CN115010813B

CN115010813B - Enterovirus 71 virus-like particle, and preparation method and application thereof

Info

Publication number: CN115010813B
Application number: CN202210555594.7A
Authority: CN
Inventors: 刘启亮; 朱寒钰; 刘洪波; 章�宁; 王婧; 甘燕媚
Original assignee: Guilin Medical University
Current assignee: Guilin Medical University
Priority date: 2022-05-19
Filing date: 2022-05-19
Publication date: 2024-04-05
Anticipated expiration: 2042-05-19
Also published as: CN115010813A

Abstract

The invention discloses enterovirus 71 type virus-like particles, a preparation method and application thereof, and belongs to the technical fields of genetic engineering and biological medicine. The enterovirus 71 type virus-like particle is obtained by infecting SF9 insect cells with recombinant baculovirus expressing enterovirus 71 type P1 capsid protein gene and 3CD protease gene, and culturing to over 90% of SF9 insect cells after infection and lesion. The invention also discloses a preparation method and application of the enterovirus 71 type virus-like particle. Compared with wild enterovirus 71 type virus particles, the enterovirus 71 type virus-like particles have completely similar appearance structure and size, do not contain virus nucleic acid, have no replication and infection capability, have the function of stimulating host innate and adaptive immune response, and have higher in-vitro assembly efficiency.

Description

Enterovirus 71 virus-like particle, and preparation method and application thereof

Technical Field

The invention relates to enterovirus 71 virus-like particles, a preparation method and application thereof, and belongs to the technical fields of genetic engineering and biological medicine.

Background

Hand-foot-and-mouth disease (HFMD) is a common infectious disease caused by over twenty Enterovirus (EV) infections, and only Enterovirus group A71 (EV-A71) monovalent inactivated vaccines are currently marketed in China. EV-A71 type monovalent inactivated vaccine cannot generate cross protection against other enteroviruses. In recent years, the infection rate of enteroviruses other than EV-A71, such as CV-A16 and CV-A10, has been increasing year by year. The prior art has a plurality of bivalent EV-A71/CV-A16 inactivated or VLP vaccines, most of the multivalent vaccines are simple mixtures of different antigens, have better immunogenicity and can induce various protections, but the successful development of the multivalent vaccine needs strict and complex processes of strain screening, strain domestication, virus culture and the like, so that the development period is long, the cost is high, the biological safety risk exists in the production process, and the emergency prevention and control requirements of new emergent infectious diseases cannot be met.

Enterovirus group a71 (EV-a 71) is an icosahedral spherical particle with a diameter of 24-30nm, the viral genome comprising about 7.5kb bases, having only one open reading frame, a 5 'untranslated region and a 3' untranslated region, wherein the open reading frame encodes a polyprotein comprising about 2193 amino acids that can be hydrolyzed to 3 precursor proteins: p1, P2 and P3. Wherein capsid protein precursor P1 is cleavable into VP1, VP2, VP3 and VP4, and is assembled into a viral capsid in a cell. Cleavage of the capsid protein precursor P3 into the resulting 3C and 3D proteases plays a major role in the cleavage of the capsid protein precursor P1. VP1 contains an important epitope capable of neutralizing viruses, is antigenic and plays an important role in viral function. Studies show that P1 and 3CD are expressed simultaneously in cells, EV-A71 Virus-like particles (VLPs) can be formed, the size and the morphology of the EV-A71 Virus-like particles are similar to those of EV-A71 wild-type viruses, the EV-A71 Virus-like particles do not contain viral nucleic acid, have no replication and infection capacity, maintain the natural conformation of the EV-A71 wild-type Virus antigen protein, and have the functions of exciting the innate and adaptive immune responses of hosts. Three human vaccines based on VLPs are currently formally approved for the prevention of hepatitis b virus, human papilloma virus and hepatitis e virus. No enterovirus-related VLPs vaccine has been marketed.

The neutralizing epitope is a special small molecule peptide on the surface of a virus antigen protein, and can stimulate an organism to generate effective and specific neutralizing immune protection reaction. The main epitope of enteroviruses is proved to be positioned on VP1, and the current research has reported that EV-A71 VP1 linear neutralization epitope comprises 163-177 amino acid epitope peptide, 208-222 amino acid epitope peptide, 253-267 amino acid epitope peptide and the like, CV-A16 VP1 epitope comprises 109-123 amino acid epitope peptide, 163-177 amino acid epitope peptide, 187-202 amino acid epitope peptide, 271-285 amino acid epitope peptide and the like. There is no report on epitope peptide of CV-A10 VP1 linear neutralization epitope.

At present, no report exists that two CV-A10 epitopes and one CV-A16 epitope are simultaneously substituted for corresponding positions of a wild enterovirus EV-A71P 1 to construct a trivalent epitope chimeric EV-A71 virus-like particle.

Disclosure of Invention

The invention aims at providing enterovirus 71 type virus-like particles.

The technical scheme for solving the technical problems is as follows: an enterovirus 71 type virus-like particle is obtained by infecting SF9 insect cells with recombinant baculovirus expressing enterovirus 71 type P1 capsid protein gene and 3CD protease gene, and culturing to over 90% of SF9 insect cells after infection.

The enterovirus 71 type virus-like particle has the beneficial effects that:

1. compared with wild enterovirus 71 type virus particles, the enterovirus 71 type virus-like particles have completely similar appearance structure and size, do not contain virus nucleic acid, have no replication and infection capability, have the function of stimulating host innate and adaptive immune response, and have higher in-vitro assembly efficiency.

2. The enterovirus 71-like particle of the invention retains the natural conformation of most wild enterovirus 71-like particle antigen proteins, and retains immunogenicity and immunoprotection against enterovirus 71.

3. The enterovirus 71-type virus-like particle of the present invention also increases the protection efficiency against CV-A16 and CV-A10 by 20% and 40%, respectively, thus increasing the protection range of the vaccine.

On the basis of the technical scheme, the invention can be improved as follows.

Further, the preparation method of the recombinant baculovirus expressing the enterovirus 71 type P1 capsid protein gene and the 3CD protease gene comprises the following steps:

the enterovirus 71 type P1 capsid protein gene EV-A71-P1 optimized by SF9 insect cell preference codon ^CHI3 And 3CD protease gene optimized by SF9 insect cell preferential codon, and is connected with shuttle vector pOET5 of insect baculovirus to obtain recombinant plasmid pOET5-EV-A71-P1 ^CHI3 -3CD；

Then the recombinant plasmid pOET5-EV-A71-P1 is subjected to ^CHI3 Co-transfecting SF9 insect cells by using-3 CD and insect baculovirus genome Flash-BAC DNA, culturing to over 90% of SF9 insect cells to infect lesions, and obtaining expressed enterovirusRecombinant baculovirus of P1 capsid protein gene and 3CD protease gene of type 71;

wherein, the nucleotide sequence of the enterovirus 71 type P1 capsid protein gene optimized by SF9 insect cell preference codons is shown in SEQ ID NO. 1; the nucleotide sequence of the 3CD protease gene optimized by SF9 insect cell preference codons is shown as SEQ ID NO. 2.

The adoption of the method has the further beneficial effects that: by adopting the method, the recombinant baculovirus expressing the enterovirus 71 type P1 capsid protein gene and the 3CD protease gene can be prepared.

Furthermore, the SF9 insect cell preference codon optimized enterovirus 71 type P1 capsid protein gene EV-A71-P1 ^CHI3 The preparation method of (2) is as follows:

the VP1 linear neutralization epitope of the first CV-A10, the VP1 linear neutralization epitope of the second CV-A10 and the VP1 linear neutralization epitope of CV-A16 are respectively subjected to SF9 insect cell preference codon optimization, and then substitution is carried out on 1969 to 2016, 2179 to 2223 and 2314 to 2367 of the wild type enterovirus 71 type P1 capsid protein genes respectively, so as to obtain the polypeptide;

the nucleotide sequence of the VP1 linear neutralization epitope of the first CV-A10 after SF9 insect cell preference codon optimization is shown as SEQ ID NO.3, the nucleotide sequence of the VP1 linear neutralization epitope of the second CV-A10 after SF9 insect cell preference codon optimization is shown as SEQ ID NO.4, the nucleotide sequence of the VP1 linear neutralization epitope after SF9 insect cell preference codon optimization is shown as SEQ ID NO.5, and the nucleotide sequence of the P1 capsid protein gene of the wild type enterovirus 71 type is shown as SEQ ID NO. 6.

The adoption of the method has the further beneficial effects that: the inventors of the present invention studied and identified earlier that the linear neutralizing epitope of CV-A10 VP1 comprises nucleotides 1969 to 2016 and 2179 to 2223. According to the invention, two neutralizing epitopes of CV-A10 are selected for codon optimization respectively. One neutralizing epitope peptide of CV-A16 was selected for codon optimization.

According to the invention, the wild enterovirus 71 type virus-like particle is taken as a skeleton for the first time, the three codon-optimized neutralizing epitope is embedded, the trivalent virus-like particle is constructed, and the protection efficiency on CA16 and CA10 is enhanced while the immunogenicity and immunoprotection against enterovirus 71 type are maintained.

The second object of the present invention is to provide a method for preparing the enterovirus 71 type virus-like particle.

The technical scheme for solving the technical problems is as follows: the preparation method of the enterovirus 71 type virus-like particle comprises the following steps:

step 1: construction of recombinant plasmid pOET5-EV-A71-P1 ^CHI3 -3CD

The VP1 linear neutralization epitope of the first CV-A10, the VP1 linear neutralization epitope of the second CV-A10 and the VP1 linear neutralization epitope of CV-A16 are respectively subjected to SF9 insect cell preference codon optimization, and then substitution is respectively carried out at 1969 to 2016, 2179 to 2223 and 2314 to 2367 of the P1 capsid protein gene of the wild type enterovirus 71 type, thus obtaining the enterovirus 71 type P1 capsid protein gene EV-A71-P1 optimized by SF9 insect cell preference codon ^CHI3 ；

3CD protease gene is subjected to SF9 insect cell preference codon optimization;

the enterovirus 71 type P1 capsid protein gene EV-A71-P1 optimized by SF9 insect cell preference codon ^CHI3 And 3CD protease genes optimized by SF9 insect cell preference codons are cloned to EcoRI/NotI cleavage sites after P10 promoter and BamHI/XhoI cleavage sites after polh promoter of shuttle vector pOET5 of insect baculovirus respectively to construct recombinant plasmid pOET5-EV-A71-P1 ^CHI3 -3CD；

The nucleotide sequence of the VP1 linear neutralization epitope of the first CV-A10 after SF9 insect cell preference codon optimization is shown as SEQ ID NO.3, the nucleotide sequence of the VP1 linear neutralization epitope of the second CV-A10 after SF9 insect cell preference codon optimization is shown as SEQ ID NO.4, and the nucleotide sequence of the VP1 linear neutralization epitope of the second CV-A10 after SF9 insect cell preference codon optimization is shown as SEQ ID NO.4The nucleotide sequence of VP1 linear neutralization epitope of CV-A16 is shown as SEQ ID NO.5, the nucleotide sequence of the wild type enterovirus 71 type P1 capsid protein gene is shown as SEQ ID NO.6, and the codon optimized enterovirus 71 type P1 capsid protein gene EV-A71-P1 is shown as SEQ ID NO.6 ^CHI3 The nucleotide sequence of the 3CD protease gene optimized by the preferential codon of the SF9 insect cell is shown as SEQ ID NO.1, and the nucleotide sequence of the 3CD protease gene optimized by the preferential codon of the SF9 insect cell is shown as SEQ ID NO. 2;

step 2: construction of recombinant baculovirus rBV-EV-A71-P1 ^CHI3 -3CD

The recombinant plasmid pOET5-EV-A71-P1 obtained in the step 1 is subjected to ^CHI3 SF9 insect cells are transfected by the-3 CD and insect baculovirus genome Flash-BAC DNA, and the P1 capsid protein gene and the 3CD gene are integrated into the insect baculovirus genome to obtain recombinant baculovirus rBV-EV-A71-P1 ^CHI3 -3CD；

Step 3: preparation and purification of virus-like particles

Recombinant baculovirus rBV-EV-A71-P1 obtained through SF9 insect cell amplification step 2 ^CHI3 And (3) infecting SF9 insect cells again, culturing to more than 90% of SF9 insect cells after infection and lesion, collecting supernatant and purifying the supernatant to obtain enterovirus 71 type virus-like particles.

The preparation method of enterovirus 71 virus-like particles comprises the following steps:

in step 1 of the present invention, the shuttle vector pOET5 of the insect baculovirus was purchased from Oxford Expression Technologies. Codon-optimized enterovirus 71 type P1 capsid protein gene EV-A71-P1 ^CHI3 And 3CD protease gene after codon optimization, cloning the two target genes to EcoRI/NotI cleavage site after P10 promoter and BamHI/XhoI cleavage site after polh promoter of shuttle vector pOET5 of insect baculovirus respectively by chemical synthesis to construct recombinant plasmid pOET5-EV-A71-P1 ^CHI3 -3CD, this step is done by the hua-da gene.

In the step 2 of the invention, the recombinant plasmid pOET5-EV-A71-P1 obtained in the step 1 is taken ^CHI3 -3CD, with insect baculovirus genomeThe Flash-BAC DNA is transfected together with SF9 insect cells, so that the P1 protein gene and the 3CD protease gene of enterovirus 71 type can be integrated into insect baculovirus genome, and living recombinant insect baculovirus can be produced. And infecting new SF9 insect cells again, so that the live recombinant insect baculovirus with large culture and high titer can be obtained.

Insect baculovirus genome Flash-BAC DNA is commercially available, for example from UK Oxford Expression Technologies.

SF9 insect cells, which are potent host cells for insect baculoviruses, are commercially available, such as Invitrogen, inc., USA.

In step 2 of the present invention, the transfection is performed using an insect cell transfection reagent which is commercially available, for example, from Invitrogen, inc., USA under the name Cellfectin II.

In conclusion, the invention constructs EV-A71P 1 capable of simultaneously expressing and embedding three heterologous epitopes based on insect baculovirus-insect cell expression system ^CHI3 Recombinant baculovirus of protein gene and 3CD protease gene, and the 3CD protease enzyme is used for cutting P1 in cell ^CHI3 The protein spontaneously assembles into trivalent enterovirus 71 type virus empty shell with heterologous epitope. The trivalent enterovirus 71 virus empty shell can be released into culture supernatant.

The preparation method of enterovirus 71 virus-like particles has the beneficial effects that:

1. the preparation method has simple and convenient production procedures, and the prepared enterovirus 71 type virus-like particles do not contain genetic materials of viruses, so that the inactivation treatment is not needed.

2. The invention can cultivate and infect SF9 insect cells by shaking bottles, thereby producing enterovirus 71 type virus-like particles in a large scale and further producing enterovirus 71 type virus-like particle vaccines.

On the basis of the technical scheme, the invention can be improved as follows.

Further, in step 3, the recombinant baculovirus rBV-EV-A71-P1 ^CHI3 -3CD infection SFThe multiplicity of infection MOI of 9 insect cells was 3, and the SF9 insect cell densities were all 2X 10 ⁶ /mL。

The adoption of the method has the further beneficial effects that: by adopting the complex infection, the P1 of exogenous enterovirus 71 type is efficiently expressed ^CHI3 Protein gene and 3CD proteinase gene, and releasing the enterovirus 71 type virus-like particle assembled automatically into cell culture liquid.

Further, in the step 3, the temperature of the culture is 27 ℃, the shaking speed is 110 revolutions per minute, and the time is 5d-6d.

The adoption of the method has the further beneficial effects that: by using the parameters, the expression P1 can be obtained after culture ^CHI3 The structural proteins and 3CD protease are automatically assembled into empty capsids of enterovirus 71 type in host cells, i.e. trivalent enterovirus 71 type virus-like particles (EV-A71-VLP ^CHI3 ) And (3) protein.

Further, in step 3, the specific method for purification is as follows:

step 3.1: concentrating the supernatant

Mixing the supernatant with PEG8000 and 0.6M NaCl solution with mass percentage concentration of 20% by volume, stirring overnight at 4deg.C, centrifuging at 8000 rpm for 30min, removing supernatant, retaining protein precipitate, and re-suspending the protein precipitate with PBS buffer to obtain virus concentrate; the PBS buffer solution contains KH ₂ PO ₄ 2mM、Na ₂ HPO ₄ 8mM, 136mM NaCl and KCl 2.6mM, pH 7.2;

step 3.2: sucrose density gradient ultracentrifugation

And (3) preparing sucrose solutions with mass percentage concentration of 30%, 45% and 60%, performing density gradient ultracentrifugation on the virus concentrated solution obtained in the step (3.1), centrifuging at 290,000 rpm for 60min, and collecting milky white substances at the junctions of 30% and 45% and at the junctions of 45% and 60%, namely enterovirus 71 type virus-like particles.

The adoption of the method has the further beneficial effects that: collecting the milky white material at the boundary of 30% and 45% and at the boundary of 45% and 60%, wherein the milky white material contains purified EV-A71 ^CHI3 Virus-like particle proteins. The EV-A71 after purification can be determined by using a BCA (bicinchonininc acid) protein concentration assay ^CHI3 The concentration of virus-like particle protein for subsequent immunoassay quantification.

The invention provides an enterovirus 71 type virus-like particle vaccine.

The technical scheme for solving the technical problems is as follows: an enterovirus 71 type virus-like particle vaccine comprises the enterovirus 71 type virus-like particle as an active ingredient or one of the active ingredients.

The enterovirus 71 type virus-like particle vaccine has the beneficial effects that:

1. in the prior art, the multivalent vaccine product without the hand-foot-mouth disease only has the enterovirus 71 type inactivated vaccine, and the invention provides the trivalent enterovirus 71 type virus-like particle vaccine.

2. The enterovirus 71 type virus-like particle vaccine can cause the immune system of an organism to generate a strong response, has strong immunity and long duration, can achieve 100% complete protection on enterovirus 71 type, can provide 20% protection on CV-A16, and can provide 40% protection on CV-A10.

3. The enterovirus 71 type virus-like particle vaccine has a shell structure similar to that of a wild enterovirus 71 type virus, but has no virus activity and no infectious force, so that the enterovirus 71 type virus-like particle vaccine is very safe and effective. The production process does not require special environmental controls (such as biosafety level 2 or level 3 workshops) to prevent virus leakage and does not require an inactivation process.

4. The enterovirus 71 type virus-like particle vaccine has a short production period and is completely suitable for the rapid multi-mutation characteristic of enteroviruses. It takes only 6-8 weeks from isolation of the structural protein gene of the mutant strain to vaccine production.

On the basis of the technical scheme, the invention can be improved as follows.

Furthermore, the enterovirus 71 virus-like particle vaccine is in the form of any one or more of liquid injection, injection powder and injection tablets.

The adoption of the method has the further beneficial effects that: the enterovirus 71 type virus-like particle vaccine can be prepared into various dosage forms, is used for meeting different use requirements, and is more convenient.

Further, the enterovirus 71 virus-like particle vaccine further comprises an adjuvant, wherein the adjuvant is selected from any one or more of an oil adjuvant, an oil-in-water adjuvant, a water-in-oil-in-water adjuvant, an aluminum salt and a polysaccharide adjuvant.

The adoption of the method has the further beneficial effects that: the adjuvant and the enterovirus 71 type virus-like particle can be used for preparing the enterovirus 71 type virus-like particle vaccine.

Drawings

FIG. 1 shows the average neutralization titers of VP1 linear neutralization epitope of CV-A10 at positions 96 to 104 and 162 to 176 after immunization of mice with the epitope peptide, respectively at 1:4 and 1:17.96.

FIG. 2 shows construction of recombinant plasmid pOET5-EV-A71-P1 in the examples of the present invention ^CHI3 -a flow chart of 3 CD.

FIG. 3 shows the recombinant plasmid pOET5-EV-A71-P1 according to the embodiment of the invention ^CHI3 Schematic representation of 3 CD.

FIG. 4 shows a pOET5-EV-A71-P1 according to an embodiment of the invention ^CHI3 -3CD plasmid cleavage results. Wherein, lane M is a 15000bp molecular weight standard Marker; lane 1 is linearized pOET5-EV-A71-P1 ^CHI3 -a 3CD plasmid; lane 2 is linearized pOET5 plasmid; lane 3 shows pOET5-EV-A71-P1 after cleavage with EcoRI, notI, bamHI and xho I restriction enzymes ^CHI3 -3CD。

FIG. 5 shows rBV-EV-A71-P1 in the embodiment of the invention ^CHI3 -3CD recombinant baculovirus PCR results plot. Wherein, lane M is a 15000bp molecular weight standard Marker; lane 1 is the positive control pOET5-EV-A71-P1 ^CHI3 -a 3CD plasmid; lane 2 is rBV-EV-A71-P1 ^CHI3 -3CD recombinant baculovirus.

FIG. 6 shows infection rBV-EV-A71-P1 ^CHI3 After recombinant baculovirus of-3 CD, culture supernatants of SF9 insect cells on different days EV-A71-VLP ^CHI3 Virus-like particle expressionAnd (3) the situation. Lane M is a protein molecular weight standard Marker; lane PC is positive control EV-A71 inactivated virus; lanes D1-D6 were day 1 through day 6, respectively, SF9 insect cell culture supernatant EV-A71-VLPs ^CHI3 Virus-like particle expression.

FIG. 7 shows EV-A71-VLP after purification ^CHI3 And (5) detecting protein. Wherein lane PC is a positive control EV-A71 inactivated virus; lane 1 is purified EV-A71-VLP ^CHI3 。

FIG. 8 is a purified EV-A71-VLP ^CHI3 The virus particles were transmitted through the electron microscope picture at a scale of 200nm.

FIG. 9 shows serum specific IgG antibody levels against EV-A71 inactivated virus in serum of immunized mice.

FIG. 10 shows serum specific IgG antibody levels against the CA16 inactivated virus in serum of immunized mice, and data analyzed using a two-tailed t-test (Student's-two-tailed t test).

FIG. 11 shows serum specific IgG antibody levels against CA10 inactivated virus in mouse serum. Data were analyzed using a two-tailed t-test (Student's-two-tailed t test) with P <0.05.

FIG. 12 shows EV-A71-VLP ^CHI3 Virus-like particle vaccine and inactivated EV-a71 vaccine serum is directed against EV-a71 virus neutralizing antibody titers after mice are immunized.

FIG. 13 shows EV-A71-VLP ^CHI3 Virus-like particle vaccine and inactivated EV-a71 vaccine serum is directed against neutralizing antibody titers against CA16 virus after mice are immunized. The data were analyzed using the two-tailed t-test (Student's-two-tailed t-test).

FIG. 14 shows EV-A71-VLP ^CHI3 Virus-like particle vaccine and inactivated EV-a71 vaccine serum is directed against neutralizing antibody titers against CA10 virus after mice are immunized. Data were analyzed using a two-tailed t-test (Student's-two-tailed t-test), p<0.05。

FIG. 15 shows EV-A71-VLP ^CHI3 And the protection efficiency of the inactivated EV-A71 vaccine against EV-A71 challenge is 100 percent, and the survival rate is 100 percent.

FIG. 16 shows EV-A71-VLP ^CHI3 And the protection efficiency of the inactivated EV-A71 vaccine against CA16 challenge is 20 percent, and the survival rate is high.

FIG. 17 shows EV-A71-VLP ^CHI3 And the protection efficiency of the inactivated EV-A71 vaccine against CA10 challenge is 40 percent, and the survival rate is high.

Detailed Description

The principles and features of the present invention are described below with reference to the drawings, the examples being provided for the purpose of illustrating the invention and not for the purpose of limiting the same.

The preparation method of the enterovirus 71 type virus-like particle of the embodiment comprises the following steps:

step 1: and searching and screening through a PubMed website to determine a CV-A16 linear neutralization epitope, selecting 271 st to 285 rd amino acid epitope peptides as replacement epitopes, and optimizing the codon preference of SF9 insect cells to obtain a nucleotide sequence shown in SEQ ID NO. 5.

The P1 linear neutralizing epitope of CV-A10 previously studied and identified by the inventors of the present invention includes two epitopes of nucleotides 1969 to 2016 and 2179 to 2223, respectively designated as VP1 linear neutralizing epitope of the first CV-A10 and VP1 linear neutralizing epitope of the second CV-A10. Serum was obtained after animals were immunized with these two epitope peptides, respectively, and a trace neutralization experiment was performed, which demonstrated that the neutralizing ability against CV-A10 was exhibited, with average neutralization titers of 1:4 and 1:17.96, respectively, as shown in FIG. 1.

The nucleotide sequence of the VP1 linear neutralization epitope of the first CV-A10 after SF9 insect cell preference codon optimization is shown as SEQ ID NO.3, and the nucleotide sequence of the VP1 linear neutralization epitope of the second CV-A10 after SF9 insect cell preference codon optimization is shown as SEQ ID NO. 4.

Step 2: construction of recombinant plasmid pOET5-EV-A71-P1 ^CHI3 -3CD

As shown in FIG. 2, the 96 th to 104 th amino acid epitope peptides, 162 th to 176 th amino acid epitope peptides and 271 th to 285 th amino acid epitope peptides of VP1 of CV-A10 and CV-A16 were subjected to SF9 insect cell preference codon optimization, respectively, and then substitution was performed at 1969 to 2016, 2179 to 2223 and 2314 to 2367 th positions of the P1 capsid protein gene of wild type enterovirus 71, respectively, to obtain SF9 insect cell preference codon optimized P1 capsidProtein gene EV-A71-P1 ^CHI3 。

The 3CD protease gene was optimized for SF9 insect cell-preferred codons.

The enterovirus 71 type P1 capsid protein gene EV-A71-P1 optimized by SF9 insect cell preference codon ^CHI3 And 3CD protease genes optimized by SF9 insect cell preference codons are cloned to EcoRI/NotI cleavage sites after P10 promoter and BamHI/XhoI cleavage sites after polh promoter of shuttle vector pOET5 of insect baculovirus respectively to construct recombinant plasmid pOET5-EV-A71-P1 ^CHI3 -3CD。

The nucleotide sequence of the VP1 linear neutralization epitope of the first CV-A10 after SF9 insect cell preference codon optimization is shown as SEQ ID NO.3, the nucleotide sequence of the VP1 linear neutralization epitope of the second CV-A10 after SF9 insect cell preference codon optimization is shown as SEQ ID NO.4, the nucleotide sequence of the VP1 linear neutralization epitope after SF9 insect cell preference codon optimization is shown as SEQ ID NO.5, the nucleotide sequence of the P1 capsid protein gene of the wild type enterovirus 71 is shown as SEQ ID NO.6, and the nucleotide sequence of the P1 capsid protein gene EV-A71-P1 of the enterovirus 71 after codon optimization is shown as SEQ ID NO.6 ^CHI3 The nucleotide sequence of the 3CD protease gene optimized by the preferential codon of the SF9 insect cell is shown as SEQ ID NO.1, and the nucleotide sequence of the 3CD protease gene optimized by the preferential codon of the SF9 insect cell is shown as SEQ ID NO. 2.

atgggttcccaggtgtccactcaacgttccggttcccacgagaactccaactccgctaccgagggttccaccatcaactacaccaccatcaactactacaaggactcctacgctgctaccgctggtaagcagtccctgaagcaggaccctgacaagttcgctaaccctgtgaaggacatcttcaccgagatggctgctcctctgaagtctccttccgctgaggcttgtggttactccgatcgcgtggctcaactgaccatcggtaactccaccatcaccacccaggaggctgctaacatcatcgtgggttacggtgagtggccttcctactgctccgactccgatgctaccgctgtggacaaacctactcgccctgacgtttccgttaaccgcttctacaccctggacaccaagctgtgggagaagtcctccaagggttggtactggaagttccctgacgtgctgaccgaaaccggtgtgttcggtcagaacgctcagttccactacctgtaccgctccggtttctgcattcacgtgcaatgcaacgcttccaagttccaccagggtgctctgctggtggctgttctgcctgagtacgtgatcggtaccgtggctggtggtactggtaccgaagacacccaccctccttacaagcagacccagcctggtgctgatggtttcgagctgcagcacccttatgtgctggacgctggtatccctatctcccagctgaccgtgtgtcctcaccagtggatcaacctgcgcaccaacaactgcgctaccatcatcgtgccttacatcaacgctctgcctttcgactccgctctgaaccactgtaacttcggtctgctggtggtgcctatttcccctctggactacgatcagggtgctacccctgtgatccctatcaccatcaccctggctcctatgtgctccgagttcgctggtttgcgtcaggctgtgacccaaggtttccctaccgagctgaagcctggtaccaaccagttcctgaccaccgatgacggtgtgtccgctcctatcctgcctaacttccaccctaccccttgcatccacatccctggtgaggtgcgcaatttgctggagctgtgccaagtggagactatcctggaggtgaacaacgtgcctaccaacgctacctccctgatggagcgtctgcgctttcctgtgtccgctcaggctggtaagggtgaactgtgcgctgtgtttcgtgctgaccctggtagaaacggtccttggcaatccaccctgctgggtcaactgtgcggttactacacccagtggtccggttctctggaggtgaccttcatgttcaccggttccttcatggctaccggtaagatgctgatcgcttacacccctcctggtggtcctctgcctaaagaccgtgctaccgctatgttgggtacccacgtgatttgggacctgggtctgcaatcctctgtgaccctggtgatcccttggatctccaacacccactaccgcgctcatgctcgtgatggtgtgttcgactactacaccaccggtctggtgtccatctggtaccagaccaactacgtggtgcctatcggtgctcctaacaccgcttacatcatcgctctggctgctgctcagaagaacttcaccatgaagctgtgcaaggacgcttccgacatcttgcagaccggtaccattcaaggtgaccgcgtggctgatgttatcgagtcctccatcggtgattccgtgtcccgcgctttgactcatgctctgcctgctcctactggtcagaacacccaggtgtcctcccatcgtctggataccggtaaagtgcctgctctgcaggctgctgagattggtgcttcctccaacgcttccgacgagtccatgatcgaaacccgctgcgtgctcaattctcactccaccgctgaaaccactctggactccttcttttcccgcgctggtctggttggtgtggtgaacctgaccgatggtggtactgacaccaccggttatgctacctgggacatcgacatcaccggttacgctcagatgcgccgcaaagtggagctgttcacctacatgcgcttcgacgctgagttcaccttcgtggcttgcactcctactggtgaggtggtgcctcaactgctgcagtacatgttcgtgcctcctggtgctcctaaacctactggtcgcgacgctttccaatggcagaccgctactaacccttccgtgttcgtgaagctgtccgaccctcctgctcaagtgtccgtgcctttcatgtcccctgcttccgcttaccagtggttctacgacggtacccctaccttcggtgagcacctgcaggctaacgacctggactacggtcagtgccctaacaacatgatgggtaccttctccgtgcgtactgtgggtacctccaagtccaagtaccctctggtggtgcgcatctacatgcgcatgaagcacgtgcgcgcttggattcctcgtcctatgcgcaaccagaactacctgttcaaggctaaccctaactacgctggtaactccatcaagcctaccggtgcttcccgtaccgctatcaccaccctgtaa(SEQ ID NO.1)。

atgggtccatctttggacttcgctttgtctttgttgagaagaaacatcagacaagttcaaactgaccaaggtcacttcactatgttgggtgttagagacagattggctgttttgccaagacactctcaaccaggtaagactatctggatcgaacacaagttggttaacgttttggacgctgttgaattggttgacgaacaaggtgttaacttggaattgactttgatcactttggacactaacgaaaagttcagagacatcactaagttcatcccagaaaacatctctactgcttctgacgctactttggttatcaacactgaacacatgccatctatgttcgttccagttggtgacgttgttcaatacggtttcttgaacttgtctggtaagccaactcacagaactatgatgtacaacttcccaactaaggctggtcaatgtggtggtgttgttacttctgttggtaaggttgttggtatccacatcggtggtaacggtagacaaggtttctgtgctggtttgaagagatcgtacttcgcttctgaacaaggtgaaatccaatgggttaagccaaacaaggaaactggtagattgaacatcaacggtccaactagaactaagttggaaccatctgttttccacgacatcttcgaaggtaacaaggaaccagctgttttgcactctaaggacccaagattggaagttgacttcgaacaagctttgttctctaagtacgttggtaacactttgcacgaaccagacgaatacatcaaggaagctgctttgcactacgctaaccaattgaagcaattggaaatcaacacttctcaaatgtctatggaagaagcttgttacggtactgaaaacttggaagctatcgacttgcacacttctgctggttacccatactctgctttgggtatcaagaagagagacatcttggacccaactactagagacgtttctagaatgaagttctacatggacaagtacggtttggacttgccatactctacttacgttaaggacgaattgagatcgatcgacaagatcaagaagggtaagtctagattgatcgaagcttcttctttgaacgactctgtttacttgagaatggctttcggtcacttgtacgaagctttccacgctaacccaggtactatcactggttctgctgttggttgtaacccagacactttctggtctaagttgccaatcttgttgccaggttctttgttcgctttcgactactctggttacgacgcttctttgtctccagtttggttcagagctttggaattggttttgagagaaatcggttactctgaagaagctatctctttgatcgaaggtatcaaccacactcaccacgtttacagaaacaagacttactgtgttttgggtggtatgccatctggttgttctggtacttctatcttcaactctatgatcaacaacatcatcatcagagctttgttgatcaagactttcaagggtatcgacttggacgaattgaacatggttgcttacggtgacgacgttttggcttcttacccattcccaatcgactgtttggaattggctaagactggtaaggaatacggtttgactatgactccagctgacaagtctccatgtttcaacgaagttaactggggtaacgctactttcttgaagagaggtttcttgccagacgaacaattcccattcttgatccacccaactatgccaatgagagaaatccacgaatctatcagatggactaaggacgctagaaacactcaagaccacgttagatcgttgtgtttgttggcttggcacaacggtaagcaagaatacgaaaagttcgtttctactatcagatcggttccagttggtagagctttggctatcccaaactacgaaaacttgagaagaaactggttggaattgttctaa(SEQ ID NO.2)。

gtggtgaacctgaccgatggtggtactgacaccaccggttatgctacc(SEQ ID NO.3)。

cctactggtcgcgacgctttccaatggcagaccgctactaaccct(SEQ ID NO.4)。

acccctaccttcggtgagcacctgcaggctaacgacctggactacggtcagtgc(SEQ ID NO.5)。

atgggttcgcaagtgtctacacagcgctccggttctcacgaaaactcaaactcagccactgagggttctaccataaactacaccaccattaattactacaaagactcctatgctgccacagcaggcaaacagagtctcaagcaggatccagacaagtttgcaaatcctgttaaagacattttcactgaaatggcagcgccactgaaatccccatccgctgaggcatgtgggtacagtgatcgagtggcgcaattaactattggcaactccaccatcaccacgcaagaagcggctaacatcatagtcggttatggtgagtggccttcctactgctcagattctgacgctacagcagtggataaaccaacgcgcccggatgtttcagtgaacaggttttacacattggacaccaaattgtgggagaaatcgtccaaggggtggtactggaagttcccggatgtgttaactgaaactggggtttttgggcaaaatgcacaattccactacctctaccgatcagggttctgcatccacgtgcagtgcaatgccagtaaattccaccaaggagcactcctagtcgctgtcctaccagagtatgtcattgggacagtggcaggcggtacagggacggaagatacccaccccccttacaagcagactcaacccggcgccgatggcttcgagttgcaacacccgtacgtgcttgatgctggcatcccaatatcacagttaacagtgtgcccacaccagtggatcaacttgaggaccaacaattgtgctacaataatagtgccatacattaacgcactgccttttgattctgccttgaatcattgcaactttggcctgttggttgtgcctattagcccactagactacgaccaaggagcgacgccagtaatccctataactatcacattggccccaatgtgttctgaattcgcaggtcttaggcaggcagtcacgcaagggttccccaccgagctaaaacctggcacaaatcaatttttaaccaccgatgatggcgtttcagcacctattctaccaaacttccaccccaccccgtgtatccacatacctggtgaggttaggaacttgctagagttatgccaggtggaaaccattctggaggttaacaatgtgcccacgaatgccactagcttaatggagagactgcgcttcccggtctcagcacaagcagggaaaggtgagctgtgtgcggtgtttagagccgatcctgggcgaaatggaccatggcaatccaccttactgggtcagttgtgcgggtactacacccaatggtcaggatcattggaagtcaccttcatgtttactggatctttcatggctaccggcaagatgctcatagcctatacaccgccaggaggtcctctgcccaaggaccgggcgaccgccatgttgggcacgcacgtcatctgggatttggggctgcaatcgtctgttacccttgtaataccatggatcagcaacactcattacagagcacatgcccgagatggagtgtttgactactacaccacagggttagtcagtatatggtaccagacaaattacgtggttccaatcggtgcgcccaacacagcctatataatagcgctagcggcggcccaaaagaatttcactatgaaattgtgcaaggatgctagtgatatcctgcagacgggcaccatccagggagatagggtggcagatgtaattgaaagttccataggagatagcgtgagcagagccctcactcacgctctaccagcacccacaggccagaacacacaggtgagcagtcatcgactggatacaggtaaggttccagcactccaagctgctgaaattggagcatcatcaaatgctagtgacgagagcatgattgagacacgctgtgttcttaactcgcacagtacagctgagaccactcttgatagtttcttcagcagggcgggattagttggagagatagatctccctcttaagggcacaactaacccaaatggttatgccaactgggacatagatataacaggttacgcgcaaatgcgtagaaaggtagagctattcacctacatgcgctttgatgcagagttcacttttgttgcgtgcacacccaccggggaagttgtcccacaattgctccaatatatgtttgtgccacctggagcccctaagccagattctagggaatcccttgcatggcaaaccgccactaacccctcagtttttgtcaagctgtcagaccctccagcgcaggtttcagtgccgttcatgtcacctgcgagtgcttatcaatggttttatgacggatatcccacattcggagaacacaaacaggagaaagatcttgaatacggggcatgtcctaataacatgatgggcacgttctcagtgcggactgtggggacctccaagtccaagtaccctttagtggttaggatttacatgagaatgaagcacgtcagggcgtggatacctcgcccgatgcgtaaccagaactacctatttaaagccaacccaaattatgctggcaactccattaagccaactggcgccagtcgcacagcgatcaccactctttaa(SEQ ID NO.6)。

The shuttle vector pOET5 of the insect baculovirus described above was purchased from Oxford Expression Technologies. Codon-optimized enterovirus 71 type P1 capsid protein gene EV-A71-P1 ^CHI3 And 3CD protease gene after codon optimization, cloning the two target genes to EcoRI/NotI cleavage site after P10 promoter and BamHI/XhoI cleavage site after polh promoter of shuttle vector pOET5 of insect baculovirus respectively by chemical synthesis to construct recombinant plasmid pOET5-EV-A71-P1 ^CHI3 -3CD, as shown in fig. 3, this step is done by the warrior gene.

As shown in FIG. 4, pOET5-EV-A71-P1 ^CHI3 Simultaneous digestion of the 3CD positive plasmid with EcoRI, notI, bamHI, xhoI four endonucleases produced four bands, from large to small, respectively linear pOET5 vector, EV-A71-P1 ^CHI3 Genes, 3CD genes, and short sequences between the P10 promoter and polh promoter.

Step 3: construction of recombinant baculovirus rBV-EV-A71-P1 ^CHI3 -3CD

The recombinant plasmid pOET5-EV-A71-P1 obtained in the step 1 is subjected to ^CHI3 SF9 insect cells are transfected by the-3 CD and insect baculovirus genome Flash-BAC DNA, and the P1 capsid protein gene and the 3CD gene are integrated into the insect baculovirus genome to obtain recombinant baculovirus rBV-EV-A71-P1 ^CHI3 -3CD。

The insect baculovirus genome Flash-BAC DNA described above is commercially available, for example from UK Oxford Expression Technologies.

The SF9 insect cells described above, which are effective host cells for insect baculoviruses, are commercially available, for example, from Invitrogen, inc. of America.

Recombinant baculovirus rBV-EV-A71-P1 as described above ^CHI3 3CD can be identified as positive by PCR methods as shown in FIG. 5.

Recombinant plasmid pOET5-EV-A71-P1 was prepared using insect cell transfection reagent Cellfectin II (available from Invitrogen Co., U.S.A.) ^CHI3 SF9 insect cells are co-transfected by-3 CD and insect baculovirus genome Flash-BAC DNA, and a large amount of recombinant insect baculovirus rBV-EV-A71-P1 is subjected to cell culture at 27 ℃ for 5-6 days ^CHI3 -3CD is released into the cell culture broth and the collected cell culture supernatant is again used to infect new SF9 insect cells, obtaining amplified high titer recombinant insect baculovirus for later use.

Step 4: preparation and purification of virus-like particles

Recombinant baculovirus rBV-EV-A71-P1 obtained through SF9 insect cell amplification step 2 ^CHI3 -3CD to increase its viral titer. Determination of viral titres standard PMV-rBV copy numbers were calculated according to formula 1 using qPCR.

Standard PMV-rBV copy number (copies/. Mu.l) =6.02x10 ²³ Xplasmid concentration (ng/. Mu.L). Times.10 ^-9 /(plasmid base number. Times.660) formula 1.

The known copy number PMV-rBV plasmid was diluted 8-fold with a 10-fold ratio as standard curve sample. Recombinant baculovirus rBV-EV-A71-P1 ^CHI3 -3CD stock and 10-fold dilution as the sample to be tested.

Baculovirus genome universal primer:

BV-F：gacaatccagtcacggacgaacat(SEQ ID NO 7)；

BV-R：ggcaaaggtttcaatgccgg(SEQ ID NO 8)。

calculating rBV-EV-A71-P1 according to the standard curve and CQ value corresponding to the sample to be detected ^CHI3 -3CD titer。

At a multiplicity of infection (MOI) of 3 (Multiplicity of infection, MOI), the infection density was 2X 10 ⁶ SF9 insect cell culture solution of/mL can efficiently express exogenous enterovirus 71 type P1 ^CHI3 Protein gene and 3CD proteinase gene, and releasing the enterovirus 71 type virus-like particle assembled automatically into cell culture liquid.

Reinfection density is 2X 10 ⁶ Culturing SF9 insect cell culture solution of/mL at a temperature of 27 ℃ and a shaking speed of 110 revolutions per minute for 5-6d until more than 90% of SF9 insect cells are infected with lesions, collecting supernatant, detecting target protein in the supernatant, purifying the target protein of the supernatant, and finally detecting by a transmission electron microscope, wherein the specific method comprises the following steps:

step 3.1: western Blot detection of target proteins in supernatants

The supernatant samples were mixed with loading buffer, boiled at 99℃for 10 min, separated on a 10% SDS-PAGE gel, and further electrotransferred to PVDF membrane for Western Blot analysis. The whole virus antiserum of the mouse EV-A71 diluted to 1:500 is used as a primary antibody, the HRP-coupled IgG antibody of the goat anti-mouse diluted to 1:5000 is used as a secondary antibody, and the ECL luminous kit is used for chemiluminescence. As shown in FIG. 6, the protein expression in the 1d-6d supernatant was detected, and VP1 protein was abundantly expressed at 5d and 6d.

Step 3.2: concentrating the supernatant

Mixing the supernatant with PEG8000 and 0.6M NaCl solution with mass percentage concentration of 20% by volume, stirring overnight at 4deg.C, centrifuging at 8000 rpm for 30min, removing supernatant, retaining protein precipitate, and re-suspending the protein precipitate with PBS buffer to obtain virus concentrate; the PBS buffer solution contains KH ₂ PO ₄ 2mM、Na ₂ HPO ₄ 8mM, 136mM NaCl and KCl 2.6mM, pH 7.2.

Step 3.3: sucrose density gradient ultracentrifugation

And (3) preparing sucrose solutions with mass percentage concentration of 30%, 45% and 60%, performing density gradient ultracentrifugation on the virus concentrated solution obtained in the step (3.1), centrifuging at 290,000 rpm for 60min, and collecting milky white substances at the junctions of 30% and 45% and at the junctions of 45% and 60%, namely enterovirus 71 type virus-like particles. As shown in FIG. 7, the purified sample contained a large amount of VP1 protein as detected by Western Blot.

Step 3.4: transmission electron microscope detection

The above purified sample was subjected to negative staining with 2% phosphotungstic acid, and observed under a transmission electron microscope, and the appearance exhibited spherical particles similar to those of real virus particles, with a diameter of about 30nm, as shown in FIG. 8.

Experimental example 1: BALB/c mice of 6 weeks old, which were free of specific pathogen contamination, were immunized with enterovirus 71-type virus-like particles and serum from immunized mice was analyzed.

Animal immunization and serum antibody determination and virus neutralization reaction are carried out according to the currently used enterovirus animal immunization experiment mode. The experimental animals were selected 6-week-old BALB/c female mice without specific pathogen contamination. The specific operation is as follows: each BALB/c mouse was subcutaneously injected with Freund's adjuvant emulsified 0.3mL of enterovirus 71-type virus-like particles (10. Mu.g total protein) at weeks 0, 2 and 4, and mice were subjected to tail-off blood collection at weeks 0, 2, 4, 6 and 12 with the same dose of enterovirus 71-type inactivated virus as positive control and PBS group as negative control, and serum was collected for ELISA and micro-neutralization experiments.

The ELISA experiments were performed as follows:

step (1) coating: diluting the purified EV-A71, CV-A16 or CV-A10 inactivated virus to 1 μg/mL with a coating buffer, adding 100 μl to each well of a 96-well plate, and coating overnight at 4deg.C;

and (2) washing: the 1 XPBST (containing 0.1% Tween-20) was washed 3 times for a second day. 200 mu L of each hole for 1min;

and (3) closing: blocking with 1% BSA blocking solution, 200 μl per well, blocking at 37deg.C for 1h;

and (4) washing: 1 XPBST was washed 3 times with 200. Mu.L per well for 1min each;

step (5) primary antibody incubation: after adding the serum to be detected by the dilution (0.1% BSA) in a gradient manner, 100 mu L of each dilution is added into the coated reaction well, and the mixture is incubated for 1h at 37 ℃ (blank, negative and positive Kong Duizhao are simultaneously made);

and (6) washing: wash 3 times with 1 XPBST, 200 μl per well, 1min each;

step (7) secondary antibody incubation: adding 100 mu L of enzyme-labeled secondary antibody HRP-goat anti-mouse IgG diluted 1:5000 times with diluent (0.1% BSA), and incubating at 37 ℃ for 1h;

and (8) washing: wash 3 times with 1 XPBST, 200 μl per well, 1min each;

and (9) developing: adding 100 mu L of TMB substrate developing solution temporarily prepared into each reaction hole, and reacting for 10-20min at 37 ℃;

and (5) terminating the step (10): to each reaction well, 50. Mu.L of 1mol/L sulfuric acid was added to terminate the reaction. Reading: immediately after termination of the reaction, plates were read on a microplate reader at 450 nm.

The steps of the micro neutralization experiment are as follows:

step (1), inactivating serum to be detected at 56 ℃ for 30min;

step (2) EV-A71 or CV-A16 or CV-A10 isolate dilution: according to the titer of EV-A71, CV-A16 or CV-A10 isolates, the viruses are diluted to contain 100TCI D50 virus amount per 25 mu L, and the diluted solution is cell maintenance solution;

step (3) serum experiment plate: adding 25 mu L of DMEM culture medium into each well of a 96-well plate, adding serum to be detected into a first well, uniformly mixing and sucking 25 mu L of serum out to a second well, and similarly diluting according to a ratio of 2 times, wherein the dilutions are sequentially 1:2, 1:4, 1:8, 1:16, 1:32, 1:64, 1:128 and 1:256, and 2 wells are arranged for each dilution; add 100TCID 50/25. Mu.L EV-A71 or CV-A16 or CV-A10 virus suspension to each well and gently mix;

step (4) negative serum control wells and cell control wells are set: the dilution method of the negative serum control hole is the same as the step (3); adding 50 mu L of cell maintenance solution into each cell control well, wherein the cell control is provided with 4 wells; setting virus back drop control: mu.L of cell maintenance solution was added to each well of the 96-well plate, and then EV-A71, CV-A16, CV-A10100, TCID 50/25. Mu.L, 10TCID 50/25. Mu.L, 1TCID 50/25. Mu.L, 0.1TCID 50/25. Mu.L were added thereto, and 8 wells were set for each dilution;

serum experiment board, serum contrast,Cell control, virus drip control and 5% CO ₂ Neutralizing in a 37 ℃ incubator for 3 hours, taking out the 96-well plate at intervals of half an hour, and uniformly mixing to ensure that the tested serum fully reacts with viruses;

step (5) preparing a cell suspension: over 95%25cm ² After single-layer cells of the culture flask are digested, a cell growth solution is added for cell counting, and the density of diluted cell suspension is 1.0X10 ⁵ And each mL. After neutralization for 3 hours, 100. Mu.L of cell suspension was added to each well of the 96-well plate, mixed with gentle shaking, and placed in 5% CO ₂ Culturing in a 37 ℃ incubator; daily observations were recorded and when complete CPE was present in 100TCID 50/25. Mu.L virus control wells, the results were judged to be the anti-EV-A71 or CV-A16 or CV-A10 neutralizing antibody titers of the test serum with the reciprocal of the highest serum dilution that did not produce CPE. Cell control wells cells grew well, serum control Kong Modu response, and experimental results with virus drip-back control in the range of 32-320TCID50/25 μl were considered valid.

Experimental example 2: in vivo passive protection experiments, enterovirus 71 virus-like particles are used for immunizing 6-week-old ICR female mice without special pathogen pollution, the produced milk mice are detoxified, and the survival rate of the milk mice is recorded.

The experimental mouse virus challenge experiment is carried out according to the currently used enterovirus animal immunity experiment and challenge protection experiment mode. Six-week-old ICR mice without special pathogen contamination are used for immunization, EV-A71 virus-like particles are inoculated subcutaneously at a dose of 10 mug/0.1 mL for each mouse, EV-A71 inactivated virus at the same dose is used as a positive control, PBS group is used as a negative control, and the mice are immunized once at week 0, week 2 and week 4 respectively. The rats were mated at week three and were born at about weeks 6-7, with about 10 rats per rat. Toxicity attack protection experiment of milk mice: 10 milk mice with the age of 1 day are taken as a group; the mice in each group were adapted to intracranial infection with a strain EV-A71 or CV-A16 or CV-A10, respectively, 50 times LD 50, and the positive control group and the negative control group received the same dose of EV-A71 or CV-A16 or CV-A10 intracranial infection as the immunized experimental group, and the survival rate of the mice and clinical symptoms were recorded daily for 15 days.

Experimental results:

FIGS. 9-11 show serum-specific IgG antibody titer detection results after immunization of mice. Female BALB/c mice of 6 weeks old were selected as experimental animals, and sf9 cell culture supernatant was used as negative control, PBS as blank control, EV-A71 inactivated virus as positive control, EV-A71-VLP, respectively ^CHI3 For the experimental group, mice were immunized and post-immunization sera were collected, and specific IgG antibody titers against EV-A71, CV-A16 and CV-A10 in the mouse sera were determined by an indirect ELISA method. The results showed that, as shown in FIG. 9, EV-A71-VLP ^CHI3 Both the vaccine and the EV-A71 inactivated vaccine can induce mice to generate EV-A71 specific IgG antibodies, and the antibody titer is enhanced along with the increase of immunization times; as shown in FIG. 10, EV-A71-VLP ^CHI3 Both the vaccine and the EV-A71 inactivated vaccine can induce the mice to generate CV-A16 specific IgG antibodies, the antibody titer is enhanced along with the increase of the immunization times, and the EV-A71-VLP ^CHI3 Inducing to generate CV-A16 specific IgG antibody with higher titer than EV-A71 inactivated vaccine; as shown in FIG. 11, EV-A71-VLP ^CHI3 Can induce the generation of CV-A10 specific antibodies, and has significant difference compared with EV-A71 inactivated vaccine.

FIGS. 12-14 are serum neutralizing antibody titer determinations after immunized mice. The results showed that, as shown in FIG. 12, EV-A71-VLP ^CHI3 And the average titer of neutralizing antibodies against EV-A71 induced by the EV-A71 inactivated vaccine is 1:213 and 1:235, respectively; as shown in FIG. 13, EV-A71-VLP ^CHI3 And EV-A71 inactivated vaccine induced an average titer of 1:19 and 1:11 of neutralizing antibodies against CV-A16, respectively; as shown in FIG. 14, EV-A71-VLP ^CHI3 And the average titers of neutralizing antibodies against CV-A10 induced by inactivated EV-A71 vaccine were 1:69 and 1:21, respectively.

Fig. 15-17 are animal challenge protection experiments. The results showed that, as shown in FIG. 15, EV-A71-VLP ^CHI3 The EV-A71 inactivated vaccine can protect the EV-A71 virus from attacking by 100 percent; as shown in FIG. 16, EV-A71-VLP was targeted against CV-A16 challenge ^CHI3 20% protection can be provided, while EV-A71 inactivated vaccine can not provide protection; as shown in FIG. 17, EV-A71-VLP was targeted against CV-A10 challenge ^CHI3 40% protection can be provided, while EV-A71 inactivated vaccine cannot.

The foregoing description of the preferred embodiments of the invention is not intended to limit the invention to the precise form disclosed, and any such modifications, equivalents, and alternatives falling within the spirit and scope of the invention are intended to be included within the scope of the invention.

Sequence listing

<110> Guilin medical college

<120> enterovirus 71-like particle, preparation method and application thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2586

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

atgggttccc aggtgtccac tcaacgttcc ggttcccacg agaactccaa ctccgctacc 60

gagggttcca ccatcaacta caccaccatc aactactaca aggactccta cgctgctacc 120

gctggtaagc agtccctgaa gcaggaccct gacaagttcg ctaaccctgt gaaggacatc 180

ttcaccgaga tggctgctcc tctgaagtct ccttccgctg aggcttgtgg ttactccgat 240

cgcgtggctc aactgaccat cggtaactcc accatcacca cccaggaggc tgctaacatc 300

atcgtgggtt acggtgagtg gccttcctac tgctccgact ccgatgctac cgctgtggac 360

aaacctactc gccctgacgt ttccgttaac cgcttctaca ccctggacac caagctgtgg 420

gagaagtcct ccaagggttg gtactggaag ttccctgacg tgctgaccga aaccggtgtg 480

ttcggtcaga acgctcagtt ccactacctg taccgctccg gtttctgcat tcacgtgcaa 540

tgcaacgctt ccaagttcca ccagggtgct ctgctggtgg ctgttctgcc tgagtacgtg 600

atcggtaccg tggctggtgg tactggtacc gaagacaccc accctcctta caagcagacc 660

cagcctggtg ctgatggttt cgagctgcag cacccttatg tgctggacgc tggtatccct 720

atctcccagc tgaccgtgtg tcctcaccag tggatcaacc tgcgcaccaa caactgcgct 780

accatcatcg tgccttacat caacgctctg cctttcgact ccgctctgaa ccactgtaac 840

ttcggtctgc tggtggtgcc tatttcccct ctggactacg atcagggtgc tacccctgtg 900

atccctatca ccatcaccct ggctcctatg tgctccgagt tcgctggttt gcgtcaggct 960

gtgacccaag gtttccctac cgagctgaag cctggtacca accagttcct gaccaccgat 1020

gacggtgtgt ccgctcctat cctgcctaac ttccacccta ccccttgcat ccacatccct 1080

ggtgaggtgc gcaatttgct ggagctgtgc caagtggaga ctatcctgga ggtgaacaac 1140

gtgcctacca acgctacctc cctgatggag cgtctgcgct ttcctgtgtc cgctcaggct 1200

ggtaagggtg aactgtgcgc tgtgtttcgt gctgaccctg gtagaaacgg tccttggcaa 1260

tccaccctgc tgggtcaact gtgcggttac tacacccagt ggtccggttc tctggaggtg 1320

accttcatgt tcaccggttc cttcatggct accggtaaga tgctgatcgc ttacacccct 1380

cctggtggtc ctctgcctaa agaccgtgct accgctatgt tgggtaccca cgtgatttgg 1440

gacctgggtc tgcaatcctc tgtgaccctg gtgatccctt ggatctccaa cacccactac 1500

cgcgctcatg ctcgtgatgg tgtgttcgac tactacacca ccggtctggt gtccatctgg 1560

taccagacca actacgtggt gcctatcggt gctcctaaca ccgcttacat catcgctctg 1620

gctgctgctc agaagaactt caccatgaag ctgtgcaagg acgcttccga catcttgcag 1680

accggtacca ttcaaggtga ccgcgtggct gatgttatcg agtcctccat cggtgattcc 1740

gtgtcccgcg ctttgactca tgctctgcct gctcctactg gtcagaacac ccaggtgtcc 1800

tcccatcgtc tggataccgg taaagtgcct gctctgcagg ctgctgagat tggtgcttcc 1860

tccaacgctt ccgacgagtc catgatcgaa acccgctgcg tgctcaattc tcactccacc 1920

gctgaaacca ctctggactc cttcttttcc cgcgctggtc tggttggtgt ggtgaacctg 1980

accgatggtg gtactgacac caccggttat gctacctggg acatcgacat caccggttac 2040

gctcagatgc gccgcaaagt ggagctgttc acctacatgc gcttcgacgc tgagttcacc 2100

ttcgtggctt gcactcctac tggtgaggtg gtgcctcaac tgctgcagta catgttcgtg 2160

cctcctggtg ctcctaaacc tactggtcgc gacgctttcc aatggcagac cgctactaac 2220

ccttccgtgt tcgtgaagct gtccgaccct cctgctcaag tgtccgtgcc tttcatgtcc 2280

cctgcttccg cttaccagtg gttctacgac ggtaccccta ccttcggtga gcacctgcag 2340

gctaacgacc tggactacgg tcagtgccct aacaacatga tgggtacctt ctccgtgcgt 2400

actgtgggta cctccaagtc caagtaccct ctggtggtgc gcatctacat gcgcatgaag 2460

cacgtgcgcg cttggattcc tcgtcctatg cgcaaccaga actacctgtt caaggctaac 2520

cctaactacg ctggtaactc catcaagcct accggtgctt cccgtaccgc tatcaccacc 2580

ctgtaa 2586

<210> 2

<211> 1941

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

atgggtccat ctttggactt cgctttgtct ttgttgagaa gaaacatcag acaagttcaa 60

actgaccaag gtcacttcac tatgttgggt gttagagaca gattggctgt tttgccaaga 120

cactctcaac caggtaagac tatctggatc gaacacaagt tggttaacgt tttggacgct 180

gttgaattgg ttgacgaaca aggtgttaac ttggaattga ctttgatcac tttggacact 240

aacgaaaagt tcagagacat cactaagttc atcccagaaa acatctctac tgcttctgac 300

gctactttgg ttatcaacac tgaacacatg ccatctatgt tcgttccagt tggtgacgtt 360

gttcaatacg gtttcttgaa cttgtctggt aagccaactc acagaactat gatgtacaac 420

ttcccaacta aggctggtca atgtggtggt gttgttactt ctgttggtaa ggttgttggt 480

atccacatcg gtggtaacgg tagacaaggt ttctgtgctg gtttgaagag atcgtacttc 540

gcttctgaac aaggtgaaat ccaatgggtt aagccaaaca aggaaactgg tagattgaac 600

atcaacggtc caactagaac taagttggaa ccatctgttt tccacgacat cttcgaaggt 660

aacaaggaac cagctgtttt gcactctaag gacccaagat tggaagttga cttcgaacaa 720

gctttgttct ctaagtacgt tggtaacact ttgcacgaac cagacgaata catcaaggaa 780

gctgctttgc actacgctaa ccaattgaag caattggaaa tcaacacttc tcaaatgtct 840

atggaagaag cttgttacgg tactgaaaac ttggaagcta tcgacttgca cacttctgct 900

ggttacccat actctgcttt gggtatcaag aagagagaca tcttggaccc aactactaga 960

gacgtttcta gaatgaagtt ctacatggac aagtacggtt tggacttgcc atactctact 1020

tacgttaagg acgaattgag atcgatcgac aagatcaaga agggtaagtc tagattgatc 1080

gaagcttctt ctttgaacga ctctgtttac ttgagaatgg ctttcggtca cttgtacgaa 1140

gctttccacg ctaacccagg tactatcact ggttctgctg ttggttgtaa cccagacact 1200

ttctggtcta agttgccaat cttgttgcca ggttctttgt tcgctttcga ctactctggt 1260

tacgacgctt ctttgtctcc agtttggttc agagctttgg aattggtttt gagagaaatc 1320

ggttactctg aagaagctat ctctttgatc gaaggtatca accacactca ccacgtttac 1380

agaaacaaga cttactgtgt tttgggtggt atgccatctg gttgttctgg tacttctatc 1440

ttcaactcta tgatcaacaa catcatcatc agagctttgt tgatcaagac tttcaagggt 1500

atcgacttgg acgaattgaa catggttgct tacggtgacg acgttttggc ttcttaccca 1560

ttcccaatcg actgtttgga attggctaag actggtaagg aatacggttt gactatgact 1620

ccagctgaca agtctccatg tttcaacgaa gttaactggg gtaacgctac tttcttgaag 1680

agaggtttct tgccagacga acaattccca ttcttgatcc acccaactat gccaatgaga 1740

gaaatccacg aatctatcag atggactaag gacgctagaa acactcaaga ccacgttaga 1800

tcgttgtgtt tgttggcttg gcacaacggt aagcaagaat acgaaaagtt cgtttctact 1860

atcagatcgg ttccagttgg tagagctttg gctatcccaa actacgaaaa cttgagaaga 1920

aactggttgg aattgttcta a 1941

<210> 3

<211> 48

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

gtggtgaacc tgaccgatgg tggtactgac accaccggtt atgctacc 48

<210> 4

<211> 45

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

cctactggtc gcgacgcttt ccaatggcag accgctacta accct 45

<210> 5

<211> 54

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

acccctacct tcggtgagca cctgcaggct aacgacctgg actacggtca gtgc 54

<210> 6

<211> 2589

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

atgggttcgc aagtgtctac acagcgctcc ggttctcacg aaaactcaaa ctcagccact 60

gagggttcta ccataaacta caccaccatt aattactaca aagactccta tgctgccaca 120

gcaggcaaac agagtctcaa gcaggatcca gacaagtttg caaatcctgt taaagacatt 180

ttcactgaaa tggcagcgcc actgaaatcc ccatccgctg aggcatgtgg gtacagtgat 240

cgagtggcgc aattaactat tggcaactcc accatcacca cgcaagaagc ggctaacatc 300

atagtcggtt atggtgagtg gccttcctac tgctcagatt ctgacgctac agcagtggat 360

aaaccaacgc gcccggatgt ttcagtgaac aggttttaca cattggacac caaattgtgg 420

gagaaatcgt ccaaggggtg gtactggaag ttcccggatg tgttaactga aactggggtt 480

tttgggcaaa atgcacaatt ccactacctc taccgatcag ggttctgcat ccacgtgcag 540

tgcaatgcca gtaaattcca ccaaggagca ctcctagtcg ctgtcctacc agagtatgtc 600

attgggacag tggcaggcgg tacagggacg gaagataccc acccccctta caagcagact 660

caacccggcg ccgatggctt cgagttgcaa cacccgtacg tgcttgatgc tggcatccca 720

atatcacagt taacagtgtg cccacaccag tggatcaact tgaggaccaa caattgtgct 780

acaataatag tgccatacat taacgcactg ccttttgatt ctgccttgaa tcattgcaac 840

tttggcctgt tggttgtgcc tattagccca ctagactacg accaaggagc gacgccagta 900

atccctataa ctatcacatt ggccccaatg tgttctgaat tcgcaggtct taggcaggca 960

gtcacgcaag ggttccccac cgagctaaaa cctggcacaa atcaattttt aaccaccgat 1020

gatggcgttt cagcacctat tctaccaaac ttccacccca ccccgtgtat ccacatacct 1080

ggtgaggtta ggaacttgct agagttatgc caggtggaaa ccattctgga ggttaacaat 1140

gtgcccacga atgccactag cttaatggag agactgcgct tcccggtctc agcacaagca 1200

gggaaaggtg agctgtgtgc ggtgtttaga gccgatcctg ggcgaaatgg accatggcaa 1260

tccaccttac tgggtcagtt gtgcgggtac tacacccaat ggtcaggatc attggaagtc 1320

accttcatgt ttactggatc tttcatggct accggcaaga tgctcatagc ctatacaccg 1380

ccaggaggtc ctctgcccaa ggaccgggcg accgccatgt tgggcacgca cgtcatctgg 1440

gatttggggc tgcaatcgtc tgttaccctt gtaataccat ggatcagcaa cactcattac 1500

agagcacatg cccgagatgg agtgtttgac tactacacca cagggttagt cagtatatgg 1560

taccagacaa attacgtggt tccaatcggt gcgcccaaca cagcctatat aatagcgcta 1620

gcggcggccc aaaagaattt cactatgaaa ttgtgcaagg atgctagtga tatcctgcag 1680

acgggcacca tccagggaga tagggtggca gatgtaattg aaagttccat aggagatagc 1740

gtgagcagag ccctcactca cgctctacca gcacccacag gccagaacac acaggtgagc 1800

agtcatcgac tggatacagg taaggttcca gcactccaag ctgctgaaat tggagcatca 1860

tcaaatgcta gtgacgagag catgattgag acacgctgtg ttcttaactc gcacagtaca 1920

gctgagacca ctcttgatag tttcttcagc agggcgggat tagttggaga gatagatctc 1980

cctcttaagg gcacaactaa cccaaatggt tatgccaact gggacataga tataacaggt 2040

tacgcgcaaa tgcgtagaaa ggtagagcta ttcacctaca tgcgctttga tgcagagttc 2100

acttttgttg cgtgcacacc caccggggaa gttgtcccac aattgctcca atatatgttt 2160

gtgccacctg gagcccctaa gccagattct agggaatccc ttgcatggca aaccgccact 2220

aacccctcag tttttgtcaa gctgtcagac cctccagcgc aggtttcagt gccgttcatg 2280

tcacctgcga gtgcttatca atggttttat gacggatatc ccacattcgg agaacacaaa 2340

caggagaaag atcttgaata cggggcatgt cctaataaca tgatgggcac gttctcagtg 2400

cggactgtgg ggacctccaa gtccaagtac cctttagtgg ttaggattta catgagaatg 2460

aagcacgtca gggcgtggat acctcgcccg atgcgtaacc agaactacct atttaaagcc 2520

aacccaaatt atgctggcaa ctccattaag ccaactggcg ccagtcgcac agcgatcacc 2580

actctttaa 2589

<210> 7

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

gacaatccag tcacggacga acat 24

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

ggcaaaggtt tcaatgccgg 20

Claims

1. The enterovirus 71 type virus-like particle is characterized in that SF9 insect cells are infected by recombinant baculovirus expressing enterovirus 71 type P1 capsid protein genes and 3CD protease genes, and the recombinant baculovirus is obtained after the SF9 insect cells are cultured to over 90 percent of infection lesions, wherein the preparation method of the recombinant baculovirus expressing enterovirus 71 type P1 capsid protein genes and 3CD protease genes comprises the following steps:

Then the recombinant plasmid pOET5-EV-A71-P1 is subjected to ^CHI3 The method comprises the steps of co-transfecting SF9 insect cells by 3CD and insect baculovirus genome Flash-BAC DNA, culturing to over 90% of SF9 insect cells, and obtaining recombinant baculovirus expressing enterovirus 71 type P1 capsid protein gene and 3CD protease gene after infection and lesion;

2. The preparation method of the enterovirus 71 type virus-like particle is characterized by comprising the following steps of:

step 1: construction of recombinant plasmid pOET5-EV-A71-P1 ^CHI3 -3CD

The nucleotide sequence of the VP1 linear neutralization epitope of the first CV-A10 after SF9 insect cell preference codon optimization is shown as SEQ ID NO.3, the nucleotide sequence of the VP1 linear neutralization epitope of the second CV-A10 after SF9 insect cell preference codon optimization is shown as SEQ ID NO.4, the nucleotide sequence of the VP1 linear neutralization epitope of the CV-A16 after SF9 insect cell preference codon optimization is shown as SEQ ID NO.5, the nucleotide sequence of the P1 capsid protein gene of the wild type enterovirus 71 is shown as SEQ ID NO.6, and the nucleotide sequence of the P1 capsid protein gene EV-A71-P1 of the enterovirus 71 after codon optimization is shown as SEQ ID NO.6 ^CHI3 Is a nucleoside of (2)The nucleotide sequence of the 3CD protease gene optimized by the preferential codon of the SF9 insect cell is shown as SEQ ID NO.1, and the nucleotide sequence of the 3CD protease gene optimized by the preferential codon of the SF9 insect cell is shown as SEQ ID NO. 2;

step 2: construction of recombinant baculovirus rBV-EV-A71-P1 ^CHI3 -3CD

Step 3: preparation and purification of virus-like particles

3. The method for producing enterovirus 71-type virus-like particles according to claim 2, wherein in step 3, the recombinant baculovirus rBV-EV-A71-P1 ^CHI3 -3CD infection of SF9 insect cells with a multiplicity of infection MOI of 3, the SF9 insect cells having a density of 2X 10 ⁶ /mL。

4. The method for producing enterovirus 71-type virus-like particles according to claim 2, wherein in step 3, the temperature of the culture is 27 ℃, the shaking speed is 110 rpm, and the time is 5d to 6d.

5. The method for preparing enterovirus 71-type virus-like particles according to claim 2, wherein in step 3, the purification is specifically performed by:

step 3.1: concentrating the supernatant

Mixing the supernatant with PEG8000 and 0.6M NaCl solution with mass percentage concentration of 20% at equal volume, stirring overnight at 4deg.C, centrifuging at 8000 rpm for 30min, discarding supernatant, collecting protein precipitate,re-suspending the protein precipitate with PBS buffer to obtain virus concentrate; the PBS buffer solution contains KH ₂ PO ₄ 2mM、Na ₂ HPO ₄ 8mM, 136mM NaCl and KCl 2.6mM, pH 7.2;

step 3.2: sucrose density gradient ultracentrifugation

6. An enterovirus 71-like particle vaccine comprising the enterovirus 71-like particle of claim 1 as an active ingredient or one of the active ingredients.

7. The enterovirus 71 type virus-like particle vaccine according to claim 6, wherein the enterovirus 71 type virus-like particle vaccine is in the form of any one or more of liquid injection, injection powder and injection tablet.

8. The enterovirus 71-like particle vaccine of claim 6, further comprising an adjuvant selected from any one or more of an oil adjuvant, an oil-in-water adjuvant, a water-in-oil-in-water adjuvant, an aluminum salt, and a polysaccharide adjuvant.