more comprehensive, certain immunoprotection; Can or inject multiple mode and give seedling by drinking-water, spraying, collunarium, eye droppings, extremely easy to use; NDV has the chicken embryonic development characteristic of high titre, and production cost is very cheap (1,7,8)NDV is the chickenpest cause of disease of hyperinfection and height lethality, and China is used for the attenuated vaccine of the anti-system of newcastle disease every year at least more than 10,000,000,000 plumage parts.The economic implications that NDV uses as the live-virus vaccine carrier is very huge.
The reverse genetic manipulation of minus-stranded rna virus (Reverse genetic) is a process of making new virus by operation viral genome cDNA, and its primary process is; 1. assemble complete viral genome (or recombinant type genome) cDNA clone, 5 ' end is accurately sewed after the T7 promotor, 3 ' terminal accurately sewing before nuclease sequence and T7 transcription termination signal that the oneself shears, constitutes genome cDNA and transcribes template; 2. transcribe template with starting the necessary expression plasmid (T7 promotor) of transcribing correlation function structural protein such as nucleoprotein (NP), phosphoric acid albumen (P) and polymerase protein (L) of virus replication, the virus replication permissive cell of cotransfection integrative gene expression T7 polysaccharase with genome cDNA; 3. gather in the crops culture supernatant after 24-72 hour, filter that the back continues that sensitive cells goes down to posterity or the inoculated into chick embryo allantoic cavity is rescued and obtained (rescue) virus.Genome cDNA is suddenlyd change, after disappearance or foreign gene insert and modify, can obtain the minus-stranded rna virus of corresponding sudden change or reorganization by reverse genetic operating system (reverse genetic system, RGS system) (1,2,3,4,5,6)
NDV genome total length 15186 Nucleotide, the same with other paramyxovirus, comprise nucleoprotein (NP), phosphorprotein (P), stromatin (M), fusion rotein (F), lectin neuraminic acid zymoprotein (HN) and big six of polymerase proteins (L) are independently transcribed coding unit (Figure 1A).This research is cloned into IBDV VP2 albumen between P and the M, studies the expression appropriate location of foreign protein in NDV.NDV is the same with other minus-stranded rna virus, and its minimum infectious unit is the ribonucleoprotein mixture, and the RNA of no albumen parcel itself there is no infectivity.The geneome RNA of NDV is by forming the nucleoprotein complex body with NP, P, L albumen, and the first run of startup RNA is transcribed and the translation of viral protein is synthetic, produce infectious progeny virus (7,10)According to this principle, European scholars in 1999 have taken the lead in setting up the reverse genetic operating system (reversegenetic system, RGS system) of first highly pathogenic NDV (2)Europe, the United States have several laboratories to utilize the RGS technology of NDV carrying out the keen competition Journal of Sex Research aspect basis and the applied research at present.
Bird flu is the important diseases of harm world aviculture development, and highly pathogenicity avian influenza can cause infecting fowl group 100% death, is classified as the category-A deadly infectious disease by International Office of Epizootics.The H5 hypotype causes that in history highly pathogenicity avian influenza breaks out.Since the year ends 2003, Korea S, Japan, Vietnam, Thailand, Indonesia, Cambodia, Laos, China's Mainland are broken out H5 hypotype highly pathogenicity avian influenza in succession.H5 hypotype highly pathogenicity avian influenza epidemic situation took place in China Qinghai Lake migratory bird in 2005, wherein a strain is derived from the advantage strain virus strain of bar-headed goose, A/Bar-headed goose/Qinghai/3/2005 (H5N1), migrate with migratory bird and to be transmitted to Mongolia, Russia, Europe, West Asia, the Middle East and Africa, not only cause a large amount of poultry epidemic situations to take place, and cause people's infection morbidity and death in a plurality of countries.Existing inactivated avian influenza vaccine and fowl pox live vector vaccine tool safety, the advantage that immune protective effect is good, but still exist manufacturing cost height, the use deficiency of inconvenience relatively.Development highly effective and safe, vaccine of new generation with low cost, easy to use have important practical significance.
Bird flu (Avian Influenza, AI) be by avian influenza virus (Avian Influenza Virus, AIV) bird that causes infects and/or disease syndrome, AIV belongs on taxonomy: viral boundary (Vira)----orthomyxoviridae family (Orthomyxoviridae)----Influenza Virus (Influenza VirusA and B)----avian influenza virus (Avian Influenza Virus).Avian influenza virus belongs to the A type influenza virus of orthomyxoviridae family's Influenza Virus, and genome is made up of 8 sub-thread strand RNA fragments.Its surface tissue albumen hemagglutinin (HA) is different with neuraminidase (NA) antigenicity, is divided into different subtype.Hemagglutinin (HA) is the main immunogen protein of avian influenza virus, it can induce body to produce antibody-mediated specific humoral immune response, thereby the antibody of anti-HA can combining or the viral infection that neutralizes of the fusion process of virus envelope and endocytosis body film by viral interference and sialic acid acceptor.The aminoacid sequence of the virulence of AIV and its surface tissue albumen HA cracking site is closely related.The HA cracking site of low pathogenicity AIV has only a basic amino acids arginine (R), this structures shape can only in respiratory system, breed behind these virus infection animals, because have only airway epithelial cell to contain the proteolytic enzyme of the special similar pancreatin of a kind of arginine, the HA0 that cracking site can be contained single basic amino acids arginine is cracked into activated HA1 and HA2, starts the absorption and the replicative cycle of virus.Highly pathogenicity H5 and H7 hypotype AIV HA cracking site contain a plurality of alkaline amino acid residue-RKKR of successive-, the proteolytic enzyme identification and the cracking that can extensively be existed in the various kinds of cell in the body, therefore have tissue tropism widely, just can cause the general diffusion and cause rapid death in case infect.But compare with the subtype influenza viruses such as H1, H2, H3 and H9 of infected person, highly pathogenic H5 and H7 hypotype AIV are more huge to the mankind's potential hazard, in case because promptly may general diffusion and rapid causing death after the infected person.
2001-2002; Palese.P. wait the reorganization NDV B1 strain of the virus of construction expression H1 subtype influenza in succession HA immunogen gene and express the reorganization NDVB1 strain of H7 subtype influenza virus HA immunogen gene, immunity test shows that these two kinds of NDV live vector vaccines can induce protective immunological reaction mouse and bird respectively.But because a little less than B1 itself highly causes; relatively poor in the intravital replication of immunization chicken; thereby the induction of immunity chicken form effective immunoprotection ability also relatively a little less than; test shows; the NDV B1 strain of expressing H7 hypotype HA gene only is respectively 60% and 40% to the survival protection of NDV and H7 hypotype highly pathogenicity avian influenza lethal hit, and can not stop virus duplicating and discharging in vivo.Studies show that the NDV genome inserts external source reporter gene or immunogen gene in different loci, going down to posterity through cell or the continuous high generation of chicken embryo still keeps the heredity and the expression stability of height.But, all be unrealized and producing actual widespread use owing to the deficiency and the reasons such as defective and use cost of above-mentioned expression system, live vector itself.
Summary of the invention
At above-mentioned research background; the inventor is the immunogenicity that further improves the avian influenza virus antigen expressed; the reorganization NDV live vector bigeminy attenuated vaccine rL-QHwH5 and the rL-QHmH5 of construction expression wild-type and mutant avian influenza virus HA immunogen protein; to induce protection immune response, be used for the epidemic prevention of bird newcastle disease and bird flu by number of ways immune animals such as collunarium, eye droppings, intramuscular injection even drinking-water, spraying suctions to bird flu.
Therefore, an object of the present invention is to provide the recombinant new castle disease LaSota attenuated vaccine strain of a kind of expression encoding wild type or the proteic gene of mutant avian influenza virus H5 hypotype hemagglutinin (HA).
In one embodiment, the proteic gene of described encoding wild type HA has the nucleotide sequence (seeing sequence table) shown in the SEQ ID No.1.
In another embodiment, the proteic gene of described encoding mutant type HA has the nucleotide sequence (seeing sequence table) shown in the SEQ ID No.2.
Preferred described new castle disease LaSota attenuated vaccine strain is AV1615.
More preferably described recombinant new castle disease LaSota attenuated vaccine strain is rL-QHwH5 and rL-QHmH5.
A further object of the invention provides a kind of method of producing above-mentioned recombinant new castle disease LaSota attenuated vaccine strain, and this method comprises:
(1) structure is transcribed plasmid, and this transcribes the genome cDNA sequence that plasmid comprises the described new castle disease LaSota attenuated vaccine strain of the gene (SEQ ID No.1 or SEQ ID No.2) that wherein inserts encoding wild type or mutant avian influenza virus H5 subtype HA protein;
(2) make up one or more helper plasmids of transcribing, this helper plasmid comprises the cDNA sequence of the big polymerase protein (L) of the cDNA sequence of phosphoric acid albumen (P) of the cDNA sequence of the nucleoprotein (NP) of the described new castle disease LaSota attenuated vaccine strain of encode, the described new castle disease LaSota attenuated vaccine strain of encoding and the described new castle disease LaSota attenuated vaccine strain of encoding;
(3) with the described host cell of transcribing plasmid and transcribing the described virus replication permission of helper plasmid cotransfection, the host cell after the cultivation transfection;
(4) results supernatant liquor filters that the back continues that sensitive cells goes down to posterity or the inoculated into chick embryo allantoic cavity is rescued and obtained recombinant virus.
In an embodiment of aforementioned production method, the gene of encoding wild type or mutant avian influenza virus H5 subtype HA protein is inserted into the genome P of new castle disease LaSota attenuated vaccine strain, manually-injected PmeI site between the M.Preferred described LaSota attenuated vaccine strain is AV1615.
In another embodiment of aforementioned production method, be included in described genome cDNA sequence of transcribing in the plasmid and be positioned at after the T7 promotor, and before the sequence and T7 transcription terminator of the nuclease that the coding oneself shears, constitute genome cDNA and transcribe template.The nuclease that preferred described oneself shears is a fourth hepatovirus ribozyme (Rib).
In another embodiment of aforementioned production method, the cDNA sequence that is included in the big polymerase protein (L) of the cDNA sequence of phosphoric acid albumen (P) of described cDNA sequence of transcribing the nucleoprotein (NP) of the described new castle disease LaSota attenuated vaccine strain of coding in the helper plasmid, the described new castle disease LaSota attenuated vaccine strain of coding and the described new castle disease LaSota attenuated vaccine strain of encoding all is positioned at after the T7 promotor.The preferred described plasmid of transcribing is pBRN-FL-QHwH5 or pBRN-FL-QHmH5, and the described helper plasmid of transcribing is plasmid pBSNP, pBSP and pBSL.In a preferred embodiment, described host cell is BHK-21.
The present invention also provides the application of above-mentioned recombinant new castle disease LaSota attenuated vaccine strain (particularly rL-QHwH5 and rL-QHmH5) in the vaccine of preparation birds flu-preventing.
The present invention utilizes the part that overlaps each other between the fragment to splice by RT-PCR 10 the cDNA fragments of NDV vaccine strain LaSota that increased, and is assembled into full length cDNA clone.The sequencing result has logined GenBank, and accession number is AY845400.Then respectively with avian influenza virus (Avian influenza virus) H5 hypotype, (the dead bar-headed goose of Qinghai Lake separated the strain of H5 subtype avian influenza virus to A/Bar-headed goose/Qinghai/3/2005 (H5N1) in 2005, available from Chinese Harbin veterinary institute.Reference, Li Y, Chen H, etc., Journal of Virology, 2006, in press; Wild-type HA gene, registered in influenza virus sequence library: http: // Www.flu.lanl.govISDN138009) strain isolated wild-type (QHwH5 keeps the HA protease cracking site, SEQ IDNo.1) and mutant (QHmH5,4 basic aminoacidss of protease cracking site disappearance, SEQ IDNo.2) the HA gene is recombinated respectively between the P and M of NDV vaccine strain LaSota.Itself and nucleoprotein (NP), phosphorprotein (P) and big polymerase protein (L) helper plasmid cotransfection are infected the bhk cell of the poxvirus of expressing the T7 polysaccharase in advance, thereby synthesize antigenomic RNA.This RNA transcribes and duplicates under NP, P and the proteic effect of L.With transfection supernatant inoculation SPF embryo, obtain from the infective virus of having of cDNA.By base mutation, produced derivation strain rL-QHwH5 and the rL-QHmH5 of the Lasota that has hereditary label, the virus of rescue is bred feature with wild malicious close on the chicken embryo, and the blood clotting valency is up to 2 12, above result shows that two types HA all obtains expressing, and confirms that again NDV has the potentiality as the vaccine live vector, lays the foundation for developing novel avian influenza vaccine.More than reorganization NDV not only can be used as the two valency attenuated vaccines of bigeminy attenuated vaccine of prevention H5 hypotype highly pathogenicity avian influenza and newcastle disease, also can be used as bivalent inactivated vaccine kind strain, and do not disturb the conventional bird flu epidemiology serology monitoring of present widespread usage fully.
The continuous a plurality of basic aminoacidss in HA protein cleavage site are the necessary molecular basises of decision H5 hypotype highly pathogenicity avian influenza.HA might be fitted to the virus envelope surface of reorganization NDV after expressing as the RNA viruses envelope protein is sick, might bring into play its cell-membrane receptor in conjunction with waiting cell intrusion correlation function with fusions.By the continuous a plurality of basic aminoacidss of artificial mutation deletion HA cracking site, make it change the proteic gene form of low pathogenicity avian influenza virus HA into, will avoid potential Biosafety hidden danger fully.For this reason, the present invention passes through PCR method, continuous 4 basic aminoacidss of cracking site have manually been deleted (RKKR-), and the another one amino acid that suddenlyd change, form low pathogenicity form H5 hypotype HA gene (the QHmH5 gene of sudden change, SEQ ID No.2), be used for the strain of the antigenic recombinant Newcastle disease LaSota of construction expression H5 subtype avian influenza virus HA bivalent vaccine.
Description of drawings
Fig. 1. assemble total length NDV cDNA from the overlapping cDNA fragment of subgene group that high-fidelity RT-PCR produces.The cDNA fragment is connected at total restriction site, and in transcribing plasmid pBR322, assemble, in transcribing plasmid pBR322, RBZ and T7 terminator sequence are cloned between EcoRI and the salI site (seeing specification sheets for details) in advance.(A) first and last Nucleotide of the whole full-length gene group of demonstration parental generation NDV.(B) cDNA that shows the NDV that contains wild-type or mutant HA gene at the top clones, and the sea line under genetic map shows the position of single cDNA.
Fig. 2. produce the Nucleotide of introducing the modifying enzyme site by RT-PCR and change, and by using the order-checking of PRISM test kit (Perkin-Elmer) and Applied Biosystems ABI310 automatic sequencer.What add frame is a nucleotide substitution (sporting G by A) of introducing in pBRN1-10 by PCR mutagenesis.
Fig. 3. recombinant Newcastle disease virus rL-QHwH5 and rL-QHmH5 express the antigenic immunofluorescence analysis of H5 hypotype HA.(Fig. 3 A and D) rL-QHwH5 is 1 infection BHK-21 cell with MOI, (Fig. 3 B and E) and rL-QHmH5 are 1 infection BHK-21 cell with MOI, (Fig. 3 C and F) NDVLaSota parent plant AV1615 contrast is 1 infection BHK-21 cell with MOI, infect and infected B HK cell methyl alcohol fixed in back 20 hours, respectively with the anti-H5 subtype avian influenza virus of chicken hyper-immune serum (Fig. 3 A, B and C) and chicken anti-new castle disease virus hyper-immune serum (Fig. 3 D, E and F) be one anti-, FITC-link coupled rabbit is anti--and chicken IgG is that the two anti-indirect immunofluorescences that carry out detect observation of cell under the LeicaDMIRES2 fluorescent microscope.The result shows that wild-type and mutant H5 hypotype HA antigen all can obtain correct the expression in the recombinant new castle disease LaSota attenuated vaccine virus strain.
Fig. 4. recombinant Newcastle disease virus live vector vaccine chicken embryonic development power determination is relatively.
Fig. 5. recombinant Newcastle disease virus rL-QHwH5 and the special HI antibody response of rL-QHmH5 immunity SPF chick H5 avian influenza poison.H5 subtype avian influenza Avian pneumo-encephalitis virus live vector bivalent vaccine (rL-QHwH5 and rL-QHmH5) immunity SPF chick in 1 age in week is induced the special HI antibody mediated immunity reaction of H5 subtype avian influenza.Vaccine adds eye droppings approach immunity 7 Japanese instar chicklings through collunarium, and every plumage is totally 100 μ l volumes.
Fig. 6. recombinant Newcastle disease virus rL-QHwH5 and the special HI antibody response of rL-QHmH5 immunity SPF chicken Newcastle disease virus.H5 subtype avian influenza Avian pneumo-encephalitis virus live vector bivalent vaccine (rL-QHwH5 and rL-QHmH5) immunity SPF chick in 1 age in week is induced the special HI antibody mediated immunity reaction of newcastle disease.Recombinant Newcastle disease virus adds eye droppings approach immunity 7 Japanese instar chicklings through collunarium, and every plumage is totally 100 μ l volumes.Immunity back 19 days (26 age in days) is gathered serum and is carried out NDV and the special HI antibody test of H5 hypotype AIV.
The plasmid map of Fig. 7 .pBTRT.
The dna sequence dna of Fig. 8 .pBTRT plasmid.First italicized item: T7 promotor; Band underscore part: ribozyme sequence; The italicized item of second band underscore: T7 terminator.
The plasmid map of Fig. 9 .pBRN-FL-QHwH5.
The dna sequence dna of Figure 10 .pBRN-FL-QHwH5 plasmid.Band underscore italicized item: QHwH5 gene order (SEQ ID No.1).
The plasmid map of Figure 11 .pBRN-FL-QHmH5.
The dna sequence dna of Figure 12 .pBRN-FL-QHmH5 plasmid.Band underscore italicized item: QHmH5 gene order (SEQ ID No.2).
Figure 13 .AV1615 genome cDNA sequence, wherein the 122nd to 1591bp is the encoding sequence of gene NP, and the 1887th to 3074bp is the encoding sequence of gene P, and the 8381st to 14995bp is the encoding sequence of gene L.
Figure 14. the sequence of plasmid pB SNP, the italicized item of band underscore is the encoding sequence of NP gene.
Figure 15. the sequence of plasmid pBSP, the italicized item of band underscore is the encoding sequence of P gene.
Figure 16. the sequence of plasmid pBSL, the italicized item of band underscore is the encoding sequence of L gene.
Embodiment
Hereinafter describe reference example in detail the present invention, described embodiment only is intended as illustrative explanation the present invention, rather than intention limits the scope of the invention.Scope of the present invention is specifically limited by accompanying Claim.
Embodiment 1 expresses the structure of wild-type or the proteic recombinant new castle disease LaSota attenuated vaccine strain of mutant avian influenza virus H5 hypotype hemagglutinin (HA)
Cell, virus and test materials
BHK-21 cell (newborn hamster nephrocyte ATCC CCL-10), the DMEM (Eagle ' s substratum of Dulbecco ' s improvement) of substratum for containing 10% foetal calf serum (Hyclone) and 1 μ g/ml G418; NDV Lasota vaccine strain AV1615 (available from Chinese veterinary microorganism culture presevation administrative center (CVCC)).-70 ℃ of inoculation 9-10 age in days SPF chick embryo allantoic cavity amplification backs are frozen standby; The anti-NDV height of the chicken property exempted from serum is by this research department's preparation (Chu, H.P., G.Snell, D.J.Alexander and G.C.Schild.1982.Avian Pathol 11:227-234); SPF chicken embryo and SPF chicken provide by Harbin veterinary institute SPF Experimental Animal Center.H5 hypotype highly pathogenic avian influenza virus (HPAIV) A/Bar-headed goose/Qinghai/3/2005 (H5N1) (the dead bar-headed goose of Qinghai Lake in 2005 separates H5 subtype avian influenza virus strain QH/05, available from Chinese Harbin veterinary institute) and SPF chicken hyper-immune serum thereof, H5 hypotype HPAIV isolate A/Goose/Guangdong/1/1996/H5N1 (GD/96), reverse genetic manipulation are rescued the wild-type Newcastle disease virus LaSota vaccine (rLaSota) that obtains respectively available from the Harbin veterinary institute.
The structure of transcription vector
Geneome RNA transcription vector pBTRT be a skeleton and at the insertion of EcoRI/salI site T7 promotor (T7 promotor), fourth hepatovirus ribozyme (Rib) and T7 transcription termination signal (T7 terminal) with low copy cloning vector pBR322 (Invitrogen), is made up voluntarily by this laboratory.The dna fragmentation that is cloned between T7 promotor and the ribozyme can be transcribed under the effect of t7 rna polymerase, and because the autocatalysis function of Rib can guarantee that 3 of transcription product ' end is accurately consistent with clone's dna segment.
Insert the structure of the reorganization NDV LaSota pnca gene group full-length cDNA of wild-type and mutant HA gene
For setting up the reverse genetic operating system of NDV newcastle disease Lasota vaccine strain, must at first make up the full length cDNA clone of corresponding gene group, transcribe template as the genome strand RNA, ten cDNA cloned sequences that cover whole genome have been made up for this reason, utilize the restriction enzyme site of lap between each segment, assemble the global cDNA clone who has obtained 15186nt at low copy plasmid transcription vector plasmid pBTRT, the sequencing result has logined GenBank, accession number is AY845400, and with the wild-type and the mutant HA gene of H5 subtype avian influenza virus, QHwH5 (band underscore italicized item among Figure 10, sequence table SEQ ID No.1) and the QHmH5 gene (the full length gene dna sequence dna is seen among Figure 12 band underscore italicized item, sequence table SEQ ID No.2), is cloned into P, between the M.In full-length cDNA fragment 5 ' terminal prefix t7 rna polymerase promotor, having no progeny at the cDNA sheet is connected with hepatitis δ ribozyme (GenBank X04451) and the T7 transcription termination signal with self-catalysis.The plasmid that structure is finished respectively the plasmid map of called after pBRN-FL-QHwH5 and pBRN-FL-QHmH5 and DNA complete sequence thereof see respectively Fig. 9,10 and Figure 11,12).For avoiding methylating of Xba I site, be C with F protein-coding region the 6178th bit base in the genome cDNA by T same sense mutation by the pcr gene group, and as the viral molecule marker of rescue.The same with other investigators, at T7 polymerase promoter two unnecessary G of 5 ' terminal introducing in genome cDNA, this has the virus rescue that helps the paramyxovirus reverse genetic manipulation simultaneously for we.Specific as follows:
NDV Lasota vaccine strain virus egg inoculation allantoic fluid extracts geneome RNA through conventional method (animal virology, second edition); Whole genome is divided into 10 fragments of terminal portions eclipsed (F1-F10) and carries out the RT-PCR amplification, the cDNA fragment cloning is to pBluescript (Clontech) SmaaI site and in full accord through sequential analysis conclusive evidence and virus genome RNA sequence: the sequencing result has logined GenBank, and accession number is AY845400.For introducing special molecular genetic label, select Lasota vaccine strain genome cDNA 6172 bp places to have monomethylated XbaI site, sequence is TCTAGATCA, utilize the PCR means that it is sported TCTAGACCA, make it discerned by methylase, thereby can discern by being limited property restriction endonuclease XbaI; The restriction site that utilizes the adjacent segment lap to exist connects into the complete NDV genome cDNA (Figure 1A) of assembling; From H5 hypotype highly pathogenic avian influenza virus (HPAIV) A/Bar-headedgoose/Qinghai/3/2005 (H5N1), mutant HA gene (QHmH5) is to produce by continuous 4 basic aminoacidss of PCR artificial mutation disappearance cracking site to wild-type HA gene (QHwH5) the encoding sequence cDNA of H5 subtype avian influenza virus by RT-pcr amplification.Adopt upstream primer 5 ' GTTTAAACCTTAGAAAAAATACGGGTAGAACCAGTTGTGCC respectively
ACCATGGAGAAAATAGTGCTTCTT3 ', with downstream primer 5 ' GTTTAAACTTAAA TGCAAATTCTGCATTGT3 ', QHwH5 and QHmH5 are carried out the PCR modification, hold introducing NDV polysaccharase Transcription Termination and homing sequence (GE/GS) (TTAAGAAAAAA/T/ACGGGTAGAA) at 5 ' of cDNA, and introduce the PmeI restriction site respectively at its two end.QHwH5 and QHmH5cDNA after modifying are handled through the PmeI restriction enzyme digestion respectively, be cloned into the P of NDV genome cDNA, between the M (through the manually-injected PmeI of PCR site), and be cloned between the T7 promotor and fourth hepatovirus ribozyme sequence-T7 transcription termination sequence of transcription vector pBTRT, be built into the wild-type that contains the H5 subtype avian influenza virus and the recombination group of mutant HA gene QHwH5 and QHmH5 gene respectively and transcribe plasmid pBRN-FL-QHwH5 and pBRN-FL-QHmH5 (Figure 1B).And then open reading frame (ORF) cDNA that expresses nucleoprotein (NP), phosphoric acid albumen (P) and big polymerase protein (L) gene is cloned in pBluescript II SK (+/-) SmaI site, plasmid T7 promotor downstream respectively, constitute respectively and transcribe helper plasmid pBSNP, pBSP and pBSL.Rescue from recombinant full-lenght cDNA clone and to obtain infectious NDV (virus rescue)
For the infectious NDV of rescue from clone's cDNA, at first respectively with pBRN-FL-QHwH5 and pBRN-FL-QHmH5 and express NDV NP, the proteic helper plasmid cotransfection of P, L infects the BHK-21 cell of expressing T7 polysaccharase recombinant poxvirus in advance.The fusion protein F 0 of NDV must be cracked into F1 and F2 just has infectivity, for the Lasota low virulent strain, the BHK-21 cell can not be secreted the required pancreatin proteolytic enzyme of cracking F0 albumen, therefore substratum should change serum free medium into and add the pancreatin (Sigma that TPCK (tosylphenylalanine chloromethyl ketone) handles this moment, Cat# T8802) (1 μ g/ml), continue to cultivate 2-3 days, results transfectional cell supernatant is inoculated in the SPF chicken embryo of 9-11 age in days.Gather in the crops chick embryo allantoic liquid after 4 days, blood clotting (HA) the test-results positive, the HA valency of Different Chicken embryo is between 2 8-11NDV immune serum blood clotting suppresses (HI) analysis of experiments and presents positive findings equally.Results virus-positive allantoic fluid is as rescuing the F1 generation of obtaining viral rL-QHwH5 and rL-QHmH5.Further RT-PCR and The sequencing results show, it is C that F1 generation is rescued the 6178 site bases that obtain viral genome cDNA, but not the T of former LaSota parent plant, with expection conform to fully (Fig. 2).The result shows, by anti-Genetic Manipulative Technology, utilizes the H5 avian influenza virus HA gene recombination genome cDNA clone of NDV LaSota vaccine strain, successfully rescues to obtain to have infective progeny virus rL-QHwH5 and rL-QHmH5.More specifically, experimental procedure is as follows:
The BHK-21 cell inoculation is grown when reaching the 50-80% individual layer in 35mm six orifice plates, to transcribe plasmid and helper plasmid pBRN-FL-QHwH5 or pBRN-FL-QHmH5, pBSNP, pBSP and pBSL respectively with 5 μ g, 2.5 μ g, 1.25 μ g1.25 μ g, cotransfection BHK-21 cell adopts CaPO 4Transfection reagent box (Invitrogene), operation is undertaken by the test kit specification sheets.After the transfection 8-12 hour, discard transfection mixture, with the PBS liquid shock cell that contains 10%DMSO 2.5 minutes, add complete DMEM night incubation, changed serum free medium in second day into, and add after TPCK (1 μ g/ml) continues to hatch 2-3 days, results culture supernatant, 0.22um aperture filter filter 9-11 days SPF embryo allantoic cavity of back inoculation; Postvaccinal SPF embryo continues to cultivate, 3-5 days, get blood clotting (HA) and blood clotting inhibition (HI) test (ThayerSG that chick embryo allantoic liquid 50 μ l carry out Avian pneumo-encephalitis virus routinely, Nersessian BN, Rivetz B, Fletcher OJ.Comparison of serological tests forantibodies against Newcastle disease virus and infectious bronchitis virus usingImmunoComb solid-phase immunoassay, a commercial enzyme-linkedimmunosorbent assay, and the hemagglutination-inhibition assay.Avian Dis.1987 Jul-Sep; 31 (3): 459-63.).The positive allantoic fluid of results HA and HI test-results ,-70 ℃ are frozen, and according to a conventional method respectively at 9-10 day instar chicken embryo and every milliliter of EID of chick embryo fibroblast titration 50And PFU viral level (10)Difference called after rL-QHwH5 and rL-QHmH5.
Embodiment 2 reorganization NDV express AVI HA albumen indirect immunofluorescence assay (IFA) test
The mammalian cell of NDV LaSota vaccine strain energy one passing infection vitro culture.For proof rL-OHwH5 and rL-QHmH5 virus are duplicated and virus antigen is expressed in that BHK-21 is intracellular, the two allantotoxicon is the individual layer BHK-21 cell (Fig. 3 A and B) that 1 virus quantity infects about 70-80% respectively with MOI, be contrast (Fig. 3 C) with NDV wild-type LaSota vaccine strain cells infected simultaneously, infect back 20 hour cells and early stage CPE (cytopathy) phenomenon occurs, exempting from SPF chicken positive serum with the NDV height immediately serves as to detect antibody to carry out indirect IF staining, observe strong positive reaction (Fig. 3 A under three kinds of virus infected cell fluorescent microscopes as a result, B and C) more specifically, experimental procedure is as follows:
Respectively with the egg inoculation two generation allantois virus liquid rL-QHwH5 that goes down to posterity, rL-QHmH5 and wild-type LaSota vaccine strain AV1615 (Fig. 3 D, E and F) dilution of DMEM suitable multiple, press MOI=5,50 μ l volumes infect the BHK-21 that grows in 24 orifice plates, 37 ℃, wash three times with DMEM after hatching 1h, adding complete DMEM then continues to cultivate, behind the 24h with 95% ethanol fixed cell 5min, after PBST (phosphate buffered saline buffer that contains 0.05% polysorbas20) washes behind the cell and to seal 1 hour with the SPF chicken serum, it is one anti-exempting from SPF chicken positive serum with the anti-H5 hypotype of chicken highly pathogenic avian influenza virus height, after acting on after 30 minutes the PBST washing, the anti-chicken IgG two of rabbit anti-(Sigma) that adds 1:160 dilution fluorescein (FITC) mark, effect 30min, PBST washing back fluorescent microscope (Leica DMIRES2) is observed, strong positive reaction all appears in rL-QHwH5 and rL-QHmH5 cells infected, and wild-type Lasota cells infected is then negative fully.
The result shows, recombinant Newcastle disease virus rL-QHwH5 and rL-QHmH5 successful expression H5 subtype avian influenza virus HA antigen protein.
Embodiment 3 rNDV are at chicken growth of the embryo characteristic and pathogenic property
For determining that reverse genetic manipulation rescues the chicken embryonic development characteristic that obtains rL-QHwH5 and rL-QHmH5 and pathogenic to the chicken embryo thereof, will rescue to obtain viral chicken embryo amplification F1 generation by 1x10 4EID 50Inoculation 9～10 age in days SPF chick embryo allantoic cavities.Reverse genetic manipulation is rescued the wild-type Newcastle disease virus LaSota vaccine strain (rLaSota that obtains as a result, promptly use transcription vector pBTRT and transcribe helper plasmid pBSNP, pBSP and pBSL, rescue the wild-type Newcastle disease virus LaSota vaccine strain AV161 that obtains by reverse genetic manipulation as described in the present invention) SPF chicken embryo fully caused death in 120 hours, inoculate back 24 hours, 48 hours, 72 hours and 96 hours results allantoic fluids, every milliliter of allantoic fluid EID 50Then be respectively 10 -8.5, 10 -86, 10 -100With 10 -9.4RL-QHwH5 and rL-QHmH5 same dose approach inoculation 9～10 age in days SPF chick embryo allantoic cavities, SPF chicken embryo did not equally cause death in 120 hours; RL-QHwH5 inoculates back 24 hours, 48 hours, 72 hours and 96 hours results allantoic fluids, every milliliter of allantoic fluid EID 50Then be respectively 10 -82, 10 -86, 10 -90With 10 -8.5RL-QHmH5 inoculates back 24 hours, 48 hours, 72 hours and 96 hours results allantoic fluids, and every milliliter of allantoic fluid EID 50Then be respectively 10 -79, 10 -85, 10 -92With 10 -86It is similar that the result of Fig. 4 shows that reverse genetic manipulation is rescued the chicken embryonic development kinetics and the wild strain NDV Lasota vaccine strain (rLaSota) that obtain viral rL-QHwH5 and rL-QHmH5, still keeps high titre growth and the low lethal biological characteristics of NDV LaSota vaccine parent plant at the chicken embryo.
Next recombinant virus rL-QHwH5 and rL-QHmH5 and reverse genetic manipulation are rescued and obtained viral wild-type Lasota vaccine strain (rLaSota), promptly rLaSota carries out pathogenic comparative analysis.Specifically carrying out intracerbral pathogenicity index (ICPI), intravenously pathogenic index (IVPI) and the average lethal time of chicken embryo (MDT) by International Animal Health tissue (O.I.E.) proposed standard measures.The LaSota toxic vaccine strain ICPI alive that is used for newborn hay chicken should or be lower than 0.4 about 0.4.As a result, recombinant virus rL-QHmH5rL-QHwH5 not only keeps the low pathogenicity of NDV Lasota vaccine strain AV1615, and a little less than being caused more.The above results has shown that this reorganization NDV has kept high titre growth characteristics and the low pathogenicity of parent LaSota vaccine strain at SPF chicken embryo.
The pathogenic analysis of table 1. recombinant Newcastle disease virus
Virus strain The average lethal time of chicken embryo (hour) (MDT) ** Intracerbral pathogenicity index (ICPI) ** Intravenously pathogenic index (IVPI) ** F protein cleavage site sequence is analyzed ***
rLasota >120 0.35 0 GGRQGR?L
rL-QHmH5 >120 0 0 GGRQGR?L
rL-QHwH5 >120 0 0 GGRQGR?L
*Undertaken by the O.I.E proposed standard.
* *Conventional RT-PCR and sequential analysis.
Embodiment 4 induces the immune effect of protection antibody
Rescuing and obtain viral rL-QHwH5 and the rL-QHmH5 immunogenicity to the SPF chicken for measuring reverse genetic manipulation, is example with rL-QHwH5, and F1 is for allantotoxicon 2x10 for the amplification of chicken embryo 6EID 50Dosage adds eye droppings approach artificial immunization 12 plumages seven ages in days white through collunarium and comes prosperous SPF chicken (Harbin veterinary institute SPF Experimental Animal Center provides), and other establishes non-immune group control group 8 plumages; Immune group and non-immune control group are raised respectively in air negative pressure and are filtered in the shield retaining.3 weeks were detected the special hemagglutination inhibition antibody of newcastle disease and H5 subtype avian influenza routinely with hind wing venous blood collection separation of serum.
In experimental result: rL-QHwH5 and rL-QHmH5 allantois virus liquid F1 generation, is respectively with 2x10 6EID 50Dosage adds eye droppings approach artificial immunization seven ages in days white through collunarium and comes prosperous SPF chicken, and 3 weeks were observed in the immunity back, during all chick of immune group do not have any unusual, feed intake and growing and non-immune control group no significant difference; As a result, 3 weeks behind immunized chicks of two kinds of weak poison of recombinant virus, can induce the special HI antibody horizontal reaction of high-caliber NDV and H5 hypotype AIV, and longer duration.The result shows that reorganization has good immunogenicity, and keeps the good security of low pathogenicity LaSota vaccine strain.Fig. 5 shows that recombinant virus rL-QHwH5 and rL-QHmH5 virus induction are to the immunoreactive one group of representative data of the protection antibody of H5 hypotype AIV.Fig. 6 shows that recombinant virus rL-QHwH5 and rL-QHmH5 virus induction are to the immunoreactive one group of representative data of the protection antibody of NDV.Above-mentioned data show that recombinant virus rL-QHwH5 and rL-QHmH5 virus can both induce the protection antibody immune response to NDV and AIV simultaneously.
In addition, for rL-QHwH5 and rL-QHmH5 virus, respectively they and NDV Lasota vaccine strain AV1615 are compared the immunoprotection of the strong malicious F48E9 of newcastle disease (available from CVCC) lethal hit.The result shows at table 2, shows that rL-QHwH5 and rL-QHmH5 virus both and AV1615 have the identical immanoprotection action to the strong malicious lethal hit of newcastle disease.
Table 2.H5 subtype avian influenza Avian pneumo-encephalitis virus live vector bivalent vaccine rL-QHwH5 and rL-QHmH5 immunity SPF chick in 1 age in week are to the immunoprotection of the strong malicious lethal hit of newcastle disease
*Vaccine adds eye droppings approach immunity 7 Japanese instar chicklings, every plumage 2x10 through collunarium 6EID 50Dosage is totally 100 μ l volumes;
*The strong malicious F48E9 strain 10 of NDV is adopted in immunity back 21 days (28 age in days) 4ELD 50Dosage is attacked through intramuscular injection path, continues to observe 21 days.
At last, respectively with two kinds of H5 subtype avian influenza Avian pneumo-encephalitis virus live vector bivalent vaccines of rL-QHwH5 and rL-QHmH5 virus to 1 week SPF chick immunity in age, assess its immunoprotection to H5 hypotype highly pathogenicity avian influenza lethal hit.The result is as shown in table 3, and the result shows, rL-QHwH5 and rL-QHmH5 virus recombiant vaccine immunized chicks cause death to attack to newcastle disease virulent strain and H5 hypotype highly pathogenic avian influenza virus and form 100% complete immunoprotection immunoprotection, does not fall ill, not dead; After attacking, H5 hypotype highly pathogenic avian influenza virus stops respiratory tract, the discharging of digestive tube virus fully.
Figure C200610075781D00191
This research selects China to cultivate voluntarily, widespread use for many years in the production, facts have proved that the good strain Avian pneumo-encephalitis virus LaSota attenuated vaccine of immune effect is as parent plant, anti-gene manipulation techniques by minus-stranded rna virus, non-coding region is that foreign gene inserts the site between interior P gene of selection genome and M gene, made up expression H5 hypotype highly pathogenic avian influenza virus A/Bar-headedgoose/Qinghai/3/2005 (H5N1), the reorganization NDV strain of the mutant HA immunogen gene of the HA immunogen gene of wild-type and the continuous a plurality of basic aminoacidss of artificial disappearance cracking site, rL-QHwH5 and rL-QHmH5, as two valency attenuated vaccine candidate strain of prevention newcastle disease and H5 hypotype highly pathogenicity avian influenza, and carried out the biological safety assessment.Studies show that the NDV genome inserts external source reporter gene or immunogen gene in different loci, going down to posterity through cell or the continuous high generation of chicken embryo still keeps biological characteristics, low pathogenicity and genomic genetic stability.Immunity test result to recombinant virus rL-QHwH5 and rL-QHmH5 shows, rL-QHmH5 and rL-QHmH5 recombiant vaccine once immunity can form 100% complete immunoprotection to the deadly attack of H5 hypotype highly pathogenicity avian influenza and the strong poison of newcastle disease, induce the ability of protection antibody suitable, and have more advantage aspect significant mucosal immunity and the cellular immunization inducing with existing inactivated vaccine; Kept parent LaSota vaccine strain to safe and effective, the high titre chicken of newborn chick embryonic development characteristic, advantage such as easy to use; The environment obvious social benefit, compare with traditional avian influenza vaccine, one of percentage that same dosage production of vaccine with chicken embryo amount only is, small product size only is a thousandth, and need not the use of mineral oil in producing, avoided traditional oil emulsion inactivated vaccine injection fully the influence of immunity to the commercial chicken body.
Avian pneumo-encephalitis virus makes up the control bird flu as live vector and the newcastle disease bivalent vaccine has huge superiority.Bird flu and newcastle disease are classified as the category-A deadly infectious disease by International Office of Epizootics, are the important diseases of harm world aviculture development, and bird flu has public health meaning of crucial importance simultaneously.At least more than 10,000,000,000 plumage parts, NDV attenuated vaccine particularly China's aviculture that is applied in of LaSota vaccine strain almost is the requisite immune programme for children of all newborn chick to the attenuated vaccine that China is used for the anti-system of newcastle disease every year.Avian pneumo-encephalitis virus (NDV) is an amerism sub-thread minus-stranded rna virus, genome structure and function background are clear, a serotype is only arranged, heredity is relatively stable, the foreign gene that inserts among the reorganization NDV still can keep stably express at cell or chicken embryo after high generation goes down to posterity, be suitable as very much and express or vaccine carrier.For a long time, the safety and effectiveness of the weak malicious LaSota vaccine strain of NDV is fully proved; The malicious vaccine immunity of living can be induced the formation of general humoral immunization, local mucous membrane immunity and cellular immunization simultaneously, forms more comprehensive, certain immunoprotection; Can or inject multiple mode and give seedling by drinking-water, spraying, collunarium, eye droppings, extremely easy to use; NDV has the chicken embryonic development characteristic of high titre, and production cost is very cheap.
The external source H5 subtype avian influenza HA immunogen gene of rL-QHwH5 and rL-QHmH5 is separated a strain advantage epidemic isolates virus strain from bar-headed goose from China's Qinghai Lake migratory bird epidemic situation outburst process in 2005, A/Bar-headed goose/Qinghai/3/2005 (H5N1), during 2005 to 2006, this strain is migrated with migratory bird and is transmitted to Mongolia, Russia, Europe, West Asia, the Middle East and Africa, not only cause a large amount of poultry epidemic situations to take place, and cause people's infection morbidity and death in a plurality of countries.Recombinant virus rL-QHwH5 and rL-QHmH5 are as the safety of anti-system H5 subtype avian influenza, effectively, with low cost, new generation vaccine easy to use is applied to above-mentioned countries and regions, on the HA antigenicity, have the outstanding advantage of height at epidemic isolates, Eastern Europe particularly, the West Asia, the Middle East and Africa, newcastle disease in these areas always as the harm that is widely current of endemicity disease, Newcastle disease attenuated immunity is requisite immune programme for children, therefore, rL-QHwH5 and rL-QHmH5 have more great realistic meaning as the bigeminy reorganization malicious vaccine alive that can effectively prevent system H5 avian influenza and newcastle disease.
The application of rL-QHmH5 recombiant vaccine, to make the anti-system of vaccine of H5 hypotype highly pathogenicity avian influenza almost no longer need extra manufacturing cost and use cost, can save a large amount of anti-epidemic expenditures and social labor cost every year at least in China, and reduce the distress reaction of immune object.Existing data show that this vaccine compares with avian influenza vaccine with existing newcastle disease, have huge society, economy and environmental benefit advantage, and state, inside and outside market outlook are wide.Avian pneumo-encephalitis virus is international advanced new technique as vaccine carrier, if further accelerate progress, H5 subtype avian influenza Avian pneumo-encephalitis virus live vector vaccine rL-QHwH5 or rL-QHmH5 will be expected to become and push produce one of actual minus-stranded rna virus live vector vaccine in the world in the first batch to.
Reference
1.Takaaki?Nakaya，Jerome?Cros，Man-Seong?Park，Yurie?Nakaya，Hongyong?Zheng，Ana?Sagrera，Enrique?Villar，Adolfo?Garci′A-Sastre，andPeter?Palese.2001.Recombinant?Newcastle?Disease?Virus?as?a?Vaccine?VectorJournal?of?Virology，75：11868-11873
2.Ben?P.H.Peeters，Olav?S.Deleeuw，Guus?Koch?and?Arnol.J.Gielkens1999.Rescue?of?Newcastle?Disease?Virus?from?Cloned?cDNA：Evidence?thatCleavability?of?the?Fusion?Protein?Is?a?Major?Determinant?for?Virulence.Journal?of?Virology.73：5001-5009
3.Zhuhui?Huang，Aruna?Panda，Subbiah?Elankumaran，DhanasekaranGovindaraj?an，Daniel?D.Rockemann，and?Siba?K.Samal.2003.TheHemagglutinin-Neuraminidase?Protein?of?Newcastle?Disease?Virus?DeterminesTropism?and?Virulence.Journal?of?Virology.78：4176—4184
4.Zhuhui?Huang，Sateesh?Krishnamurthy，Aruna?Panda，and?Siba?K.Samal.2003.Newcastle?Disease?Virus?V?Protein?Is?Associated?with?ViralPathogenesis?and?Functions?as?an?AlphaInterferon?Antagonist.Journal?ofVirology.77：8676-8685
5.Teshome?Mebatsion，Leonie?T.C.de?Vaan，Niels?de?Haas，AngelaRo″mer-Oberdo″rfer，and?Marian?Braber.2003.Identification?of?a?Mutation?inEditing?of?Defective?Newcastle?Disease?Virus?Recombinants?That?ModulatesP-Gene?mRNA?Editing?and?Restores?Virus?Replication?and?Pathogenicity?inChicken?Embryos.Journal?of?Virology.77：9259-9265
6.Man-Seong?Park，Adolfo?Garcia-Sastre，Jerome?F.Cros，Christopher?F.Basler，and?Peter?Palese.2003.Newcastle?Disease?Virus?V?Protein?Is?aDeterminant?of?Host?Range?Restriction.Journal?of?Virology.77：9522-9532
7.Z.Huang，S.Elankumaran，A.Panda，andS.K.Samal.2003.RecombinantNewcastle?Disease?Virus?as?a?Vaccine?Vector.Poultry?Science.82：899-906
8.Gabriele?Neumann，Michael?A.Whitt?and?Yoshihiro?Kawaoka.2002.Adecade?after?the?generation?of?a?negative-sense?RNA?virus?from?clondcDNA-what?have?we?learned？Journal?of?General?Virology.83：2635-2662
9.Angela?Romer-Oberdorfer，Egbert?Mundt，Teshome?Mebatsion，UrsulaJ.Buchholz.1999.Generation?of?recombinant?lentogenic?Newcastle?diseasevirus?from?cDNA.Journal?of?General?Virology.80：2987-2995
10.B.P.H.Peeters, Y.K.Gruijthuijsen, O.S.de Leeuw and A.L.J.Gielkens.2000.Genome replication of Newcastle disease virus:involvement ofthe rule-of-six.Archives of Virology.145:1829-1845
Sequence table
＜110〉Harbin Veterinary Medicine Inst., China Academy of Agriculture
＜120〉recombinant new castle disease LaSota attenuated vaccine strain of expression avian influenza virus H5 subtype HA protein
<130>IB061844
<160>2
<170>PatentIn?version?3.1
<210>1
<211>1707
<212>DNA
＜213〉wild-type avian influenza virus H5 hypotype
<400>1
Figure C200610075781D00231
Figure C200610075781D00241
<210>2
<211>1695
<212>DNA
＜213〉artificial sequence
<400>2
Figure C200610075781D00242

Claims (9)

1. recombinant new castle disease LaSota attenuated vaccine strain of expressing encoding wild type or the proteic gene of mutant avian influenza virus H5 hypotype hemagglutinin (HA), the proteic gene of wherein said encoding wild type HA has the nucleotide sequence shown in the SEQ ID No.1, and the proteic gene of described encoding mutant type HA has the nucleotide sequence shown in the SEQ ID No.2.
2. according to the recombinant new castle disease LaSota attenuated vaccine strain of claim 1, wherein said to be used to express the proteic new castle disease LaSota attenuated vaccine strain of HA be AV1615.
3. according to the recombinant new castle disease LaSota attenuated vaccine strain of claim 2, it is rL-QHwH5 and rL-QHmH5.
According among the claim 1-3 any one recombinant new castle disease LaSota attenuated vaccine strain the preparation birds flu-preventing vaccine in application.
5. method of producing the recombinant new castle disease LaSota attenuated vaccine strain of claim 1, this method comprises:
(1) structure is transcribed plasmid, this transcribes the genome cDNA sequence that plasmid comprises the described new castle disease LaSota attenuated vaccine strain of the gene that wherein inserts encoding wild type or mutant avian influenza virus H5 subtype HA protein, the nucleotide sequence of the proteic gene of wherein said encoding wild type HA is shown in SEQID No.1, and the nucleotide sequence of the proteic gene of described encoding mutant type HA is shown in SEQID No.2;
(2) make up one or more helper plasmids of transcribing, this helper plasmid comprises the cDNA sequence of the big polymerase protein (L) of the cDNA sequence of phosphoric acid albumen (P) of the cDNA sequence of the nucleoprotein (NP) of the described new castle disease LaSota attenuated vaccine strain of encode, the described new castle disease LaSota attenuated vaccine strain of encoding and the described new castle disease LaSota attenuated vaccine strain of encoding;
(3) with the described host cell of transcribing plasmid and transcribing the described new castle disease LaSota attenuated vaccine strain copy permission of helper plasmid cotransfection, the host cell after the cultivation transfection;
(4) results supernatant liquor filters that the back continues that sensitive cells goes down to posterity or the inoculated into chick embryo allantoic cavity is rescued and obtained recombinant virus.
6. according to the method for claim 5, the wherein said plasmid of transcribing is pBRN-FL-QHwH5 or pBRN-FL-QHmH5.
7. according to the method for claim 5, the wherein said helper plasmid of transcribing is plasmid pBSNP, pBSP and pBSL.
8. according to any one method among the claim 5-7, wherein said LaSota attenuated vaccine strain is AV1615.
9. according to any one method among the claim 5-7, wherein said host cell is the clone BHK-21 of stably express T7 polysaccharase.
CNB2006100757816A 2006-05-09 2006-05-09 Recombination newcastle disease LaSota weak virus vaccine for expressing poultry influenza virus H5 sub type HA protein Active CN100487119C (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CNB2006100757816A CN100487119C (en) 2006-05-09 2006-05-09 Recombination newcastle disease LaSota weak virus vaccine for expressing poultry influenza virus H5 sub type HA protein
PCT/CN2006/001626 WO2007128169A1 (en) 2006-05-09 2006-07-10 RECOMBINANT NEWCASTLE DISEASE LaSota LOW VIRULENT VACCINE STRAIN EXPRESSING AVIAN INFLUENZA VIRUS H5 SUBTYPE HA PROTEIN

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CNB2006100757816A CN100487119C (en) 2006-05-09 2006-05-09 Recombination newcastle disease LaSota weak virus vaccine for expressing poultry influenza virus H5 sub type HA protein

Publications (2)

Publication Number Publication Date
CN1869234A CN1869234A (en) 2006-11-29
CN100487119C true CN100487119C (en) 2009-05-13

Family

ID=37443013

Family Applications (1)

Application Number Title Priority Date Filing Date
CNB2006100757816A Active CN100487119C (en) 2006-05-09 2006-05-09 Recombination newcastle disease LaSota weak virus vaccine for expressing poultry influenza virus H5 sub type HA protein

Country Status (2)

Country Link
CN (1) CN100487119C (en)
WO (1) WO2007128169A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150056245A1 (en) * 2008-11-19 2015-02-26 Laboratorio Avi-Mex, S.A. De C.V. Recombinant inactivated viral vector vaccine

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP5884100B2 (en) * 2011-08-31 2016-03-15 公益財団法人東京都医学総合研究所 Recombinant vaccinia virus derived from a DIs strain having a hemagglutinin protein gene derived from a new influenza virus
CN102373180B (en) * 2011-09-26 2013-06-19 中国农业科学院哈尔滨兽医研究所 Recombinant duck enteritis virus (DEV) vaccine strain for expressing avian influenza virus haemagglutinin (HA) gene and constructing method and application thereof
CN107384875A (en) * 2017-09-01 2017-11-24 扬州大学 Chimeric the newcastle Disease poisonous carrier H7 live vaccines Candidate Strain and its construction method for overcoming chicken Newcastle disease maternal antibody to influence
CN108060141B (en) * 2017-12-14 2021-05-28 天津瑞普生物技术股份有限公司 VP2 gene and NP gene recombinant adenovirus and application thereof
CN110559434B (en) * 2018-06-05 2022-08-19 普莱柯生物工程股份有限公司 Avian influenza virus-like particle vaccine, and preparation method and application thereof
CN109096377B (en) * 2018-09-19 2021-03-23 天康生物股份有限公司 Avian influenza virus hemagglutinin antigen, BHK-21 cell strain expressing avian influenza virus hemagglutinin antigen, preparation method and vaccine
CN112111503B (en) * 2020-08-24 2023-04-07 河北省动物疫病预防控制中心 Adenovirus vector bivalent vaccine for simultaneously preventing H5 and H9 subtypes of avian influenza and preparation method thereof
CN113005099A (en) * 2021-03-25 2021-06-22 江苏省农业科学院 W protein silent recombinant newcastle disease virus rVII-NJ-Wko strain and preparation method and application thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2000201674A (en) * 1999-01-14 2000-07-25 Chemo Sero Therapeut Res Inst Attenuated newcastle disease virus, and vaccine or diagnostic antigen containing the same
CN1354800A (en) * 1998-09-14 2002-06-19 纽约城市大学辛乃山医科学校 Recombinant newcastle disease virus RNA expression systems and vaccines
US20040258713A1 (en) * 2001-10-04 2004-12-23 Jan Mast Attenuated mutant newcastle disease virus strains for in ovo vaccination, method for preparing and their use

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7132291B2 (en) * 2003-05-05 2006-11-07 Dow Agro Sciences Llc Vectors and cells for preparing immunoprotective compositions derived from transgenic plants
CN1261564C (en) * 2003-12-02 2006-06-28 中国农业科学院哈尔滨兽医研究所 Artificial recombined influenza virus and its application
CN1298845C (en) * 2005-09-02 2007-02-07 中国农业科学院哈尔滨兽医研究所 Recombinant Newcastle disease LaSota low virulent vaccine strain expressing bird flu virus H5 subtype HA protein

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1354800A (en) * 1998-09-14 2002-06-19 纽约城市大学辛乃山医科学校 Recombinant newcastle disease virus RNA expression systems and vaccines
JP2000201674A (en) * 1999-01-14 2000-07-25 Chemo Sero Therapeut Res Inst Attenuated newcastle disease virus, and vaccine or diagnostic antigen containing the same
US20040258713A1 (en) * 2001-10-04 2004-12-23 Jan Mast Attenuated mutant newcastle disease virus strains for in ovo vaccination, method for preparing and their use

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150056245A1 (en) * 2008-11-19 2015-02-26 Laboratorio Avi-Mex, S.A. De C.V. Recombinant inactivated viral vector vaccine

Also Published As

Publication number Publication date
WO2007128169A1 (en) 2007-11-15
CN1869234A (en) 2006-11-29

Similar Documents

Publication Publication Date Title
CN100487119C (en) Recombination newcastle disease LaSota weak virus vaccine for expressing poultry influenza virus H5 sub type HA protein
CN1293195C (en) Reverse genetic operation system of New castle disease LaSota vaccine strain and its applciation
CN1298845C (en) Recombinant Newcastle disease LaSota low virulent vaccine strain expressing bird flu virus H5 subtype HA protein
Lee et al. Avian influenza virus: prospects for prevention and control by vaccination
CN102428099B (en) The epiornitic seedling of delivery Avian pneumo-encephalitis virus
US11305007B2 (en) Composite multi-epitope expression cassette, a recombinant virus composed thereof and application thereof
Tian et al. Protection of chickens against hepatitis-hydropericardium syndrome and Newcastle disease with a recombinant Newcastle disease virus vaccine expressing the fowl adenovirus serotype 4 fiber-2 protein
CN104962581B (en) A kind of recombinant viral vaccine strain for expressing African swine fever virus p72 albumen
CN101376027B (en) Recombined newcastle disease virus LaSota attenuated vaccine strain for expressing avian influenza virus H9 subtype HA protein
CN1772886A (en) Recombinant Newcastle disease LaSota low virulent vaccine strain expressing infectious bursal disease virus VP2 gene
CN104195116B (en) A kind of recombinant Newcastle disease virus and its construction method for expressing goose parvovirus VP3 genes
CN102399754A (en) H9N2 avian influenza virus vaccine strain and application of H9N2 avian influenza virus vaccine strain in immune protection
CN108728419A (en) Express aviadenovirus penton Protein reconstitutions newcastle disease vaccine Candidate Strain rAI4-penton and construction method
CN110904058B (en) Recombinant duck plague virus vaccine and construction method and application thereof
CN110218706A (en) Express the building and application of the recombinant herpesvirus of turkeys of H7N9 subtype highly pathogenic avian influenza virus HA albumen
CN100480377C (en) Infectious bursal disease virus VP2 gene expressed recombinant newcastle disease LaSota attenuated vaccine strain
Ruan et al. Generation and evaluation of a vaccine candidate of attenuated and heat-resistant genotype VIII Newcastle disease virus
CN102373183A (en) Mixed virus-like particle (VLP) of avian influenza and Newcastle disease, preparation method thereof and application thereof
CN104353070A (en) Genetic engineering subunit vaccine of chicken infectious bronchitis virus and preparation method thereof
CN107353328A (en) A kind of H9N2 subtype avian influenza virus sample particles of restructuring and its production and use
CN104830811A (en) NS1 gene deleted and live-attenuated vaccine candidate strain of H9N2 subtype avian influenza virus and its establishing method and application
CN1942578B (en) Low virulent strain of recombinant newcastle disease lasota vaccine expressing HA protein of avian influenza-H5 virus
CN108300702B (en) Chicken-derived H9N2 avian influenza virus cold-adapted strain screening method and application thereof
CN102816741A (en) Preparation method and application of newcastle disease virus living-vector vaccine through gene recombination of canine distemper attenuated vaccine strains F and H
CN102373184A (en) Avian influenza and infectious bronchitis hybrid virus-like particle as well as preparation method and application thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant